The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011428	Salmonella enterica subsp. enterica serovar Typhimurium strain YU39 isolate YUHS 05-78 chromosome, complete genome	4886081	363737	408972	4886081	protease,coat,portal,lysis,integrase,holin	Salmonella_phage(44.78%)	68	354507:354523	417551:417567
354507:354523	attL	GATATTGAAATTCGCGT	NA	NA	NA	NA
WP_001043675.1|363737_364790_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
WP_001285275.1|365072_366176_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_000893231.1|366187_367438_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
WP_000051898.1|367643_368807_-|integrase	site-specific integrase	integrase	A0A2H5BFK7	Salmonella_phage	100.0	6.3e-230
WP_153246670.1|369036_369177_-	hypothetical protein	NA	A0A0M4QWX3	Salmonella_phage	91.3	5.2e-14
WP_001084858.1|369245_369773_-	DUF551 domain-containing protein	NA	E7C9P2	Salmonella_phage	100.0	1.8e-99
WP_000348980.1|369774_369966_-	hypothetical protein	NA	A0A2I6TD51	Escherichia_phage	100.0	2.1e-26
WP_000034216.1|369967_370807_-	hypothetical protein	NA	A0A088CC42	Shigella_phage	64.8	7.8e-65
WP_000812204.1|370803_371445_-	hypothetical protein	NA	E7C9P6	Salmonella_phage	100.0	1.7e-112
WP_001214777.1|371441_371612_-	DUF2737 family protein	NA	Q76H43	Enterobacteria_phage	100.0	1.6e-25
WP_001111291.1|371622_371916_-	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	100.0	1.4e-48
WP_001253476.1|371962_372247_-	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
WP_022630923.1|372246_372954_-	recombinase	NA	A0A1R3Y600	Salmonella_virus	99.6	2.6e-138
WP_000902087.1|372950_373094_-	hypothetical protein	NA	A0A1R3Y5R4	Salmonella_virus	100.0	2.4e-19
WP_001749553.1|373083_373272_-	DUF5444 family protein	NA	B8K1E1	Salmonella_phage	100.0	1.6e-31
WP_015995137.1|373252_373405_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	B8K1E2	Salmonella_phage	100.0	3.2e-25
WP_024144163.1|373728_374019_-	hypothetical protein	NA	A0A1R3Y5U4	Salmonella_virus	73.3	1.1e-31
WP_022630926.1|374050_374293_-	hypothetical protein	NA	U5PUY0	Salmonella_phage	58.4	7.8e-18
WP_022630927.1|374320_374521_-	Restriction inhibitor protein ral	NA	A0A1R3Y5S4	Salmonella_virus	97.0	1.1e-30
WP_001682202.1|374735_375314_+	superinfection exclusion protein B	NA	A0A075B8E6	Enterobacteria_phage	100.0	8.8e-92
WP_015975212.1|375334_375637_-	hypothetical protein	NA	A0A075B8K6	Enterobacteria_phage	100.0	3.7e-49
WP_001095984.1|375990_376641_-	LexA family transcriptional regulator	NA	B1B6L9	Salmonella_phage	100.0	5.4e-122
WP_000276884.1|376721_376907_+	hypothetical protein	NA	Q5G8T3	Enterobacteria_phage	100.0	5.4e-27
WP_000424167.1|377013_377292_+	transcriptional regulator	NA	Q5G8T2	Enterobacteria_phage	100.0	2.5e-44
WP_001125981.1|377326_377473_+	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_000067075.1|377465_378281_+	replication protein	NA	A0A075B8J2	Enterobacteria_phage	100.0	9.4e-148
WP_001248406.1|378277_379654_+	DNA helicase	NA	A0A075B8G2	Enterobacteria_phage	100.0	3.3e-254
WP_000736921.1|379727_380165_+	recombination protein NinB	NA	A8CGE3	Salmonella_phage	100.0	1.3e-79
WP_000679702.1|380161_380335_+	hypothetical protein	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
WP_000113772.1|380301_380478_+	NinE family protein	NA	I6RSQ2	Salmonella_phage	100.0	4.6e-28
WP_001531428.1|380480_380813_+	DUF2591 domain-containing protein	NA	A0A075B8G3	Enterobacteria_phage	100.0	3.5e-61
WP_000950959.1|380805_380982_+	protein ninF	NA	I6S668	Salmonella_phage	100.0	2.5e-26
WP_001129733.1|380974_381586_+	recombination protein NinG	NA	A0A075B8E9	Enterobacteria_phage	100.0	1.3e-98
WP_000036317.1|381582_381807_+	hypothetical protein	NA	Q5G8R9	Enterobacteria_phage	100.0	2.2e-38
WP_000149926.1|381803_382007_+	protein ninH	NA	Q5G8R8	Enterobacteria_phage	100.0	7.2e-33
WP_000219138.1|381987_382167_+	hypothetical protein	NA	A0A1V0E5I7	Salmonella_phage	100.0	7.1e-24
WP_001235452.1|382163_382787_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	87.0	8.3e-96
WP_022630928.1|383112_383631_+	endodeoxyribonuclease	NA	A0A1V0E5R7	Salmonella_phage	66.9	6.3e-57
WP_000738703.1|383855_384182_+|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	100.0	1.7e-52
WP_001167374.1|384165_384603_+	lysozyme	NA	Q5G8R3	Enterobacteria_phage	97.9	6.3e-74
WP_011233123.1|384620_385070_+|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	87.8	3.0e-63
WP_001028469.1|385282_385804_+	DNA-binding protein	NA	H6WRZ8	Salmonella_phage	100.0	1.9e-101
WP_000808099.1|386127_386370_+	DUF2560 family protein	NA	Q76H60	Enterobacteria_phage	100.0	1.7e-33
WP_001140562.1|386373_386763_+	hypothetical protein	NA	Q76H27	Enterobacteria_phage	100.0	3.9e-75
WP_001687044.1|386762_387167_+	hypothetical protein	NA	Q76H26	Enterobacteria_phage	100.0	1.1e-67
WP_000729923.1|387170_387659_+	hypothetical protein	NA	Q76H25	Enterobacteria_phage	100.0	1.0e-88
WP_022630929.1|387636_389136_+	DNA packaging protein	NA	Q76H24	Enterobacteria_phage	99.8	8.2e-307
WP_000774649.1|389135_391313_+|portal	portal protein	portal	A0A075B8I1	Enterobacteria_phage	100.0	0.0e+00
WP_000433852.1|391326_392238_+	scaffold protein	NA	A0A192Y6T4	Salmonella_phage	100.0	4.9e-161
WP_001196937.1|392237_393530_+|coat	coat protein	coat	Q76H21	Enterobacteria_phage	100.0	1.1e-243
WP_000538670.1|393570_394131_+	hypothetical protein	NA	C6ZR11	Salmonella_phage	100.0	9.8e-104
WP_022631114.1|394114_394615_+	Packaged DNA stabilization protein gp4	NA	I1TEJ0	Salmonella_phage	98.2	2.7e-89
WP_022631115.1|394574_395993_+	Packaged DNA stabilization protein gp10	NA	E7C9U1	Salmonella_phage	99.8	1.6e-275
WP_022631116.1|395996_396698_+	hypothetical protein	NA	B8K1I3	Salmonella_phage	98.7	1.8e-70
WP_000627695.1|396697_397153_+	DUF2824 family protein	NA	B8K1I4	Salmonella_phage	100.0	1.4e-87
WP_000964900.1|397155_397845_+	hypothetical protein	NA	E7C9U4	Salmonella_phage	100.0	4.3e-109
WP_046891324.1|397855_399205_+	phage DNA ejection protein	NA	A5VW65	Enterobacteria_phage	96.4	5.4e-241
WP_046891325.1|399204_401373_+	DNA transfer protein	NA	Q9AYY9	Salmonella_phage	94.7	0.0e+00
WP_000821346.1|401468_401888_+	hypothetical protein	NA	B9UDL3	Salmonella_phage	100.0	1.3e-73
WP_046891326.1|401932_402118_+	hypothetical protein	NA	I6RSG3	Salmonella_phage	96.7	2.8e-07
WP_046891327.1|402127_402445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001283828.1|402441_402693_-	Arc family DNA-binding protein	NA	A5VW59	Enterobacteria_phage	95.1	3.9e-36
WP_000865491.1|402798_402939_+	Arc family DNA-binding protein	NA	A0A0M4S6R9	Salmonella_phage	59.1	5.7e-05
WP_046891328.1|403037_403961_+	antirepressor	NA	A5VW58	Enterobacteria_phage	90.6	6.2e-164
WP_046891329.1|404171_406175_+	endorhamnosidase	NA	E7C9U9	Salmonella_phage	99.9	0.0e+00
WP_000671497.1|406233_407691_-	hypothetical protein	NA	E7C9N7	Salmonella_phage	100.0	1.3e-240
WP_000703639.1|407680_408613_-	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	100.0	5.5e-176
WP_000915528.1|408609_408972_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
417551:417567	attR	GATATTGAAATTCGCGT	NA	NA	NA	NA
>prophage 2
NZ_CP011428	Salmonella enterica subsp. enterica serovar Typhimurium strain YU39 isolate YUHS 05-78 chromosome, complete genome	4886081	1016869	1025601	4886081	protease,transposase	Dickeya_phage(14.29%)	7	NA	NA
WP_001201751.1|1016869_1017988_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125877.1|1017984_1019931_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|1020060_1020282_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1020605_1020926_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|1020956_1023233_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|1023424_1023883_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_085983316.1|1024345_1025601_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
>prophage 3
