The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP006256	Pseudomonas syringae pv. syringae HS191 chromosome, complete genome	5950211	2357167	2364908	5950211	tRNA	uncultured_Caudovirales_phage(71.43%)	9	NA	NA
WP_003317946.1|2357167_2358448_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.8	4.1e-97
WP_003426143.1|2358448_2359843_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_004417278.1|2359893_2360892_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_024663383.1|2360988_2361990_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	83.9	3.7e-162
WP_003317943.1|2361986_2362322_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	78.4	1.2e-43
WP_003317942.1|2362318_2362618_-	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	62.6	4.2e-29
WP_004417284.1|2362617_2362980_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	8.7e-37
WP_003317940.1|2362981_2363374_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	81.5	1.8e-56
WP_004417288.1|2363606_2364908_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.5	8.2e-61
>prophage 2
NZ_CP006256	Pseudomonas syringae pv. syringae HS191 chromosome, complete genome	5950211	3513761	3569396	5950211	capsid,tail,terminase,tRNA,protease,head,portal,integrase	Pseudomonas_phage(61.22%)	73	3519891:3519906	3568323:3568338
WP_046719568.1|3513761_3515006_-	SGNH/GDSL hydrolase family protein	NA	A0A059VA35	Pseudomonas_phage	86.5	1.5e-205
WP_046719569.1|3515002_3515182_-	hypothetical protein	NA	A0A059VK06	Pseudomonas_phage	57.1	2.6e-10
WP_046719570.1|3515238_3515769_-	DUF2514 domain-containing protein	NA	A0A059VF51	Pseudomonas_phage	84.6	3.0e-62
WP_046719571.1|3515765_3516311_-	glycoside hydrolase family 19 protein	NA	A0A2H4JHX4	uncultured_Caudovirales_phage	77.9	7.6e-77
WP_046719572.1|3516375_3517716_-|tail	tail fiber domain-containing protein	tail	A0A059VJZ6	Pseudomonas_phage	43.3	3.3e-41
WP_046719573.1|3517739_3518426_-	hypothetical protein	NA	A0A2D1GNS6	Pseudomonas_phage	38.6	3.3e-37
WP_046719574.1|3518425_3518734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046719575.1|3518742_3522438_-|tail	phage tail protein	tail	A0A2D1GNE3	Pseudomonas_phage	64.1	0.0e+00
3519891:3519906	attL	TCTGGCCGAGTTCGGT	NA	NA	NA	NA
WP_046719576.1|3522492_3523080_-|tail	tail assembly protein	tail	A0A2D1GNM2	Pseudomonas_phage	72.5	8.4e-74
WP_046719577.1|3523076_3523859_-	C40 family peptidase	NA	A0A2D1GNP8	Pseudomonas_phage	73.8	3.0e-119
WP_003370693.1|3523861_3524560_-|tail	phage minor tail protein L	tail	A0A2D1GNF3	Pseudomonas_phage	80.5	2.4e-107
WP_046719578.1|3524767_3524953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158497983.1|3524949_3525108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046719579.1|3525143_3525488_-|tail	phage tail protein	tail	A0A2D1GNJ1	Pseudomonas_phage	53.5	5.2e-31
WP_046719580.1|3525487_3528094_-|tail	phage tail tape measure protein	tail	A0A2H4PI09	Pseudomonas_phage	49.9	2.8e-177
WP_046719581.1|3528150_3528957_-	hypothetical protein	NA	A0A2H4J8D6	uncultured_Caudovirales_phage	47.8	4.3e-60
WP_002553099.1|3529016_3529163_-	hypothetical protein	NA	Q9MCA3	Pseudomonas_phage	66.7	3.6e-10
WP_005747040.1|3529219_3529657_-|tail	phage tail assembly chaperone family protein, TAC	tail	K7PJU9	Enterobacteria_phage	65.9	7.2e-38
WP_005747041.1|3529666_3530164_-	hypothetical protein	NA	H2BDC0	Pseudomonas_virus	66.5	4.7e-57
WP_046719582.1|3530228_3530597_-	DUF3168 domain-containing protein	NA	Q9MCA6	Pseudomonas_phage	64.2	3.8e-40
WP_046719583.1|3530596_3531082_-	HK97 gp10 family phage protein	NA	A0A0U3TGT7	Pseudomonas_phage	67.9	1.3e-56
WP_046719584.1|3531074_3531413_-|head	phage head closure protein	head	B5WZS5	Pseudomonas_phage	54.5	4.4e-27
WP_046719585.1|3531412_3531889_-|head,tail	phage gp6-like head-tail connector protein	head,tail	G3ENA1	Psychrobacter_phage	37.7	3.6e-14
WP_046719586.1|3531892_3532309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046719587.1|3532359_3533553_-|capsid	phage major capsid protein	capsid	H2BDB0	Pseudomonas_virus	67.6	6.8e-139
WP_003370668.1|3533549_3534413_-|protease	Clp protease ClpP	protease	A0A1V0E8B8	Vibrio_phage	62.1	5.9e-92
WP_046719588.1|3534416_3535727_-|portal	phage portal protein	portal	A0A1V0E8B9	Vibrio_phage	55.6	1.2e-136
WP_173427762.1|3535719_3535884_-	hypothetical protein	NA	Q9MCB1	Pseudomonas_phage	63.5	3.2e-07
WP_046719589.1|3535880_3537614_-|terminase	terminase large subunit	terminase	A0A2D1GNU5	Pseudomonas_phage	91.0	0.0e+00
