The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011359	Edwardsiella tarda strain FL95-01 chromosome, complete genome	3620701	599424	696727	3620701	head,portal,integrase,lysis,tail,terminase,holin,tRNA,capsid,plate	Salmonella_phage(19.61%)	94	632605:632649	662159:662203
WP_005281953.1|599424_600471_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_035596886.1|600451_601216_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	53.4	4.0e-68
WP_005281948.1|601209_601842_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	53.0	6.8e-37
WP_005281946.1|602216_603158_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	36.4	6.4e-07
WP_005281944.1|603209_604196_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	36.2	1.0e-31
WP_047059180.1|604281_606840_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	24.1	1.0e-22
WP_047059181.1|607007_607664_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_035594255.1|607786_608110_-	acid-activated periplasmic chaperone HdeB	NA	NA	NA	NA	NA
WP_005281935.1|608510_610088_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.3	4.2e-11
WP_005281933.1|610340_611735_+	glutamate decarboxylase	NA	NA	NA	NA	NA
WP_005281931.1|611772_613356_+	amino acid permease	NA	NA	NA	NA	NA
WP_047059184.1|613441_614377_+	glutaminase A	NA	NA	NA	NA	NA
WP_047059186.1|614382_615678_+	amino acid permease	NA	NA	NA	NA	NA
WP_005281925.1|615662_616307_+	MarC family protein	NA	NA	NA	NA	NA
WP_005281923.1|616459_616951_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	48.8	2.1e-30
WP_005281921.1|617014_618076_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.6	3.7e-112
WP_005281918.1|618078_618555_+	regulatory protein RecX	NA	NA	NA	NA	NA
WP_005281915.1|618689_621317_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	36.5	7.9e-79
WP_002209449.1|621570_621756_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	3.8e-12
WP_035598469.1|623336_623912_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_005281908.1|623908_624337_+	DedA family protein	NA	NA	NA	NA	NA
WP_047059200.1|624399_625959_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_005281902.1|626124_626640_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_005281900.1|626753_628040_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_005281898.1|628118_628907_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_005281893.1|629100_630462_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005296478.1|630611_630860_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_005281888.1|630878_631424_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_005281887.1|631462_632221_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_005281885.1|632270_632618_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
632605:632649	attL	AGCGCCTGAACTAAGATAACGCTTTCGCTACATCCGAAAGTAGTT	NA	NA	NA	NA
WP_071842125.1|632807_633026_-	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	74.6	7.5e-28
WP_047059202.1|633108_634263_-	phage late control D family protein	NA	A0A218M4J7	Erwinia_phage	69.8	8.1e-145
WP_047059203.1|634262_634745_-|tail	phage tail protein	tail	M1TAU1	Escherichia_phage	59.2	2.7e-49
WP_047059205.1|634756_637201_-|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	63.2	1.8e-255
WP_005281629.1|637193_637334_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	80.0	2.3e-14
WP_047059207.1|637363_637657_-|tail	phage tail assembly protein	tail	Q37846	Escherichia_phage	67.5	6.4e-22
WP_005281625.1|637717_638236_-|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	83.7	1.4e-80
WP_047059209.1|638248_639436_-|tail	phage tail sheath protein	tail	S4TRX2	Salmonella_phage	83.8	2.6e-191
WP_047059211.1|639686_640037_-|tail	tail fiber assembly protein	tail	E7EKV7	Edwardsiella_phage	59.1	4.3e-33
WP_047059215.1|641445_642057_-|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	77.6	3.9e-90
WP_047059217.1|642049_642958_-|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	80.1	9.8e-130
WP_047059219.1|642962_643313_-|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	63.8	7.8e-35
WP_047059221.1|643309_643951_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	72.8	4.9e-83
WP_047059223.1|644020_644470_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	57.8	9.4e-41
WP_005281600.1|644462_644924_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	63.9	8.7e-50
WP_047059225.1|645004_645457_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7L9Y0	Escherichia_phage	36.2	6.8e-15
WP_024523588.1|645453_645951_-	glycoside hydrolase family 104 protein	NA	S4TUB1	Salmonella_phage	78.2	1.2e-73
WP_005281588.1|645937_646246_-|holin	holin	holin	O80308	Escherichia_phage	73.5	2.1e-31
WP_047059229.1|646249_646453_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	71.6	1.8e-23
WP_005281582.1|646449_646953_-|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	60.4	3.2e-53
WP_047059230.1|647046_647808_-|terminase	terminase	terminase	Q6K1I5	Salmonella_virus	60.5	3.1e-68
