The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011591	Enterobacter asburiae strain CAV1043, complete genome	4753402	96958	103246	4753402		Enterobacteria_phage(66.67%)	6	NA	NA
WP_047741609.1|96958_98350_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.8	3.7e-19
WP_029742022.1|98526_99423_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	1.8e-43
WP_047741610.1|99776_100859_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	2.8e-99
WP_047741611.1|100861_101761_+	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	34.9	1.1e-29
WP_047741612.1|101813_102692_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	1.7e-107
WP_047741613.1|102694_103246_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.4	2.0e-48
>prophage 2
NZ_CP011591	Enterobacter asburiae strain CAV1043, complete genome	4753402	1001454	1061587	4753402	transposase,protease,tail	Escherichia_phage(25.0%)	57	NA	NA
WP_047741628.1|1001454_1002675_-|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
WP_155404503.1|1003804_1005001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047742028.1|1005849_1008333_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	59.2	7.5e-281
WP_047742029.1|1008274_1008712_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	62.6	1.8e-44
WP_047742030.1|1008704_1009175_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	55.8	1.7e-45
WP_047742031.1|1009174_1009669_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	65.2	4.2e-58
WP_047744392.1|1010515_1010833_-	hypothetical protein	NA	K7P7P8	Enterobacteria_phage	91.3	9.5e-48
WP_080963213.1|1010853_1011705_-	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	39.6	4.3e-34
WP_016063169.1|1011704_1011905_-	hypothetical protein	NA	K7P6F8	Enterobacteria_phage	100.0	5.6e-30
WP_047742033.1|1012069_1013089_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.9	5.1e-18
WP_047174828.1|1013103_1014318_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	29.4	6.3e-47
WP_047742034.1|1014428_1014755_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	53.9	2.4e-22
WP_023311550.1|1014907_1015246_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_023311549.1|1015245_1015806_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_032668251.1|1015823_1016534_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_023311546.1|1016638_1016905_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_047742036.1|1020345_1020960_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	34.9	1.4e-26
WP_047742037.1|1021000_1022716_-	SulP family inorganic anion transporter	NA	NA	NA	NA	NA
WP_047742038.1|1022886_1023312_-	VOC family protein	NA	NA	NA	NA	NA
WP_094169092.1|1023842_1024859_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_045354786.1|1025436_1026273_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_047742039.1|1026476_1027154_+	response regulator	NA	NA	NA	NA	NA
WP_047742040.1|1027153_1028542_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_155404500.1|1028718_1029735_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	3.7e-186
WP_047742041.1|1029911_1030358_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_045354781.1|1030456_1033612_-	multidrug efflux RND transporter permease subunit OqxB	NA	NA	NA	NA	NA
WP_023311529.1|1033635_1034811_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_023311528.1|1035147_1035501_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023338070.1|1035596_1037081_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_023311527.1|1037480_1037798_+	YebG family protein	NA	NA	NA	NA	NA
WP_047742042.1|1037859_1038381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047742043.1|1038781_1039192_+	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_047742044.1|1039235_1039691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023311523.1|1040089_1040593_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_094169092.1|1040829_1041846_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_047744398.1|1041844_1042090_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_047742046.1|1042155_1043040_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047742047.1|1043154_1044282_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_047742048.1|1044331_1045516_+	MFS transporter	NA	NA	NA	NA	NA
WP_047742049.1|1045600_1046224_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_032668247.1|1046377_1047115_+	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_023311516.1|1047391_1048102_+	osmoprotectant ABC transporter permease OsmY	NA	NA	NA	NA	NA