WP_003370657.1|3537614_3538100_-|terminase	phage terminase small subunit P27 family	terminase	A0A2D1GNP3	Pseudomonas_phage	90.7	1.2e-78
WP_046719590.1|3538267_3538663_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	74.4	4.1e-56
WP_046719591.1|3538653_3538833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046719592.1|3538893_3539247_-	hypothetical protein	NA	A0A059VJW1	Pseudomonas_phage	72.8	7.2e-28
WP_046719593.1|3539246_3539618_-	hypothetical protein	NA	A0A059VK40	Pseudomonas_phage	77.2	3.4e-44
WP_144417435.1|3539673_3540699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122255693.1|3540987_3541338_+	helix-turn-helix domain-containing protein	NA	A0A2D1GNL7	Pseudomonas_phage	61.2	2.9e-29
WP_046719594.1|3541392_3541740_-	antitermination protein Q	NA	A0A2D1GNB4	Pseudomonas_phage	77.7	2.2e-45
WP_046719595.1|3541743_3542064_-	hypothetical protein	NA	A0A2D1GNG3	Pseudomonas_phage	75.5	1.1e-38
WP_046719596.1|3542355_3543636_-|integrase	site-specific integrase	integrase	A0A2D1GND4	Pseudomonas_phage	86.2	8.5e-220
WP_046719597.1|3543632_3544064_-	VRR-NUC domain-containing protein	NA	A0A2D1GNH3	Pseudomonas_phage	71.3	1.6e-50
WP_016568955.1|3544060_3544357_-	DUF1364 domain-containing protein	NA	A0A2D1GNQ4	Pseudomonas_phage	84.4	5.6e-42
WP_046719598.1|3544353_3545025_-	replication P family protein	NA	NA	NA	NA	NA
WP_046720301.1|3545021_3545798_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_046719599.1|3545809_3546478_-	phage antirepressor KilAC domain-containing protein	NA	A0A1B0YZY9	Pseudomonas_phage	53.5	1.1e-53
WP_020304837.1|3546702_3546942_-	hypothetical protein	NA	A0A2H4J0V8	uncultured_Caudovirales_phage	73.4	5.0e-25
WP_046719600.1|3547025_3547721_+	helix-turn-helix domain-containing protein	NA	A5VW98	Enterobacteria_phage	46.4	1.5e-37
WP_046719601.1|3547732_3547972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046720302.1|3548315_3548531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046719603.1|3549099_3549870_+	DUF1828 domain-containing protein	NA	A0A2H4JC42	uncultured_Caudovirales_phage	63.8	7.6e-91
WP_046719604.1|3549913_3550168_-	DUF1652 domain-containing protein	NA	NA	NA	NA	NA
WP_173427763.1|3550953_3551388_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JA92	uncultured_Caudovirales_phage	61.7	1.3e-18
WP_046719606.1|3552047_3552386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046719607.1|3552385_3552976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046719608.1|3552972_3553227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046719609.1|3553297_3554302_+	nucleoid-associated protein YejK	NA	L7TI92	Pseudomonas_virus	65.9	3.8e-122
WP_046719610.1|3554356_3554995_+	hypothetical protein	NA	K7R9L4	Vibrio_phage	41.5	3.1e-37
WP_052755357.1|3555034_3555358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052755358.1|3555354_3555660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046719612.1|3555686_3556928_+	site-specific DNA-methyltransferase	NA	A0A059VK11	Pseudomonas_phage	97.1	1.9e-237
WP_080348728.1|3557927_3558764_+	DNA cytosine methyltransferase	NA	A0A2I7QZY6	Vibrio_phage	48.0	5.8e-60
WP_144417436.1|3558778_3559657_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_046719614.1|3559834_3560047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046719615.1|3560171_3560495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005753573.1|3560532_3560745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046719616.1|3560744_3561857_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A0U4JIT5	Pseudomonas_phage	31.4	4.0e-32
WP_003315559.1|3562110_3562467_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002553164.1|3562447_3562750_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	1.8e-11
WP_046719617.1|3562753_3565132_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003367019.1|3565160_3566177_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	39.3	8.4e-29
WP_002553161.1|3566281_3566638_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_002553160.1|3566667_3566862_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_170846037.1|3566922_3567474_-	translation initiation factor IF-3	NA	A0A2I7S9Q1	Vibrio_phage	37.3	9.2e-14
WP_046719618.1|3567473_3569396_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.5	2.6e-124
3568323:3568338	attR	ACCGAACTCGGCCAGA	NA	NA	NA	NA
>prophage 3