NZ_CP011428	Salmonella enterica subsp. enterica serovar Typhimurium strain YU39 isolate YUHS 05-78 chromosome, complete genome	4886081	1075664	1166581	4886081	protease,terminase,tRNA,lysis,integrase,tail,holin	Salmonella_phage(58.7%)	91	1078573:1078592	1142469:1142488
WP_001154025.1|1075664_1076468_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1076460_1077783_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1077763_1078468_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_022630856.1|1078467_1082934_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
1078573:1078592	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000925872.1|1083278_1085120_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1085379_1085928_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1085955_1086603_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1086664_1087855_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977713.1|1088039_1089131_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1089737_1091138_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1091338_1091800_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544849.1|1092116_1093331_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893207.1|1093575_1095012_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191399.1|1095089_1096292_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_022631098.1|1096486_1097779_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.5	1.0e-252
WP_000065276.1|1097823_1098072_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1098112_1098352_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_014344386.1|1098394_1099552_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	7.9e-217
WP_020899444.1|1099514_1102715_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	78.8	0.0e+00
WP_023139985.1|1102841_1103192_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	94.0	3.5e-59
WP_000917559.1|1103240_1103372_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	97.7	1.2e-17
WP_000981510.1|1103668_1104103_-	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	38.2	2.5e-14
WP_001555460.1|1104208_1104436_+	transcriptional regulator	NA	H6WRX5	Salmonella_phage	45.9	1.7e-14
WP_000426364.1|1104470_1104791_+	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	100.0	1.3e-52
WP_000062943.1|1104875_1105859_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	99.3	2.1e-162
WP_000800012.1|1105861_1106611_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
WP_020899441.1|1106621_1106969_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	1.8e-52
WP_000065109.1|1106965_1107424_+	ead/Ea22-like family protein	NA	S4TNP2	Salmonella_phage	77.4	7.1e-44
WP_000850457.1|1107427_1107736_+	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	69.3	1.8e-30
WP_000208142.1|1107739_1108384_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	40.7	1.8e-29
WP_001536080.1|1108383_1108641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000493384.1|1108695_1109673_-	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_022630855.1|1109684_1110281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000861985.1|1110872_1111106_+	DinI-like family protein	NA	A0A0M4REN2	Salmonella_phage	87.0	1.2e-31
WP_000763780.1|1111215_1111437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929788.1|1111521_1112124_+	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	99.0	7.5e-110
WP_001096542.1|1112332_1112944_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	98.0	2.7e-91
WP_000801757.1|1112940_1113081_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001097242.1|1113077_1113767_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	50.6	1.1e-59
WP_001534733.1|1113961_1114087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|1114222_1114672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141973.1|1115032_1115719_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_077248428.1|1115994_1116324_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	99.1	2.9e-55
WP_000984584.1|1116307_1116760_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	7.9e-80
WP_024143045.1|1116777_1117224_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	90.4	1.2e-64
WP_000867564.1|1117692_1118238_+|terminase	terminase small subunit	terminase	K7P7G0	Enterobacteria_phage	61.3	4.5e-53
WP_020899435.1|1119358_1119691_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	4.4e-35
WP_000725267.1|1119790_1120288_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|1120404_1120938_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152415.1|1121027_1121723_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000606351.1|1121732_1122470_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001576012.1|1122367_1123072_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
WP_000033415.1|1123143_1126494_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	68.6	0.0e+00
WP_000178849.1|1126532_1126775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031247858.1|1126828_1129267_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.8	7.5e-92
WP_000143167.1|1129266_1129848_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001674638.1|1130323_1131292_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_000334547.1|1131939_1132566_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_031603423.1|1132634_1132934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525490.1|1132918_1133605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|1133875_1134067_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193784.1|1134493_1137106_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|1137313_1138324_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1138489_1139032_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1139028_1140138_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|1140236_1142345_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1142357_1144265_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1142469:1142488	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000333152.1|1144279_1145533_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|1145537_1147178_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1147174_1147738_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1147993_1148161_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1148260_1148779_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156454.1|1148847_1150608_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1150793_1151246_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1151317_1152370_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1152726_1153236_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1153452_1154058_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1154044_1156198_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1156216_1156663_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_022630854.1|1156786_1158841_+	DNA helicase IV	NA	A0A1P8CWU5	Bacillus_phage	23.8	1.1e-08
WP_000424187.1|1158876_1159335_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|1159429_1160092_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001537782.1|1160265_1160679_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1160723_1161041_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1161098_1162310_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859419.1|1162524_1163073_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1163098_1163878_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|1163926_1164208_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1164204_1164534_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374050.1|1164620_1165280_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000938191.1|1165900_1166581_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 4