WP_047059231.1|647811_648915_-|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	67.5	6.3e-139
WP_047059232.1|648977_649820_-|capsid	GPO family capsid scaffolding protein	capsid	Q6K1I7	Salmonella_virus	64.6	1.5e-95
WP_047059234.1|649981_651748_+|terminase	terminase ATPase subunit family protein	terminase	A0A0M4RE51	Salmonella_phage	86.8	2.6e-304
WP_047059235.1|651747_652782_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	80.2	1.0e-162
WP_071842126.1|652809_653091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047059237.1|653350_653590_-	DinI family protein	NA	Q7Y3V9	Yersinia_phage	49.4	1.6e-15
WP_047059240.1|653874_656106_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	68.7	2.6e-285
WP_005281547.1|656102_656969_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	57.3	5.4e-85
WP_047059241.1|656968_657862_-	DNA cytosine methyltransferase	NA	W0LM09	Edwardsiella_phage	67.9	6.7e-123
WP_047059243.1|657866_658088_-	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	54.8	1.3e-16
WP_047059244.1|658087_658315_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_005281535.1|658380_658722_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	56.6	3.2e-25
WP_005281532.1|658685_658886_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	69.2	5.3e-20
WP_047059245.1|658887_659394_-	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	67.5	4.6e-60
WP_047059246.1|659429_659654_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_071842127.1|659773_660649_+	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	47.0	1.3e-70
WP_052761402.1|660661_661021_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_047059248.1|661026_662067_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4S6G4	Salmonella_phage	73.0	1.0e-146
WP_005281882.1|662323_662872_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
662159:662203	attR	AGCGCCTGAACTAAGATAACGCTTTCGCTACATCCGAAAGTAGTT	NA	NA	NA	NA
WP_035598457.1|663030_663801_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_005281876.1|663971_665315_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_005281869.1|666373_667270_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005281867.1|667283_668186_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005281865.1|668655_669372_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_047060750.1|669607_670675_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A2I6UFP9	Klebsiella_phage	50.8	1.6e-86
WP_035598454.1|670679_671801_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_047059251.1|671825_672992_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_005281856.1|673286_673625_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_005281854.1|673975_674713_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_005281851.1|674845_675826_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_005281850.1|675822_676557_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_005281848.1|676736_679310_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	37.1	4.3e-122
WP_071842160.1|685245_686031_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_047059254.1|686095_687475_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.8	3.8e-08
WP_035600477.1|687544_688300_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_005295048.1|688331_689054_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_047059256.1|689050_689527_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.6	4.2e-47
WP_035600474.1|689594_690326_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.1	1.1e-38
WP_005295051.1|690877_692071_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_047059258.1|692428_693682_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.1	5.0e-100
WP_109611109.1|693729_694785_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_005295055.1|694957_695761_-	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_047059261.1|695989_696727_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP011359	Edwardsiella tarda strain FL95-01 chromosome, complete genome	3620701	1671552	1713580	3620701	portal,integrase,tail,terminase,protease,holin	Enterobacteria_phage(38.89%)	49	1667283:1667297	1689972:1689986
1667283:1667297	attL	CCCTGGCAAATGCCG	NA	NA	NA	NA
WP_047059795.1|1671552_1672689_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	43.1	3.9e-67
WP_047059797.1|1672675_1672921_-	excisionase	NA	NA	NA	NA	NA
WP_047059798.1|1672996_1673278_-	DNA breaking-rejoining protein	NA	NA	NA	NA	NA
WP_047059800.1|1673621_1673849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047060794.1|1673945_1674428_+	hypothetical protein	NA	A0A291AWW1	Escherichia_phage	64.5	7.5e-52
WP_047059802.1|1674898_1675699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071842141.1|1675770_1676460_+	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_047059804.1|1676828_1677065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144413606.1|1677382_1677706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047059807.1|1678118_1679636_+	AAA family ATPase	NA	K7PHD1	Enterobacteria_phage	53.4	1.8e-144