NZ_CP006256	Pseudomonas syringae pv. syringae HS191 chromosome, complete genome	5950211	4565847	4611166	5950211	integrase,transposase,protease,tRNA	uncultured_Mediterranean_phage(30.0%)	39	4586542:4586557	4612517:4612532
WP_003421924.1|4565847_4567137_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	24.8	1.1e-22
WP_003339743.1|4567159_4568269_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_003365076.1|4568272_4569283_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_046719838.1|4569282_4570041_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_003433455.1|4570067_4571216_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_002552482.1|4571249_4571675_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	36.4	2.2e-15
WP_002552481.1|4571771_4571972_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_003433456.1|4571986_4572328_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_003433457.1|4572331_4574194_-	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	39.7	3.8e-104
WP_002552478.1|4574238_4574760_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_003365093.1|4574771_4575095_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	51.4	6.8e-25
WP_002552476.1|4575166_4575553_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.2	2.7e-52
WP_003365095.1|4575634_4576849_-	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	30.5	1.3e-31
WP_002552474.1|4576893_4577385_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_046719839.1|4577544_4578321_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_003421915.1|4578320_4579085_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_046719840.1|4579300_4580116_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_003421912.1|4580183_4580723_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_003314165.1|4580831_4581743_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	41.7	1.0e-49
WP_004418791.1|4581752_4583621_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_002552468.1|4583684_4584020_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	44.6	2.2e-10
WP_161421222.1|4584073_4585189_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	49.3	1.3e-94
WP_004418793.1|4585203_4586268_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
4586542:4586557	attL	AACACTCCCGAGCAAT	NA	NA	NA	NA
WP_046719842.1|4586637_4587534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080348754.1|4587615_4588716_-	DUF4113 domain-containing protein	NA	I6RSM4	Salmonella_phage	46.4	9.3e-82
WP_046719843.1|4588890_4589700_+|protease	YopT-type cysteine protease domain-containing protein	protease	NA	NA	NA	NA
WP_057417330.1|4590351_4591008_+	type III effector HopH1	NA	NA	NA	NA	NA
WP_046719844.1|4591109_4593251_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_046719845.1|4593274_4594285_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_122234452.1|4595630_4595741_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_024662503.1|4596718_4597324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158497988.1|4597316_4597883_-	DUF4747 family protein	NA	NA	NA	NA	NA
WP_122255747.1|4600766_4601135_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_046719847.1|4601353_4603309_-	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_024662498.1|4603301_4605617_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_024662497.1|4606143_4606557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024662496.1|4606546_4608391_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_024662495.1|4608387_4609998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024662494.1|4610008_4611166_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
4612517:4612532	attR	ATTGCTCGGGAGTGTT	NA	NA	NA	NA
>prophage 4
NZ_CP006256	Pseudomonas syringae pv. syringae HS191 chromosome, complete genome	5950211	5245473	5324124	5950211	plate,lysis,tail,tRNA	Pseudomonas_phage(51.52%)	73	NA	NA
WP_046720038.1|5245473_5248305_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.1	7.7e-80
WP_003371105.1|5248325_5249252_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_003403539.1|5249384_5250923_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_003344603.1|5251173_5251452_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_003318791.1|5251623_5252094_-	CreA family protein	NA	NA	NA	NA	NA
WP_010436747.1|5252121_5253240_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	38.6	7.8e-60