WP_047742050.1|1048120_1049020_+	osmoprotectant ABC transporter substrate-binding protein OsmX	NA	NA	NA	NA	NA
WP_023311514.1|1049028_1049676_+	osmoprotectant ABC transporter permease OsmW	NA	NA	NA	NA	NA
WP_047742051.1|1049675_1050824_+	osmoprotectant ABC transporter ATP-binding protein OsmV	NA	G9BWD6	Planktothrix_phage	33.0	4.9e-25
WP_052948717.1|1050926_1051730_+	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_047742052.1|1051664_1052360_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_023311510.1|1052490_1053711_-	ROK family transcriptional regulator	NA	NA	NA	NA	NA
WP_047742053.1|1053805_1054738_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047742054.1|1054859_1056113_+	MFS transporter	NA	NA	NA	NA	NA
WP_047742055.1|1056286_1056769_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_047742056.1|1056782_1057232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047742057.1|1057231_1057561_+	DUF1493 family protein	NA	NA	NA	NA	NA
WP_047742058.1|1057662_1059150_+	carboxypeptidase M32	NA	NA	NA	NA	NA
WP_080298623.1|1059306_1059846_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_032657610.1|1060020_1060485_+	acid resistance repetitive basic protein Asr	NA	NA	NA	NA	NA
WP_047742059.1|1060765_1061587_+|protease	serine protease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP011591	Enterobacter asburiae strain CAV1043, complete genome	4753402	1278096	1287547	4753402	transposase	Enterobacteria_phage(66.67%)	7	NA	NA
WP_047742145.1|1278096_1279380_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	1.3e-10
WP_045406334.1|1279507_1279828_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	88.7	3.5e-50
WP_047742146.1|1279827_1280067_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	85.9	3.7e-36
WP_047741628.1|1280132_1281353_-|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
WP_047742147.1|1281477_1281744_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	95.5	4.7e-40
WP_052948721.1|1283218_1283770_-	hypothetical protein	NA	A0A0E3GMH9	Enterobacteria_phage	35.0	9.2e-22
WP_047742150.1|1284370_1287547_-	host specificity protein J	NA	K7P7G9	Enterobacteria_phage	91.7	0.0e+00
>prophage 4
NZ_CP011591	Enterobacter asburiae strain CAV1043, complete genome	4753402	1290724	1302593	4753402	protease,integrase,holin,head	Enterobacterial_phage(58.82%)	19	1288620:1288632	1303665:1303677
1288620:1288632	attL	CGCGCTCGGCTTT	NA	NA	NA	NA
WP_047742152.1|1290724_1290988_-	DUF4035 domain-containing protein	NA	K7P7L5	Enterobacteria_phage	97.7	1.4e-41
WP_071845475.1|1291207_1291924_-|head,protease	HK97 family phage prohead protease	head,protease	K7PKL4	Enterobacterial_phage	99.3	7.6e-69
WP_047742154.1|1291930_1292416_-	hypothetical protein	NA	K7PGU7	Enterobacterial_phage	98.1	5.9e-81
WP_047742155.1|1292601_1292805_-	hypothetical protein	NA	K7PHC8	Enterobacterial_phage	68.7	5.9e-19
WP_047742156.1|1292804_1293146_-	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	96.5	1.5e-62
WP_047742157.1|1293142_1293733_-	hypothetical protein	NA	F1C588	Cronobacter_phage	86.2	7.6e-99
WP_047742160.1|1293714_1295172_-	glycosyl transferase	NA	K7PKP3	Enterobacterial_phage	72.2	5.5e-215
WP_052948722.1|1295285_1296179_-	trypsin-like peptidase domain-containing protein	NA	S5FV10	Shigella_phage	70.7	8.3e-73
WP_047742162.1|1296245_1296473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047742163.1|1296500_1296695_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	76.4	4.1e-17
WP_047742165.1|1296645_1296921_-	hypothetical protein	NA	K7PGW4	Enterobacterial_phage	93.4	1.5e-12
WP_047742166.1|1296928_1297555_-	glycoside hydrolase family 19 protein	NA	K7PJS7	Enterobacterial_phage	95.2	2.4e-111
WP_022648766.1|1297554_1297836_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	93.5	4.1e-42
WP_022648767.1|1297822_1298218_-	phage membrane protein	NA	K7PHB9	Enterobacterial_phage	99.2	9.1e-64
WP_047742167.1|1298927_1299938_+	hypothetical protein	NA	A0A0R6PIZ6	Moraxella_phage	30.6	2.0e-38
WP_047744407.1|1299951_1300329_-	DUF1133 family protein	NA	K7PGW2	Enterobacterial_phage	94.2	1.2e-57
WP_047742169.1|1300910_1301180_+	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	85.4	1.7e-37
WP_062676769.1|1301212_1301476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047742171.1|1301450_1302593_+|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	48.4	2.4e-93