NZ_CP011428	Salmonella enterica subsp. enterica serovar Typhimurium strain YU39 isolate YUHS 05-78 chromosome, complete genome	4886081	1865959	1946927	4886081	protease,capsid,plate,terminase,head,portal,tRNA,integrase,tail,transposase,holin	Enterobacteria_phage(75.0%)	95	1858049:1858064	1942208:1942223
1858049:1858064	attL	CGCGTGAGCGCGATAT	NA	NA	NA	NA
WP_000173208.1|1865959_1867216_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_000174484.1|1867529_1868153_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_000988246.1|1868149_1869001_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001518537.1|1869266_1870214_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	8.6e-44
WP_001037181.1|1870338_1872024_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.3	3.9e-23
WP_000823878.1|1872068_1872347_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000985595.1|1872622_1873207_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505850.1|1873323_1874415_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000794388.1|1874573_1875839_-	DUF4427 domain-containing protein	NA	NA	NA	NA	NA
WP_001058312.1|1876333_1877452_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000070978.1|1877448_1879242_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_000147036.1|1879260_1879992_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000993803.1|1879988_1880585_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001262581.1|1880574_1880979_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000063377.1|1880975_1881824_+	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000263610.1|1881898_1883443_+	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000888114.1|1883454_1884591_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000270301.1|1884603_1884693_+	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_001526439.1|1885087_1886362_+	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_000612821.1|1886575_1888288_+	alpha,alpha-trehalase	NA	NA	NA	NA	NA
WP_000511323.1|1888350_1888605_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_000017421.1|1888773_1889508_+	flagellar brake protein YcgR	NA	NA	NA	NA	NA
WP_000776974.1|1889521_1890133_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051601.1|1890303_1891218_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000338376.1|1891314_1893048_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_000197903.1|1893110_1894181_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266937.1|1894194_1895493_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_001240769.1|1895815_1897348_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_000234826.1|1897394_1898114_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406435.1|1898333_1899878_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943475.1|1900019_1900550_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000215756.1|1900681_1901488_-	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	53.2	1.5e-65
WP_001353016.1|1901432_1901630_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001519189.1|1901822_1902119_-	zinc-ribbon domain and TM2 domain-containing protein	NA	M4ZS56	Bacillus_phage	67.2	9.0e-16
WP_000078916.1|1902254_1902395_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_001383550.1|1902585_1902846_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_001763778.1|1902888_1903989_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	99.7	6.0e-206
WP_000005430.1|1904146_1905331_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.2	3.4e-223
WP_000290450.1|1905330_1905843_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000651563.1|1905898_1906273_+	hypothetical protein	NA	A0A0A7NPZ0	Enterobacteria_phage	72.4	2.6e-36
WP_000333503.1|1906281_1906437_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_024144064.1|1906423_1909231_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	92.7	0.0e+00
WP_022631005.1|1909243_1909732_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.8	3.0e-85
WP_022631004.1|1909758_1910358_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	86.3	3.4e-86
WP_022631029.1|1911727_1912261_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	80.9	8.7e-78
WP_065305617.1|1912263_1914132_-	hypothetical protein	NA	Q7Y4D4	Escherichia_virus	55.0	1.8e-157
WP_000071724.1|1914128_1914737_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	74.9	1.5e-86
WP_001111954.1|1914729_1915626_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	3.3e-154
WP_000213447.1|1915629_1915980_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001271888.1|1915976_1916558_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.9	6.1e-101
WP_000356339.1|1916554_1917190_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_000920594.1|1917182_1917650_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_000780549.1|1917787_1918195_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	94.8	4.6e-63
WP_000072327.1|1918191_1918584_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000104350.1|1918580_1918904_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864901.1|1918906_1919107_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063103.1|1919106_1919601_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_000632335.1|1919702_1920503_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.7	2.3e-130
WP_022631073.1|1920548_1921601_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	99.1	3.7e-197
WP_001262654.1|1921623_1922460_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.3	7.9e-150
WP_000613782.1|1922614_1924366_+|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_000087812.1|1924365_1925412_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_022631072.1|1925915_1926440_-	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	52.0	8.4e-33
WP_022631071.1|1926436_1926961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001163773.1|1927024_1927360_-	hypothetical protein	NA	A0A0A7NV51	Enterobacteria_phage	90.7	4.1e-49
WP_000211257.1|1927423_1927735_-	hypothetical protein	NA	A0A0A7NPT5	Enterobacteria_phage	96.1	7.2e-48
WP_022631070.1|1927739_1928699_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	4.9e-180
WP_031247798.1|1928764_1931617_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	88.3	0.0e+00
WP_022631086.1|1931613_1932003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157878345.1|1931999_1932617_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000104303.1|1932628_1932928_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	8.2e-41
WP_000153700.1|1932924_1933191_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000985163.1|1933187_1933391_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	1.9e-25
WP_001092663.1|1933414_1933831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021654.1|1933923_1934037_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	97.3	1.6e-10
WP_000514277.1|1934033_1934276_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000159462.1|1934287_1934566_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	81.5	3.6e-35
WP_000813365.1|1934576_1934918_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	92.2	5.1e-55
WP_001001394.1|1934936_1935263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001242988.1|1935358_1935661_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	52.0	2.3e-19
WP_001440068.1|1935694_1936717_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	53.5	2.7e-99
WP_000018967.1|1936908_1937250_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_001083582.1|1937321_1937495_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001519337.1|1937686_1937824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000785857.1|1938175_1938637_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_024144067.1|1938714_1939374_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001525604.1|1939423_1939717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072527.1|1939842_1940550_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101047.1|1940573_1941386_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185666.1|1941389_1941656_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_001109130.1|1941777_1942905_-	ribonuclease D	NA	NA	NA	NA	NA