WP_071842142.1|1679635_1680493_+	HNH endonuclease	NA	K7PK19	Enterobacteria_phage	39.9	4.4e-55
WP_047059810.1|1681001_1681652_-	LexA family transcriptional regulator	NA	A0A0M4QWY1	Salmonella_phage	38.9	7.2e-34
WP_047059812.1|1681742_1681949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047059814.1|1681968_1682484_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	49.6	5.4e-24
WP_035599935.1|1682675_1682855_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_035599927.1|1682901_1683186_-	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	55.7	1.6e-17
WP_047059816.1|1683145_1683418_-	BrnT family toxin	NA	K4NX81	Burkholderia_phage	67.8	3.2e-28
WP_080954948.1|1683421_1684291_+	peptidase	NA	A0A1C9IHV9	Salmonella_phage	59.6	1.4e-85
WP_047059819.1|1684283_1685267_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	49.5	2.2e-74
WP_047059821.1|1685263_1685998_+	DNA replication protein	NA	G9L6A9	Escherichia_phage	41.4	4.1e-33
WP_080954918.1|1686232_1686631_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	60.4	4.4e-34
WP_047059823.1|1686647_1686995_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	84.1	7.5e-54
WP_047059825.1|1687019_1688288_-	hypothetical protein	NA	A0A291AUQ1	Sinorhizobium_phage	32.0	2.5e-54
WP_047059826.1|1688280_1689312_-	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_047059828.1|1690034_1690373_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	47.7	1.2e-24
1689972:1689986	attR	CCCTGGCAAATGCCG	NA	NA	NA	NA
WP_047059830.1|1690375_1690927_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	73.0	4.6e-74
WP_047059831.1|1691109_1691685_+	hypothetical protein	NA	H6WRU8	Salmonella_phage	39.1	7.9e-16
WP_047059833.1|1691702_1692245_+	DUF2514 family protein	NA	A0A291AXG6	Shigella_phage	35.5	7.7e-13
WP_047059834.1|1692294_1692828_+	KilA-N domain-containing protein	NA	B8K1H1	Salmonella_phage	71.7	3.9e-70
WP_071842144.1|1692837_1693050_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_035599642.1|1693343_1693880_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	48.4	3.3e-32
WP_052761411.1|1693848_1695945_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	70.2	8.5e-286
WP_035599645.1|1695941_1696157_+	hypothetical protein	NA	K7PMB5	Enterobacterial_phage	53.7	7.0e-10
WP_047059837.1|1696153_1697668_+|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	64.1	1.9e-181
WP_047059838.1|1697612_1699613_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	67.0	1.7e-254
WP_035599650.1|1699665_1699989_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	47.7	2.0e-16
WP_047059839.1|1699981_1700263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047059840.1|1700259_1700805_+	hypothetical protein	NA	K7PKQ5	Enterobacteria_phage	43.6	3.9e-25
WP_050979633.1|1700801_1701233_+	hypothetical protein	NA	Q9EYD7	Enterobacteria_phage	42.9	6.7e-20
WP_052761412.1|1701229_1701712_+	hypothetical protein	NA	O64327	Escherichia_phage	55.2	8.8e-45
WP_068872316.1|1701723_1702110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047059841.1|1702118_1702442_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	46.2	2.6e-16
WP_047059842.1|1702419_1705236_+|tail	phage tail tape measure protein	tail	A5LH38	Enterobacteria_phage	39.3	1.1e-115
WP_047059843.1|1705235_1705565_+|tail	tail protein	tail	A0A291AWW9	Escherichia_phage	56.9	2.2e-31
WP_047059844.1|1705561_1706254_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	56.8	6.2e-76
WP_035599671.1|1706262_1706997_+	C40 family peptidase	NA	A0A0P0ZDJ9	Stx2-converting_phage	68.4	1.2e-98
WP_047059845.1|1706897_1707536_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	58.9	2.6e-60
WP_047059846.1|1707553_1710895_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	53.2	0.0e+00
WP_052761414.1|1710922_1713580_+	hypothetical protein	NA	A0A0P0ZCC1	Stx2-converting_phage	46.5	3.2e-19
>prophage 3
NZ_CP011359	Edwardsiella tarda strain FL95-01 chromosome, complete genome	3620701	1884718	1894039	3620701	tRNA	Brazilian_cedratvirus(16.67%)	11	NA	NA
WP_005293654.1|1884718_1885486_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	1.2e-06
WP_144413624.1|1885478_1886504_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_005285820.1|1886490_1886694_-	protein DsrB	NA	NA	NA	NA	NA
WP_005285818.1|1886783_1887080_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	41.1	2.4e-13
WP_047059934.1|1887084_1889472_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	23.7	2.4e-05
WP_005293646.1|1889486_1890470_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	42.6	6.4e-34
WP_106120997.1|1890657_1890702_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_005285808.1|1890870_1891227_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005293643.1|1891270_1891468_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_071523971.1|1891564_1892107_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	34.8	3.3e-16
WP_005293637.1|1892110_1894039_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.7	1.1e-127