1303665:1303677	attR	CGCGCTCGGCTTT	NA	NA	NA	NA
>prophage 5
NZ_CP011591	Enterobacter asburiae strain CAV1043, complete genome	4753402	3744830	3785529	4753402	transposase,integrase	Escherichia_phage(22.22%)	36	3745942:3745958	3780801:3780817
WP_000019450.1|3744830_3745811_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
3745942:3745958	attL	GCTTATTCGCACCTTCC	NA	NA	NA	NA
WP_074173020.1|3746295_3746670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071845519.1|3746758_3747484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080470126.1|3747744_3749148_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	27.6	7.8e-33
WP_047743631.1|3749556_3751077_+	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	48.5	1.4e-32
WP_047743635.1|3751669_3752362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372177.1|3752572_3754222_-	glycerone kinase	NA	NA	NA	NA	NA
WP_023336797.1|3754296_3755715_-	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_007372179.1|3755725_3756358_-	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_007372180.1|3756368_3757439_-	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_007372182.1|3757995_3759093_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_007372183.1|3759282_3759561_-	dihydroxyacetone kinase	NA	NA	NA	NA	NA
WP_007372185.1|3760121_3761219_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_009653098.1|3761308_3763234_+	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_007372187.1|3763211_3763742_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_007372188.1|3763742_3764096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372189.1|3764112_3765276_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_007372190.1|3765298_3765727_-	heme-binding protein	NA	NA	NA	NA	NA
WP_016241522.1|3766119_3767787_+	propanediol/glycerol family dehydratase large subunit	NA	NA	NA	NA	NA
WP_009652918.1|3767798_3768383_+	propanediol/glycerol family dehydratase medium subunit	NA	NA	NA	NA	NA
WP_007372193.1|3768385_3768814_+	diol dehydratase small subunit	NA	NA	NA	NA	NA
WP_007372194.1|3768824_3770636_+	diol dehydratase reactivase subunit alpha	NA	NA	NA	NA	NA
WP_032655135.1|3770689_3771493_+	aquaporin	NA	M1HJ75	Acanthocystis_turfacea_Chlorella_virus	31.5	1.6e-14
WP_024196074.1|3771544_3771874_-	acid-activated periplasmic chaperone HdeB	NA	NA	NA	NA	NA
WP_045269869.1|3772112_3773429_+|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	30.6	1.6e-35
WP_155404512.1|3774068_3775272_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.5	3.7e-100
WP_001225594.1|3775393_3775549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000459847.1|3775677_3776118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024209758.1|3776462_3776690_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000481743.1|3776805_3778230_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_023294607.1|3778355_3778982_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_080963219.1|3779245_3779656_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_094169092.1|3779654_3780671_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_047744346.1|3781729_3782653_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.7	3.6e-172
3780801:3780817	attR	GCTTATTCGCACCTTCC	NA	NA	NA	NA
WP_080963220.1|3782719_3783388_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_096147877.1|3784409_3785529_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
>prophage 6
NZ_CP011591	Enterobacter asburiae strain CAV1043, complete genome	4753402	3808150	3840894	4753402	portal,tail,terminase,holin,integrase,tRNA,head	Cronobacter_phage(73.33%)	42	3808017:3808064	3834325:3834372
3808017:3808064	attL	ATTTGGTGGCCCCTGCTGGACTTGAACCAGCGACCAAGCGATTATGAG	NA	NA	NA	NA
WP_047743673.1|3808150_3809188_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	64.4	1.3e-122
WP_047743676.1|3809191_3809758_-	phage protein	NA	Q4ZA70	Staphylococcus_virus	32.2	6.3e-18
WP_047743678.1|3809774_3810371_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	38.6	3.9e-26
WP_015460844.1|3810471_3810693_+	regulator from bacteriophage origin	NA	NA	NA	NA	NA
WP_047743681.1|3810723_3811227_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	69.5	2.1e-57
WP_047743683.1|3811236_3811431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013097409.1|3811420_3811849_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.2	5.8e-24