WP_002551973.1|5253329_5254553_-	Obg family GTPase CgtA	NA	NA	NA	NA	NA
WP_002551972.1|5254769_5255045_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_002551971.1|5255077_5255389_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_003344609.1|5255628_5256597_+	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	23.5	2.5e-06
WP_024662484.1|5256743_5257508_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_024662483.1|5257541_5258642_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_003408410.1|5258641_5259676_-	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_024662482.1|5259911_5260763_+	putative selenate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_046720039.1|5260759_5261557_+	ATP-binding cassette domain-containing protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.6	9.9e-09
WP_024662480.1|5261550_5262378_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003392866.1|5262374_5263142_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_046720040.1|5263209_5264937_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_046720041.1|5265142_5266030_-	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_046720042.1|5266063_5267590_-	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_046720043.1|5267748_5268696_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017279571.1|5268969_5269578_-	DUF1851 domain-containing protein	NA	NA	NA	NA	NA
WP_017279572.1|5269593_5270961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024662476.1|5271218_5272388_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_050586303.1|5272407_5272791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024662474.1|5272891_5273296_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_024662473.1|5273403_5275497_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.8	2.9e-23
WP_046720044.1|5275493_5279186_-	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	20.2	2.1e-08
WP_046720045.1|5279182_5282656_-	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
WP_046720046.1|5288611_5289823_-|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003422785.1|5290024_5291452_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A8ATH6	Listeria_phage	44.7	4.2e-18
WP_003316311.1|5291455_5292550_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_002551953.1|5292611_5292962_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	7.4e-25
WP_024662977.1|5293135_5294170_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_003316309.1|5294303_5294732_+	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_024662978.1|5294830_5295745_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_003341077.1|5295801_5296578_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003316306.1|5296681_5297020_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_003341080.1|5297141_5297789_+	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_003316303.1|5297858_5298653_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_003316302.1|5298895_5299318_-	OsmC family protein	NA	NA	NA	NA	NA
WP_003316301.1|5299520_5300165_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_016569116.1|5300176_5300872_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_024662979.1|5300906_5301743_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.9	3.1e-69
WP_003316297.1|5301739_5302789_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	58.0	5.3e-111
WP_004415847.1|5302810_5303410_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	64.7	3.0e-74
WP_016569117.1|5303821_5304334_-|lysis	lysis protein	lysis	B5TK84	Pseudomonas_phage	48.4	2.3e-27
WP_016569118.1|5304330_5304876_-	glycoside hydrolase family 19 protein	NA	A0A2H4JHX4	uncultured_Caudovirales_phage	73.9	5.3e-70
WP_024662980.1|5305106_5305604_-|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_024662981.1|5305880_5306939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010439016.1|5307194_5307761_-|tail	tail fiber assembly protein	tail	B5TK80	Pseudomonas_phage	48.0	1.0e-44
WP_024662982.1|5307768_5309229_-	hypothetical protein	NA	B5TK79	Pseudomonas_phage	39.9	1.1e-87
WP_046720047.1|5309239_5309839_-	DUF2313 domain-containing protein	NA	B5TK76	Pseudomonas_phage	71.9	3.2e-84
WP_003401993.1|5309826_5310867_-|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	70.1	5.4e-132
WP_003316288.1|5310856_5311255_-	phage GP46 family protein	NA	B5TK74	Pseudomonas_phage	62.9	3.4e-42
