The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011492	Streptomyces sp. CNQ-509 chromosome, complete genome	8039333	5701	60994	8039333	transposase	Rathayibacter_phage(33.33%)	43	NA	NA
WP_047014193.1|5701_6790_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_164492500.1|7337_8279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037730261.1|9334_9658_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_078898090.1|9667_10210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164492501.1|10492_11116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047014197.1|11112_11640_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_047014198.1|11636_11918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052770600.1|12192_12687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047014199.1|12687_13470_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_052770170.1|13849_14350_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_047014200.1|14514_16446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052770172.1|16442_17006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078898589.1|16992_17913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047020672.1|19038_19554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107086071.1|19734_22179_-	family 78 glycoside hydrolase catalytic domain	NA	A0A1P8VV88	Rathayibacter_phage	27.0	1.0e-59
WP_052770175.1|22175_24203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078898092.1|24215_25070_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_078898093.1|25066_26017_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_047014203.1|26013_27306_-	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_047014204.1|27322_28675_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_047014205.1|28667_29492_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_078898094.1|30107_31544_-	relaxase domain-containing protein	NA	NA	NA	NA	NA
WP_047014207.1|32588_33359_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_047014210.1|34502_35591_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_047014211.1|35590_36886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047014212.1|38035_38611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052770602.1|38610_39558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047014213.1|40358_40697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047014214.1|40955_41309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047019666.1|41494_45700_+	FHA domain-containing protein	NA	A0A142F150	Bacillus_phage	37.3	7.0e-21
WP_047014215.1|45820_46117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052770178.1|46125_47736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047014216.1|47863_48142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047014217.1|48173_49958_+	protein kinase	NA	S4VV57	Pandoravirus	32.1	5.1e-13
WP_164492502.1|50757_50907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047014219.1|51289_52315_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_047014220.1|52681_53188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107086073.1|53168_53957_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_047014222.1|55195_56080_+	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_047014223.1|56076_56904_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_047014199.1|58029_58812_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_052770600.1|58812_59307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047014224.1|59548_60994_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP011492	Streptomyces sp. CNQ-509 chromosome, complete genome	8039333	3594072	3645360	8039333	transposase,integrase,protease	Mycobacterium_phage(30.0%)	51	3588217:3588236	3628617:3628636
3588217:3588236	attL	CCGGCCGGGCCGTCGAGGCG	NA	NA	NA	NA
WP_047016648.1|3594072_3594813_+|protease	Clp protease	protease	A0A249XSS8	Mycobacterium_phage	41.4	7.5e-19
WP_047020085.1|3594817_3596068_-	MFS transporter	NA	NA	NA	NA	NA
WP_047016649.1|3596226_3597132_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047016650.1|3597210_3598671_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	35.4	1.5e-55
WP_047016651.1|3598764_3599169_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047016652.1|3599221_3600211_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_047016653.1|3600274_3601555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078898311.1|3601613_3602945_-	MFS transporter	NA	NA	NA	NA	NA
WP_107086218.1|3604233_3605964_+	cytochrome c oxidase subunit I	NA	NA	NA	NA	NA
WP_047020087.1|3605984_3606326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047016656.1|3606535_3608293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047016657.1|3608289_3609645_+|protease	membrane protease subunits stomatin/prohibitin	protease	NA	NA	NA	NA
WP_047016658.1|3609697_3610066_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_047016659.1|3610140_3610980_+	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
WP_047016660.1|3611083_3611704_+	Fe-S cluster assembly protein HesB	NA	NA	NA	NA	NA
WP_047016661.1|3611840_3613373_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_018836497.1|3613614_3613911_+	type II toxin-antitoxin system VapB family antitoxin	NA	NA	NA	NA	NA
WP_047020088.1|3614005_3614674_+	LytR C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_047016662.1|3614759_3615392_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_047020089.1|3615543_3615729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047016663.1|3615920_3616478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047016664.1|3616534_3617035_+	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	45.6	4.4e-07
WP_052770344.1|3617392_3619015_+	serine/threonine protein kinase	NA	A0A1M7XTW9	Cedratvirus	25.2	2.1e-13
WP_047016665.1|3620107_3620287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078898312.1|3620585_3621593_+	RNA polymerase sigma factor SigF	NA	A0A0A0RV91	Bacillus_phage	34.1	2.9e-21
WP_173534857.1|3621839_3622919_+	RNA polymerase sigma factor SigF	NA	A0A0Y0AU18	Bacillus_phage	34.4	5.6e-23
WP_047016666.1|3623131_3623356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047016667.1|3623511_3625071_+	MFS transporter	NA	NA	NA	NA	NA
WP_047016668.1|3625057_3625903_-	TetR/AcrR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_173534858.1|3626541_3627777_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RQI5	Mycobacterium_phage	28.7	2.1e-37
WP_047016669.1|3627764_3627971_-	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_078898313.1|3627967_3629257_-	replication initiation protein	NA	NA	NA	NA	NA
3628617:3628636	attR	CCGGCCGGGCCGTCGAGGCG	NA	NA	NA	NA
WP_107086121.1|3629406_3629667_-	SpdD protein	NA	NA	NA	NA	NA
WP_047016671.1|3629681_3629876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047016672.1|3629892_3630084_-	Mobile element transfer	NA	NA	NA	NA	NA
WP_047016673.1|3630101_3630695_-	DUF2637 domain-containing protein	NA	NA	NA	NA	NA
WP_047016674.1|3630778_3632110_-	conjugal transfer protein TraS	NA	NA	NA	NA	NA
WP_026276764.1|3632109_3632460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047016675.1|3632648_3633437_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047016676.1|3633549_3633957_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_078898314.1|3634002_3634470_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_047016677.1|3634466_3634796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078898671.1|3634857_3636636_-|transposase	IS481 family transposase	transposase	S5WIU1	Leptospira_phage	27.2	7.8e-14
WP_145784188.1|3637106_3637706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078898315.1|3637708_3638905_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_145784186.1|3640200_3641427_+	lactonase family protein	NA	NA	NA	NA	NA
WP_047016679.1|3641517_3642609_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_047020096.1|3642802_3643402_+	DinB family protein	NA	NA	NA	NA	NA
WP_052770347.1|3643642_3644062_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_047016680.1|3644113_3644710_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	42.0	3.8e-37
WP_047016681.1|3644712_3645360_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A248SJ97	Salicola_phage	41.0	3.7e-30