1942208:1942223	attR	ATATCGCGCTCACGCG	NA	NA	NA	NA
WP_000502119.1|1943039_1943498_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000758418.1|1943688_1945374_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	3.8e-34
WP_000290594.1|1945578_1946160_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_001221014.1|1946231_1946927_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP011428	Salmonella enterica subsp. enterica serovar Typhimurium strain YU39 isolate YUHS 05-78 chromosome, complete genome	4886081	1991944	1998753	4886081	tail,integrase	Salmonella_phage(33.33%)	11	1986807:1986829	1996522:1996544
1986807:1986829	attL	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_031247788.1|1991944_1992826_-|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
WP_001521334.1|1993298_1993487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|1993551_1993719_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050882.1|1993975_1994509_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_001013467.1|1994562_1994793_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_010989030.1|1994982_1995477_+	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001520095.1|1995536_1996391_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_000722368.1|1996764_1997118_-	YebY family protein	NA	NA	NA	NA	NA
1996522:1996544	attR	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000979702.1|1997134_1998010_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168393.1|1998010_1998385_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|1998522_1998753_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
>prophage 6
NZ_CP011428	Salmonella enterica subsp. enterica serovar Typhimurium strain YU39 isolate YUHS 05-78 chromosome, complete genome	4886081	2074203	2152863	4886081	capsid,protease,plate,terminase,head,portal,integrase,tail,transposase,holin	Salmonella_phage(81.16%)	104	2080741:2080756	2154486:2154501
WP_000502119.1|2074203_2074662_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000659236.1|2074842_2076048_-	lysine-N-methylase	NA	NA	NA	NA	NA
WP_000079806.1|2076126_2077614_-	flagellin FliC	NA	NA	NA	NA	NA
WP_000146802.1|2077870_2079274_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000287764.1|2079288_2079696_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_000204899.1|2079695_2080064_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_022630963.1|2080135_2081620_+	alpha-amylase	NA	NA	NA	NA	NA
2080741:2080756	attL	TGAAAATATCGATTTT	NA	NA	NA	NA
WP_000754695.1|2081659_2082085_-	lipoprotein	NA	NA	NA	NA	NA
WP_001535233.1|2082270_2083476_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_000790504.1|2083472_2083706_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000639596.1|2083970_2084357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000719036.1|2084476_2084791_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001276834.1|2085007_2086690_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067735.1|2086682_2087678_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000064163.1|2087670_2088378_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213257.1|2088377_2089748_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000046981.1|2089769_2090213_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000631669.1|2090209_2091427_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000132169.1|2091531_2091999_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000502811.1|2092003_2093008_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282115.1|2093004_2093418_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_000978276.1|2093417_2093795_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253410.1|2093794_2094532_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187355.1|2094541_2094811_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000616953.1|2094819_2095614_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103974.1|2095895_2096519_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524019.1|2096557_2096806_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844798.1|2096880_2097108_+	YodD family peroxide/acid resistance protein	NA	NA	NA	NA	NA
WP_000948794.1|2097417_2098233_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001119821.1|2098211_2099924_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	37.4	1.2e-19
WP_001178599.1|2100088_2100334_-	YodC family protein	NA	NA	NA	NA	NA
WP_000929134.1|2100350_2101262_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212264.1|2101437_2102358_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000785978.1|2102346_2102817_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
WP_001157322.1|2102797_2104228_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377041.1|2104301_2104997_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107430.1|2105088_2105388_-	membrane protein	NA	NA	NA	NA	NA
WP_001080680.1|2106037_2107234_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_024131109.1|2107494_2107683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2107693_2107906_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457662.1|2108360_2109629_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000394196.1|2109631_2110051_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000500831.1|2110177_2110339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001093793.1|2111532_2111745_+	hypothetical protein	NA	A0A192Y5V6	Salmonella_phage	100.0	2.7e-30
WP_000842532.1|2111741_2112155_+	hypothetical protein	NA	A0A192Y6F0	Salmonella_phage	100.0	2.9e-73
WP_122815478.1|2112202_2112316_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	100.0	4.3e-11
WP_000836773.1|2112390_2112624_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	100.0	1.2e-36
WP_022742744.1|2112737_2113343_-|tail	tail fiber assembly protein	tail	A0A192Y8L2	Salmonella_phage	100.0	2.7e-107
WP_020899405.1|2113312_2114875_-	hypothetical protein	NA	A0A192Y7M1	Salmonella_phage	100.0	1.0e-288
WP_001207832.1|2114861_2115449_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000785578.1|2115451_2116531_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	100.0	2.9e-205
WP_000605051.1|2116523_2116937_-	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	100.0	3.1e-75
WP_001273648.1|2116941_2117475_-|plate	phage baseplate assembly protein	plate	A0A192Y8K5	Salmonella_phage	100.0	8.4e-97
WP_001066630.1|2117474_2118533_-|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	100.0	1.3e-202
WP_000863827.1|2118529_2119870_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	100.0	5.2e-252
WP_000785390.1|2119903_2121832_-|tail	phage tail tape measure protein	tail	A0A192Y6D8	Salmonella_phage	100.0	0.0e+00
WP_022742746.1|2121916_2122210_-	hypothetical protein	NA	A0A192Y6C5	Salmonella_phage	100.0	2.6e-47
WP_000515952.1|2122239_2122596_-|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007996.1|2122595_2124092_-|tail	tail sheath protein	tail	A0A192Y7L1	Salmonella_phage	100.0	2.1e-278
WP_000497740.1|2124081_2124246_-	DUF2635 domain-containing protein	NA	A0A1C9II04	Salmonella_phage	100.0	1.3e-24
WP_000779216.1|2124249_2124810_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	100.0	8.0e-106
WP_001135699.1|2124806_2125319_-	hypothetical protein	NA	A0A192Y6D2	Salmonella_phage	100.0	3.5e-92
WP_000702410.1|2125290_2125695_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	100.0	3.2e-72
WP_000927378.1|2125691_2126015_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000601352.1|2126017_2126218_-	hypothetical protein	NA	A0A192Y7K5	Salmonella_phage	100.0	1.8e-28
WP_000257526.1|2126268_2127474_-|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	100.0	7.0e-224