WP_024662984.1|5311251_5311764_-|plate	phage baseplate assembly protein	plate	B5TK73	Pseudomonas_phage	73.8	6.2e-65
WP_046720048.1|5311760_5312888_-|plate	baseplate protein	plate	B5TK72	Pseudomonas_phage	60.5	9.4e-114
WP_046720049.1|5312891_5314316_-	DNA circularization N-terminal domain-containing protein	NA	B5TK71	Pseudomonas_phage	44.3	7.0e-106
WP_046720050.1|5314312_5316472_-|tail	phage tail tape measure protein	tail	U5P420	Shigella_phage	40.7	1.2e-72
WP_103689574.1|5316471_5316678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003316280.1|5316602_5316899_-|tail	phage tail assembly protein	tail	B5TK69	Pseudomonas_phage	76.0	4.3e-34
WP_010438998.1|5316895_5317243_-|tail	phage tail tube protein	tail	B5TK68	Pseudomonas_phage	70.4	1.9e-41
WP_024683988.1|5317303_5318800_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B5TK67	Pseudomonas_phage	79.9	7.1e-234
WP_002551914.1|5318818_5319007_-	DUF2635 domain-containing protein	NA	B5TK66	Pseudomonas_phage	74.5	1.2e-13
WP_003316276.1|5319003_5319594_-	hypothetical protein	NA	B5TK65	Pseudomonas_phage	52.0	1.1e-52
WP_003394900.1|5319640_5319979_-	hypothetical protein	NA	A0A059VJW1	Pseudomonas_phage	57.9	2.0e-19
WP_003411734.1|5319959_5320349_-	hypothetical protein	NA	A0A059VK40	Pseudomonas_phage	76.4	2.3e-43
WP_003372740.1|5320471_5321644_-	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_003372742.1|5321646_5321841_-	Com family DNA-binding transcriptional regulator	NA	B5TK59	Pseudomonas_phage	89.5	6.1e-13
WP_003422750.1|5322113_5322557_-	hypothetical protein	NA	A0A2H4J8A5	uncultured_Caudovirales_phage	45.8	3.5e-24
WP_024639984.1|5322746_5323358_+	helix-turn-helix domain-containing protein	NA	A0A0M4QWY1	Salmonella_phage	49.2	2.0e-49
WP_002551908.1|5323511_5323760_+	DUF1654 domain-containing protein	NA	NA	NA	NA	NA
WP_003316268.1|5323881_5324124_+	pyocin activator PrtN family protein	NA	A0A2H4J8B4	uncultured_Caudovirales_phage	51.2	1.9e-16
>prophage 5
NZ_CP006256	Pseudomonas syringae pv. syringae HS191 chromosome, complete genome	5950211	5423685	5460600	5950211	holin,transposase,protease	Alteromonas_virus(16.67%)	29	NA	NA
WP_144417441.1|5423685_5424069_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_024661745.1|5424280_5425168_+	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_024649925.1|5425432_5425786_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_024661746.1|5425785_5426088_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_046720090.1|5426107_5426626_-	glycine cleavage system protein R	NA	NA	NA	NA	NA
WP_046720091.1|5426948_5429126_+	malate synthase G	NA	NA	NA	NA	NA
WP_003372457.1|5429191_5429638_-	response regulator	NA	A0A220YL79	Alteromonas_virus	29.6	2.8e-05
WP_046720361.1|5429869_5431804_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_003372461.1|5431800_5432514_+	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_003316170.1|5432539_5432842_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_003316169.1|5432838_5433072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046720092.1|5433483_5435109_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.6	2.5e-67
WP_010407061.1|5435467_5435926_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_046720093.1|5436050_5437154_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_046720095.1|5437947_5438895_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_170846044.1|5438959_5439808_+|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_044309129.1|5439804_5440983_+|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	36.4	2.9e-25
WP_010407077.1|5441238_5442492_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.5	3.5e-101
WP_003316161.1|5442509_5443760_+	sarcosine oxidase subunit beta family protein	NA	NA	NA	NA	NA
WP_003316160.1|5443775_5444072_+	sarcosine oxidase subunit delta	NA	NA	NA	NA	NA
WP_024663464.1|5444068_5447089_+	sarcosine oxidase subunit alpha	NA	NA	NA	NA	NA
WP_003393613.1|5447139_5447772_+	sarcosine oxidase subunit gamma family protein	NA	NA	NA	NA	NA
WP_003319123.1|5447969_5448827_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_046269329.1|5448935_5450135_+	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	27.7	2.2e-12
WP_046720097.1|5451298_5457127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003372491.1|5457348_5457912_+	DUF2780 domain-containing protein	NA	NA	NA	NA	NA