WP_047743685.1|3811848_3812250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047743687.1|3812316_3812550_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_047743689.1|3812540_3812873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047743697.1|3812872_3813739_+	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	92.9	1.1e-146
WP_047743699.1|3813735_3813948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047743700.1|3813949_3815965_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	75.7	1.3e-307
WP_047743701.1|3816083_3816272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047743703.1|3816248_3816569_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	78.8	5.1e-41
WP_047743704.1|3816565_3817597_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	80.8	2.5e-161
WP_047743709.1|3818148_3818853_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	76.3	5.9e-98
WP_047743711.1|3818910_3819399_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	77.3	4.4e-60
WP_047743713.1|3819395_3819899_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	72.7	1.3e-67
WP_047743715.1|3819898_3820606_+	phage protein	NA	F1BUL6	Cronobacter_phage	82.8	8.5e-105
WP_047743716.1|3820602_3821730_+	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	82.4	3.0e-176
WP_047743718.1|3821726_3822182_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	78.1	2.8e-64
WP_047743720.1|3822190_3822484_+|holin	holin	holin	A0A0M5M1H1	Salmonella_phage	53.1	1.3e-19
WP_047743722.1|3822480_3822822_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	85.1	2.5e-46
WP_047743723.1|3822821_3823187_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	58.5	5.5e-23
WP_047743726.1|3823303_3823564_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	55.8	2.0e-19
WP_047743728.1|3823751_3825719_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	68.0	1.1e-253
WP_047743729.1|3825715_3826045_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	85.7	2.1e-45
WP_047743730.1|3826041_3827226_+	phage protein	NA	F1BUK6	Cronobacter_phage	81.2	1.4e-179
WP_080963221.1|3827218_3827857_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	73.7	3.0e-77
WP_052948741.1|3827865_3829953_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	63.6	5.6e-96
WP_047743731.1|3829967_3830153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047743732.1|3830139_3830388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047743733.1|3830450_3831167_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	53.1	2.2e-60
WP_047743734.1|3831141_3831687_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	73.2	7.6e-61
WP_047743735.1|3831690_3833388_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	71.4	2.3e-212
WP_047743736.1|3833952_3834276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029741755.1|3834528_3835035_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
3834325:3834372	attR	ATTTGGTGGCCCCTGCTGGACTTGAACCAGCGACCAAGCGATTATGAG	NA	NA	NA	NA
WP_047743737.1|3835566_3837414_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_029741754.1|3837567_3839313_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.0	1.9e-76
WP_001144069.1|3839428_3839644_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_032650276.1|3839880_3840894_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.6	1.1e-108
>prophage 7
NZ_CP011591	Enterobacter asburiae strain CAV1043, complete genome	4753402	3891495	3941045	4753402	transposase,integrase	Staphylococcus_phage(27.27%)	45	3889018:3889033	3919555:3919570
3889018:3889033	attL	CATTCCTGCCGATGTC	NA	NA	NA	NA
WP_007897923.1|3891495_3892743_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_007897920.1|3892729_3894496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017384059.1|3894483_3896601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017384060.1|3896604_3897033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013036336.1|3901289_3901370_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_040063370.1|3901608_3902760_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	3.7e-41
WP_012561110.1|3903845_3904682_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_012561111.1|3904746_3905145_-	VOC family protein	NA	NA	NA	NA	NA
WP_017384070.1|3905188_3906298_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.7	2.2e-30
WP_017384071.1|3906332_3906608_-	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_023280857.1|3907819_3908803_+	oxidoreductase	NA	NA	NA	NA	NA