WP_001193639.1|2127488_2128139_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_020899404.1|2128116_2129358_-|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.3	2.9e-241
WP_000605609.1|2129357_2129540_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000088175.1|2129551_2131285_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.3	0.0e+00
WP_000929171.1|2131281_2131776_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	100.0	1.7e-88
WP_001135098.1|2131901_2132252_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
WP_001379492.1|2132302_2132635_-	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
WP_001530346.1|2133097_2133490_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	100.0	2.8e-65
WP_001624504.1|2133486_2134101_-	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
WP_000422366.1|2134100_2134382_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001283169.1|2134368_2134755_-	membrane protein	NA	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_001624505.1|2134900_2135158_-	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
WP_020899401.1|2135308_2136061_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	100.0	1.8e-145
WP_020899400.1|2136074_2137064_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	99.1	4.0e-193
WP_020899399.1|2137071_2137932_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	99.7	8.4e-163
WP_001241579.1|2137948_2138338_-	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	100.0	3.7e-70
WP_000066908.1|2138334_2139228_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
WP_001684745.1|2139227_2139710_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	1.1e-87
WP_000061500.1|2139711_2140530_-	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
WP_000620702.1|2140526_2140751_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_001087402.1|2140747_2141905_-	peptidase	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
WP_000509731.1|2141901_2142456_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|2142484_2142709_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020636.1|2142806_2143502_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_001067432.1|2143707_2144046_+	hypothetical protein	NA	A0A1C9IHZ4	Salmonella_phage	100.0	7.0e-57
WP_023891434.1|2144008_2144233_-	hypothetical protein	NA	A0A1C9IHY8	Salmonella_phage	100.0	1.6e-33
WP_000997191.1|2144772_2145144_+	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	100.0	2.5e-63
WP_000080416.1|2145201_2146029_+	YfdQ family protein	NA	A0A192Y6E5	Salmonella_phage	100.0	2.6e-153
WP_000008351.1|2146165_2146705_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000215886.1|2146775_2147309_+	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	100.0	2.5e-101
WP_000224241.1|2147310_2147568_+	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	100.0	1.3e-42
WP_020899398.1|2147578_2148160_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	100.0	4.7e-109
WP_001061334.1|2148163_2148733_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_000414876.1|2148757_2149000_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_000532847.1|2149001_2149991_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000598920.1|2150282_2151080_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001738920.1|2151451_2151742_+	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
WP_001219015.1|2152389_2152863_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
2154486:2154501	attR	TGAAAATATCGATTTT	NA	NA	NA	NA
>prophage 7
NZ_CP011428	Salmonella enterica subsp. enterica serovar Typhimurium strain YU39 isolate YUHS 05-78 chromosome, complete genome	4886081	2238857	2249363	4886081		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2238857_2240171_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|2240197_2241277_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|2241281_2242055_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|2242051_2243044_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|2243049_2243601_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|2243601_2244480_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|2244527_2245427_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|2245426_2246512_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|2246888_2247782_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111841.1|2247959_2249363_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
>prophage 8
NZ_CP011428	Salmonella enterica subsp. enterica serovar Typhimurium strain YU39 isolate YUHS 05-78 chromosome, complete genome	4886081	2317671	2326842	4886081	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_022631044.1|2317671_2319705_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2319945_2320404_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197952.1|2320575_2321106_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2321162_2321630_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2321676_2322396_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|2322392_2324078_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240418.1|2324300_2325032_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2325091_2325199_+	protein YohO	NA	NA	NA	NA	NA
WP_000824855.1|2325179_2325911_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2325894_2326842_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 9
NZ_CP011428	Salmonella enterica subsp. enterica serovar Typhimurium strain YU39 isolate YUHS 05-78 chromosome, complete genome	4886081	2346249	2412645	4886081	tail,holin,lysis	Salmonella_phage(28.57%)	60	NA	NA
WP_000989296.1|2346249_2346945_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553526.1|2347098_2347983_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|2348159_2348879_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|2348875_2349121_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136409.1|2349325_2350567_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000956095.1|2350560_2351796_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275101.1|2351870_2352881_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535907.1|2352896_2354417_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_001036943.1|2354550_2355549_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628631.1|2356047_2357070_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_001526153.1|2357219_2358362_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139611.1|2358376_2359045_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
WP_000425488.1|2359374_2360232_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|2360220_2360610_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000443208.1|2360614_2361982_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000022915.1|2362198_2363086_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023807.1|2363118_2364441_+	MFS transporter	NA	NA	NA	NA	NA
WP_000488255.1|2364484_2366476_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000535000.1|2366821_2368291_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548308.1|2368480_2369344_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137961.1|2369464_2370514_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873909.1|2370592_2371450_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	2.2e-22
WP_000854414.1|2371514_2373203_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|2373219_2374158_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487287.1|2374157_2375288_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|2375656_2376838_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001213882.1|2376902_2377568_-	membrane protein	NA	NA	NA	NA	NA
WP_001519564.1|2377569_2377692_-	membrane protein	NA	NA	NA	NA	NA