WP_052755370.1|5457891_5458959_-	RHS repeat-associated core domain-containing protein	NA	B6SD27	Bacteriophage	39.8	7.0e-26
WP_003432549.1|5459009_5459903_-	acyltransferase	NA	NA	NA	NA	NA
WP_003432546.1|5460096_5460600_+|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
>prophage 6
NZ_CP006256	Pseudomonas syringae pv. syringae HS191 chromosome, complete genome	5950211	5677331	5727950	5950211	plate,integrase,protease	Paramecium_bursaria_Chlorella_virus(25.0%)	44	5675253:5675276	5707675:5707698
5675253:5675276	attL	GTGGGAGCGAGCTTGCTCGCGAAG	NA	NA	NA	NA
WP_046720143.1|5677331_5678660_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	37.4	1.2e-62
WP_046720144.1|5679562_5680543_+|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_046720145.1|5680539_5680839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139271380.1|5680850_5681399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046720146.1|5681519_5682191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046720147.1|5682278_5684039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046720148.1|5684035_5684515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046720149.1|5684511_5685690_-	DUF4297 domain-containing protein	NA	NA	NA	NA	NA
WP_058396535.1|5686661_5687192_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_046720151.1|5687424_5688039_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_046720152.1|5688138_5688480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046720153.1|5688946_5689450_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_046720154.1|5689895_5690318_+	DUF1493 family protein	NA	NA	NA	NA	NA
WP_046720155.1|5690870_5691956_+	type I restriction enzyme HsdR N-terminal domain-containing protein	NA	A0A1S5SAB0	Streptococcus_phage	39.9	2.6e-68
WP_046720156.1|5692100_5692838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046720157.1|5692848_5693322_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_046720158.1|5693404_5693974_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003372272.1|5694133_5694628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046720159.1|5694665_5695940_-	OprD family porin	NA	NA	NA	NA	NA
WP_080053496.1|5696162_5696369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024662785.1|5696587_5697694_-	agmatine deiminase	NA	A7IVE6	Paramecium_bursaria_Chlorella_virus	50.6	4.2e-106
WP_046720160.1|5697699_5698578_-	N-carbamoylputrescine amidase	NA	A7IVZ1	Paramecium_bursaria_Chlorella_virus	48.5	4.6e-76
WP_046720161.1|5698891_5701804_-	aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	24.1	1.0e-18
WP_003372283.1|5702044_5703127_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	53.0	1.2e-97
WP_024661828.1|5703207_5703753_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.0	1.0e-52
WP_032609702.1|5703923_5705732_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_046720162.1|5705728_5707114_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_003372291.1|5707100_5707574_+	YiiD C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_024662922.1|5708144_5708987_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
5707675:5707698	attR	CTTCGCGAGCAAGCTCGCTCCCAC	NA	NA	NA	NA
WP_003372295.1|5708983_5709550_-	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_003434805.1|5709647_5710325_+	GMP/IMP nucleotidase	NA	NA	NA	NA	NA
WP_003372300.1|5710366_5711248_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046720163.1|5711351_5712188_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_044310331.1|5712184_5714521_+	FdhF/YdeP family oxidoreductase	NA	NA	NA	NA	NA
WP_003372307.1|5714730_5715171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046720164.1|5715304_5717239_-	RecQ family ATP-dependent DNA helicase	NA	F2NZ48	Diadromus_pulchellus_ascovirus	40.5	1.3e-54
WP_046720165.1|5717385_5718207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046720166.1|5718837_5721009_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_002551426.1|5721706_5722456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005734097.1|5722525_5723059_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_046720167.1|5723073_5724576_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_003420335.1|5724601_5725084_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_003434826.1|5725083_5726916_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_024640475.1|5726879_5727950_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