WP_010989043.1|2378079_2378334_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|2378657_2379230_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169350.1|2379442_2380429_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|2380458_2381178_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|2381591_2382164_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957746.1|2382489_2384046_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000561748.1|2384152_2385958_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501623.1|2385967_2387062_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137764.1|2387061_2388087_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000203622.1|2388088_2389678_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.5	8.5e-20
WP_001094639.1|2389681_2390026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213347.1|2390416_2391607_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_001234836.1|2391634_2392330_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578121.1|2392481_2394242_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	1.9e-100
WP_000494192.1|2394366_2394651_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033440.1|2394759_2395380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|2395407_2396415_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|2396594_2396822_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256150.1|2396853_2398614_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|2398894_2399398_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|2399425_2399716_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000639473.1|2400063_2401893_+	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000022213.1|2401946_2402390_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|2402767_2403295_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000554739.1|2403297_2404539_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|2405131_2405461_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894640.1|2405757_2407089_+	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_010989045.1|2407117_2407486_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_001202279.1|2407500_2408490_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_001115840.1|2408818_2411185_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001113462.1|2411353_2411557_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|2411853_2412645_-|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 10
NZ_CP011428	Salmonella enterica subsp. enterica serovar Typhimurium strain YU39 isolate YUHS 05-78 chromosome, complete genome	4886081	2813460	2839646	4886081	holin,integrase,terminase	Salmonella_phage(68.97%)	32	2822570:2822584	2841114:2841128
WP_001110972.1|2813460_2814492_-	DUF2184 domain-containing protein	NA	A0A0U2QQI2	Escherichia_phage	45.5	1.5e-73
WP_023181116.1|2814509_2815382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046891343.1|2815402_2816977_-	NUDIX hydrolase	NA	Q6UJ14	Burkholderia_virus	48.6	1.0e-20
WP_010835735.1|2816977_2817853_-	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	45.8	1.2e-55
WP_046891344.1|2817824_2819255_-	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	37.9	5.8e-92
WP_010835733.1|2819254_2820526_-	hypothetical protein	NA	A0A0U2JTW9	Escherichia_phage	38.3	5.1e-84
WP_046891345.1|2820515_2821490_-|terminase	terminase small subunit	terminase	C5IHM0	Burkholderia_virus	37.7	7.3e-30
WP_046891346.1|2821549_2821954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046891347.1|2821943_2822495_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_046891348.1|2822491_2823118_-	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	80.2	1.3e-93
2822570:2822584	attL	TGTAACGCGTACCAT	NA	NA	NA	NA
WP_046891349.1|2823120_2823468_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	78.5	1.1e-44
WP_001749676.1|2823866_2824664_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	6.8e-151
WP_001617856.1|2824653_2824800_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_046891350.1|2824796_2825408_-	protein ninG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_046891351.1|2825616_2826219_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_001217670.1|2826553_2826793_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
WP_052753786.1|2827312_2827870_-	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	50.5	1.1e-38
WP_046891353.1|2828227_2828701_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	4.3e-68
WP_046891354.1|2828700_2829483_-	hypothetical protein	NA	A0A1V0E5L5	Salmonella_phage	92.8	8.6e-66
WP_031607904.1|2829479_2829881_-	ParB/RepB/Spo0J family partition protein	NA	S4TTI6	Salmonella_phage	99.2	6.4e-73
WP_000788825.1|2829925_2830627_-	hypothetical protein	NA	A0A0M3ULE2	Salmonella_phage	99.6	8.4e-129
WP_000024046.1|2830623_2831529_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	99.7	9.1e-176
WP_001574095.1|2831620_2831995_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000869364.1|2831960_2832197_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
WP_001009038.1|2832326_2832731_+	transcriptional regulator	NA	H6WRX4	Salmonella_phage	100.0	4.2e-72
WP_000917563.1|2833127_2833286_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	100.0	2.4e-23
WP_077941501.1|2833307_2833658_+	DNA breaking-rejoining protein	NA	S4TSN6	Salmonella_phage	94.8	1.6e-59
WP_046891356.1|2833784_2836712_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	98.6	0.0e+00
WP_077941502.1|2836674_2837832_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	1.0e-216
WP_001237031.1|2837874_2838114_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001670787.1|2838154_2838439_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001007937.1|2838416_2839646_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.1	4.9e-233
2841114:2841128	attR	TGTAACGCGTACCAT	NA	NA	NA	NA
>prophage 11
NZ_CP011428	Salmonella enterica subsp. enterica serovar Typhimurium strain YU39 isolate YUHS 05-78 chromosome, complete genome	4886081	4445784	4466204	4886081	tail,plate	Burkholderia_phage(45.0%)	26	NA	NA
WP_000587738.1|4445784_4446513_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
WP_010989092.1|4446709_4447000_-	membrane protein	NA	NA	NA	NA	NA
WP_000084331.1|4447248_4447704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526208.1|4447700_4448306_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368196.1|4448310_4450056_-|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_000359500.1|4450058_4450691_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000951736.1|4450683_4451799_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_001093501.1|4451789_4452149_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001095011.1|4452312_4453860_-	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_000703632.1|4453859_4454789_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_000593182.1|4454785_4455148_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|4455475_4456198_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|4456207_4457251_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|4457238_4457448_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271423.1|4457447_4458401_-	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_022630954.1|4458400_4460755_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	1.2e-65
WP_001185654.1|4460851_4460980_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|4460939_4461257_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|4461308_4461833_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729852.1|4461832_4463260_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|4463249_4463447_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|4463443_4463899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|4464058_4464373_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270441.1|4464385_4464991_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|4464993_4465281_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|4465856_4466204_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 1
NZ_CP011430	Salmonella enterica subsp. enterica serovar Typhimurium strain YU39 isolate YUHS 05-78 plasmid pYU39_89, complete sequence	88949	167	82669	88949	tRNA,holin,integrase,tail,portal	Escherichia_phage(94.85%)	99	122:134	20028:20040
122:134	attL	ATATTTTTCGCGT	NA	NA	NA	NA
WP_001292231.1|167_1196_+|integrase	tyrosine-type recombinase/integrase	integrase	Q5QBN6	Enterobacteria_phage	41.6	8.7e-58
WP_000349257.1|1305_1614_+	hypothetical protein	NA	Q5QBE7	Escherichia_phage	100.0	1.4e-51
WP_001557738.1|1610_2087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001557737.1|2083_2578_+	dUTP diphosphatase	NA	A0A222YYP1	Escherichia_phage	100.0	3.4e-92
WP_001557736.1|2592_3033_+	DUF2829 domain-containing protein	NA	A0A222YXY1	Escherichia_phage	100.0	2.8e-82
WP_022630895.1|3039_3816_+	hypothetical protein	NA	A0A222YXM9	Escherichia_phage	99.6	1.6e-141
WP_000113017.1|3848_4046_-	hypothetical protein	NA	A0A222YWI9	Escherichia_phage	100.0	2.9e-26
WP_001216038.1|4050_4431_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A222YZ88	Escherichia_phage	100.0	2.5e-63
WP_001190712.1|4430_4652_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_000098854.1|4760_5183_-	hypothetical protein	NA	A0A222YWI5	Escherichia_phage	100.0	1.8e-70
WP_022630896.1|5317_5707_-	DNA repair protein	NA	A0A222YZE2	Escherichia_phage	100.0	2.4e-69
WP_001443773.1|5718_5865_-	hypothetical protein	NA	A0A222YXH0	Escherichia_phage	100.0	1.7e-20
WP_001344848.1|6038_6248_+	hypothetical protein	NA	A0A222YY00	Escherichia_phage	98.6	1.1e-31
WP_001142594.1|7579_8035_-	DUF4014 family protein	NA	A0A222YXP4	Escherichia_phage	100.0	8.8e-79
WP_001557731.1|8036_8252_-	hypothetical protein	NA	A0A222YWK2	Escherichia_phage	100.0	1.3e-37
WP_001557730.1|8253_8445_-	hypothetical protein	NA	A0A222YWL3	Escherichia_phage	100.0	4.6e-29
WP_000034256.1|8431_9079_-	ead/Ea22-like family protein	NA	A0A222YWN7	Escherichia_phage	100.0	2.9e-115
WP_046891370.1|9065_9365_-	hypothetical protein	NA	A0A222YY12	Escherichia_phage	100.0	1.3e-51
WP_046891371.1|9378_10374_-	DUF968 domain-containing protein	NA	A0A222YWL6	Escherichia_phage	100.0	1.9e-198
WP_000616788.1|10472_11165_-	hypothetical protein	NA	A0A222YWF0	Escherichia_phage	100.0	5.7e-138
WP_000022451.1|11161_11473_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	97.1	3.4e-58
WP_000139729.1|11469_11694_-	hypothetical protein	NA	A0A222YYR6	Escherichia_phage	93.2	5.5e-34
WP_001018053.1|11656_11965_-	DUF4752 family protein	NA	A0A222YWQ2	Escherichia_phage	83.1	3.4e-34
WP_000072161.1|11961_12210_-	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	86.1	7.0e-30
WP_000834211.1|12206_12695_-	hypothetical protein	NA	A0A0P0ZFU9	Escherichia_phage	64.8	6.0e-41
WP_024133811.1|12998_13595_-	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	99.5	1.1e-108
WP_022630898.1|13882_14461_+	recombinase	NA	A0A222YXV2	Escherichia_phage	100.0	2.5e-78
WP_071526433.1|15134_15254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022630900.1|15272_15488_+	host cell division inhibitor Icd-like protein	NA	A0A222YWG3	Escherichia_phage	98.6	7.4e-36
WP_022630901.1|15487_16414_+	DNA-binding protein	NA	A0A222YWG0	Escherichia_phage	82.1	5.7e-141
WP_022630902.1|16473_16758_+	hypothetical protein	NA	A0A222YY28	Escherichia_phage	100.0	1.4e-45
WP_000201621.1|16903_17254_+	hypothetical protein	NA	A0A222YZD3	Escherichia_phage	100.0	9.2e-60
WP_024144056.1|17293_18205_-	hypothetical protein	NA	A0A222YYN1	Escherichia_phage	99.7	2.2e-169
WP_001557715.1|18472_19126_+	hypothetical protein	NA	A0A222YZ79	Escherichia_phage	99.1	1.4e-114
WP_000542383.1|19454_19784_+	hypothetical protein	NA	A0A222YYR0	Escherichia_phage	100.0	3.6e-58
WP_022630904.1|19776_20973_+	hypothetical protein	NA	A0A222YXT1	Escherichia_phage	96.5	8.5e-198
20028:20040	attR	ACGCGAAAAATAT	NA	NA	NA	NA
WP_022630906.1|21805_22165_-	transcriptional regulator	NA	A0A222YXG1	Escherichia_phage	97.5	2.9e-61
WP_000806445.1|22221_22560_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	100.0	1.3e-55
WP_000162415.1|22630_22933_-	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	100.0	5.9e-55
WP_001557712.1|23095_23887_+	hypothetical protein	NA	A0A222YXU3	Escherichia_phage	100.0	3.6e-152
WP_000203293.1|23883_24651_+	hypothetical protein	NA	A0A222YWF4	Escherichia_phage	100.0	4.4e-139
WP_000046500.1|24654_25635_+	hypothetical protein	NA	A0A222YXZ0	Escherichia_phage	100.0	2.5e-187
WP_000828868.1|25631_26285_+	hypothetical protein	NA	A0A222YWF1	Escherichia_phage	100.0	1.9e-103
WP_001258018.1|26344_27250_+	recombination-associated protein RdgC	NA	A0A222YY21	Escherichia_phage	100.0	2.2e-166
WP_000812238.1|27233_27914_+	hypothetical protein	NA	A0A222YXN3	Escherichia_phage	100.0	5.8e-135
WP_000045489.1|27906_28812_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A222YYM0	Escherichia_phage	100.0	1.0e-174
WP_001287145.1|28860_30522_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.8	0.0e+00
WP_000595051.1|30790_31078_-	hypothetical protein	NA	A0A222YZA7	Escherichia_phage	100.0	8.1e-46
WP_000585023.1|31070_31712_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	100.0	7.5e-116
WP_000076908.1|31999_32338_-	plasmid stabilization protein	NA	A0A222YWJ6	Escherichia_phage	100.0	2.3e-52
WP_022630907.1|32350_33307_-	recombinase	NA	A0A222YXF2	Escherichia_phage	99.7	2.9e-180
WP_001272820.1|33573_33858_+	hypothetical protein	NA	A0A222YXW1	Escherichia_phage	100.0	4.7e-38
WP_000887293.1|33857_34664_+	hypothetical protein	NA	A0A222YXK1	Escherichia_phage	100.0	7.7e-118
WP_000243176.1|34734_35193_+	hypothetical protein	NA	A0A222YWG1	Escherichia_phage	99.3	9.2e-68
WP_000020025.1|35346_35805_-	hypothetical protein	NA	A0A222YWJ4	Escherichia_phage	100.0	2.1e-88
WP_001427915.1|35821_36127_-	hypothetical protein	NA	A0A222YXX4	Escherichia_phage	99.0	3.4e-50
WP_001038834.1|36372_38070_+	hypothetical protein	NA	A0A222YWC7	Escherichia_phage	100.0	0.0e+00
WP_001396841.1|38217_38496_+	hypothetical protein	NA	A0A222YWH8	Escherichia_phage	100.0	3.1e-42
WP_001033848.1|38563_40222_+|tail	tail sheath protein	tail	A0A222YWC8	Escherichia_phage	99.8	3.7e-311
WP_000801017.1|40265_41000_+	hypothetical protein	NA	A0A222YXT7	Escherichia_phage	100.0	5.9e-125
WP_001112722.1|41067_41640_+	hypothetical protein	NA	A0A222YY02	Escherichia_phage	100.0	6.0e-101
WP_000012433.1|41648_42140_+	hypothetical protein	NA	A0A222YWE4	Escherichia_phage	100.0	3.5e-89
WP_000187859.1|42194_42746_+	hypothetical protein	NA	A0A222YWE3	Escherichia_phage	100.0	1.6e-98
WP_000021878.1|42761_43469_+	hypothetical protein	NA	A0A222YY05	Escherichia_phage	100.0	1.0e-126
WP_001077897.1|43850_44606_-	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	100.0	3.7e-138
WP_001025043.1|44994_45816_+	hypothetical protein	NA	A0A222YZ63	Escherichia_phage	99.3	7.7e-158
WP_022630908.1|45830_49613_+	structural injection transglycosylase	NA	A0A222YXR4	Escherichia_phage	97.9	0.0e+00
WP_000965099.1|49618_49993_+	hypothetical protein	NA	A0A222YXD0	Escherichia_phage	99.2	1.6e-65
WP_000156306.1|49989_51420_+	hypothetical protein	NA	A0A222YWB2	Escherichia_phage	99.2	2.9e-269
WP_000654652.1|51430_52276_+	hypothetical protein	NA	A0A222YWB7	Escherichia_phage	100.0	4.5e-161
WP_001396839.1|52667_52817_+	hypothetical protein	NA	A0A222YXS1	Escherichia_phage	98.0	7.9e-21
WP_046891372.1|52819_54895_+	hypothetical protein	NA	A0A222YWB9	Escherichia_phage	77.1	3.3e-205
WP_010835343.1|54864_55482_+|tail	tail fiber assembly protein	tail	A0A1S6KZY8	Salmonella_phage	83.6	5.3e-95
WP_022631136.1|55486_56020_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	80.3	5.7e-77
WP_077941505.1|56022_56778_-|tail	phage tail protein	tail	A0A1C9II89	Salmonella_phage	61.7	7.0e-73
WP_000904917.1|56762_57323_-	recombinase family protein	NA	A0A222YWP5	Escherichia_phage	98.9	4.7e-98
WP_000457140.1|57428_57755_+|holin	holin	holin	A0A222YZ46	Escherichia_phage	100.0	3.3e-51
WP_000526264.1|57754_58201_+	hypothetical protein	NA	A0A222YXP5	Escherichia_phage	100.0	9.2e-81
WP_000066531.1|58190_58811_+	hypothetical protein	NA	A0A222YXB2	Escherichia_phage	99.0	8.3e-80
WP_046891373.1|58803_60789_+	hypothetical protein	NA	A0A222YWA3	Escherichia_phage	92.6	1.4e-306
WP_000156172.1|60788_61157_+	hypothetical protein	NA	A0A222YWB0	Escherichia_phage	84.7	4.0e-37
WP_001043715.1|61251_62616_+	hypothetical protein	NA	A0A222YY44	Escherichia_phage	98.5	3.1e-244
WP_000094097.1|62741_63299_+	DUF4145 domain-containing protein	NA	A0A222YYQ2	Escherichia_phage	99.5	2.3e-97
WP_001244352.1|63343_63676_+	hypothetical protein	NA	A0A222YZ97	Escherichia_phage	99.1	2.6e-56
WP_143553143.1|64165_65443_+|portal	phage portal protein	portal	A0A222YXQ7	Escherichia_phage	99.8	1.2e-245
WP_001557744.1|65456_66455_+	hypothetical protein	NA	A0A222YWA7	Escherichia_phage	100.0	1.4e-182
WP_022630891.1|66655_67618_+	hypothetical protein	NA	A0A222YXV1	Escherichia_phage	100.0	3.5e-178
WP_000245715.1|68031_68256_+	host cell division inhibitor Icd-like protein	NA	A0A222YWB3	Escherichia_phage	100.0	8.8e-40
WP_000350312.1|68255_68963_+	DNA-binding protein	NA	A0A222YXY0	Escherichia_phage	99.1	1.3e-129
WP_001548248.1|68962_69160_+	hypothetical protein	NA	A0A222YWF5	Escherichia_phage	96.9	7.0e-33
WP_001273800.1|69191_69677_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	100.0	3.3e-92
WP_022630892.1|69828_76665_+	DEAD/DEAH box helicase family protein	NA	A0A222YYH3	Escherichia_phage	99.0	0.0e+00
WP_000209223.1|76701_77136_+	hypothetical protein	NA	A0A222YZ35	Escherichia_phage	100.0	2.9e-79
WP_001230915.1|77138_77399_+	hypothetical protein	NA	A0A222YXI8	Escherichia_phage	100.0	1.8e-44
WP_099145002.1|77652_78030_+	VRR-NUC domain-containing protein	NA	A0A222YXP1	Escherichia_phage	99.2	1.1e-69
WP_046891376.1|78259_78541_+	hypothetical protein	NA	A0A222YW96	Escherichia_phage	98.9	6.9e-42
WP_000077921.1|78654_79863_+	hypothetical protein	NA	A0A222YW83	Escherichia_phage	99.0	2.9e-230
WP_000467090.1|82070_82505_+	tellurite resistance TerB family protein	NA	A0A222YXQ0	Escherichia_phage	100.0	3.7e-74
WP_000579539.1|82504_82669_+	DUF3927 family protein	NA	A0A222YXW5	Escherichia_phage	100.0	1.8e-18
>prophage 1
NZ_CP011429	Salmonella enterica subsp. enterica serovar Typhimurium strain YU39 isolate YUHS 05-78 plasmid pYU39_IncA/C, complete sequence	156323	57174	128723	156323	integrase,transposase	Escherichia_phage(14.29%)	54	117404:117463	129566:130385
WP_000608644.1|57174_58437_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000976514.1|58760_59906_+	class C beta-lactamase CMY-2	NA	NA	NA	NA	NA
WP_001221666.1|59999_60533_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	6.1e-47
WP_000118520.1|60529_60847_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_001447736.1|61103_61529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000606835.1|61574_67061_+	DUF4165 domain-containing protein	NA	NA	NA	NA	NA
WP_001259346.1|67209_67917_+	DsbC family protein	NA	NA	NA	NA	NA
WP_000637384.1|67913_70361_+	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_000351984.1|70375_70693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001010740.1|70689_71220_+	S26 family signal peptidase	NA	NA	NA	NA	NA
WP_001447719.1|71182_72448_+	conjugal transfer protein TraW	NA	NA	NA	NA	NA
WP_000575345.1|72444_73116_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000983282.1|73112_74120_+	conjugal transfer protein TraU	NA	NA	NA	NA	NA
WP_001447718.1|74223_77031_+	conjugal transfer mating pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_000709517.1|77069_77930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000796664.1|78052_78694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000547566.1|78987_79308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001186917.1|79611_79797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000085160.1|80016_80985_+	AAA domain-containing protein	NA	L7TKP0	Rhizobium_phage	32.6	1.2e-29
WP_000739139.1|80995_81904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000987165.1|81964_82495_+	single-stranded DNA-binding protein	NA	A0A291LCB6	Klebsiella_phage	71.8	2.6e-42
WP_001282585.1|82589_83579_+	phage recombination protein Bet	NA	B5AX97	Iodobacteriophage	39.6	1.1e-52
WP_000706865.1|83641_84652_+	YqaJ viral recombinase family protein	NA	E0YQ48	Mycobacterium_phage	28.7	5.6e-09
WP_001067858.1|84876_85581_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001132147.1|85754_86105_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	40.0	4.8e-08
WP_000843496.1|86138_86336_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_001398208.1|86376_88854_-	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.4	2.9e-83
WP_000758221.1|88950_89391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022630998.1|89477_92624_-	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.4	1.5e-60
WP_001398209.1|92634_93927_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_001246155.1|94040_94394_-	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_000475512.1|94421_95807_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_000697969.1|95996_96677_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.1e-31
WP_022630999.1|96669_98145_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.4e-27
WP_000790483.1|98395_98827_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_000694953.1|98970_99321_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	54.3	1.9e-20
WP_001148756.1|101253_102228_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_000796235.1|103158_103830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022631000.1|103849_104638_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	5.5e-52
WP_000639434.1|107366_107648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022631019.1|108556_109882_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	1.9e-113
WP_000612626.1|110787_111135_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000817038.1|115814_116786_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.9	1.4e-150
117404:117463	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067858.1|117466_118171_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000888203.1|118339_118819_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_000347934.1|118888_122041_-	multidrug efflux RND transporter permease subunit OqxB	NA	NA	NA	NA	NA
WP_002914189.1|122064_123240_-	multidrug efflux RND transporter periplasmic adaptor subunit OqxA	NA	NA	NA	NA	NA
WP_001067858.1|123559_124264_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001376233.1|124387_124672_+	bleomycin resistance protein	NA	NA	NA	NA	NA
WP_000084745.1|124991_125384_-	NimC/NimA family protein	NA	NA	NA	NA	NA
WP_001206356.1|125868_126660_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|126665_126956_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|127067_127565_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_000845054.1|127709_128723_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
129566:130385	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCCTTTCACATTAGGCATGTTGGGGTTGCTCATTTTTTTCACTGTCGTCACTGGCGGCAGTCTGTATCTCTACCATGAGAAACAGAAGGAAAAAAAGCATCACAACGCCTAAAGAGTAACTGCGACAATGAACGTAAAGGCCAGCAATAGCTGGCCTTTTTTTATACTTGCAGTTTGAGGTGTTACATGTCACGATAAGGTAAGTGTGACATGTAACGGAAAAGGTGATTTTTTGAAAGTATCCAATGAAGATGCTCAGGCTACGGCGATCTATCTCCTCAGAGCTGCTTCGCGCCCAGCTTTCTGGCGTGACGTCCCATTCGATAAGAAACTTGAAGCCGTGGACAGCCTGAACAGCATAGGGCGATCACCATCAGAACTCACTGAATGGATTAATAAATACCTGACAGCAGAGCAAATCAATAAACTCGGGACATCAATTAGGCAACGTCGCAGAAGGGGATATGGTGTTGGTAAAAGCATAACTATAAGCGATAAAGCCCACAGGATTTTGAAGCGGTTGTCAGAAGTCGATGGTTGCAGTTTGTCAGAAGTGATCGAGAAACGCCTAGCCCGAGCTTATAAAAATACATGGGACCATAAATAGAGTGACACTAGGGGTTGCATTTTTAAAACCCGTGATAGCATCTAAATGAACCCAAACGAATAGGGGGGGCTGGCGGCGATGCCGACCATTATCCCGACAATGGAGAAATAGACCATGATGACATTGACTACCGTCTCGAAGAAAACTTCAAATAA	NA	NA	NA	NA