WP_023280966.1|3908865_3909522_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017384073.1|3909945_3910242_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023280967.1|3911100_3911589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087855188.1|3911633_3912783_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.5	5.4e-48
WP_032415320.1|3912851_3915623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000140246.1|3915827_3916157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023309180.1|3916256_3917279_+	DUF3362 domain-containing protein	NA	M1QSD9	Pseudomonas_phage	71.2	5.5e-105
WP_023309179.1|3917363_3918191_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	1.1e-63
WP_047743759.1|3918296_3919460_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_023309177.1|3919655_3920555_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
3919555:3919570	attR	CATTCCTGCCGATGTC	NA	NA	NA	NA
WP_023309176.1|3920600_3921260_-	DedA family protein	NA	NA	NA	NA	NA
WP_047743761.1|3921403_3922591_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_023309174.1|3922842_3923574_+	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_023309173.1|3923578_3924004_+	TonB system transport protein ExbD	NA	NA	NA	NA	NA
WP_023309172.1|3924046_3924496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023309171.1|3924497_3924902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023309170.1|3925005_3925509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023309169.1|3925590_3926079_+	TIGR00645 family protein	NA	NA	NA	NA	NA
WP_047743763.1|3926158_3927199_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_023309167.1|3927429_3928977_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.9	4.9e-12
WP_023309166.1|3929104_3929359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045356040.1|3929457_3929808_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_047743764.1|3929820_3930096_-	addiction module protein	NA	NA	NA	NA	NA
WP_000839182.1|3930192_3930597_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	97.8	1.6e-68
WP_000612626.1|3930593_3930941_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_008786790.1|3930989_3932528_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	93.8	1.7e-278
WP_023309163.1|3932808_3933141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047743766.1|3933301_3934168_-	glutathione-dependent disulfide-bond oxidoreductase	NA	NA	NA	NA	NA
WP_047743768.1|3934413_3936003_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023309160.1|3936048_3937002_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_047743770.1|3937007_3937853_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_047743772.1|3937845_3938823_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.1	1.0e-15
WP_047743773.1|3938819_3939797_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_040063370.1|3939893_3941045_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	3.7e-41
>prophage 8
NZ_CP011591	Enterobacter asburiae strain CAV1043, complete genome	4753402	4209346	4266165	4753402	portal,tail,capsid,terminase,integrase,transposase,tRNA	Cronobacter_phage(44.44%)	54	4248382:4248426	4265229:4265273
WP_045355806.1|4209346_4211974_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.2	8.4e-81
WP_000906486.1|4212328_4212514_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_023308940.1|4213763_4214330_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_008499541.1|4214326_4214755_+	DedA family protein	NA	NA	NA	NA	NA
WP_023308938.1|4214838_4216383_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_014884972.1|4216536_4217052_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_047743958.1|4217106_4217871_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_045357565.1|4217857_4219513_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_047743960.1|4219695_4221243_-	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_023308934.1|4221259_4222432_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_023308933.1|4222558_4223089_-	transcriptional repressor MprA	NA	NA	NA	NA	NA
WP_045357559.1|4223402_4224587_-	MFS transporter	NA	NA	NA	NA	NA
WP_045404718.1|4224778_4225774_-	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_045404715.1|4225783_4226854_-	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_047743962.1|4226837_4228049_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.3	1.9e-27
WP_047743964.1|4228380_4229340_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	72.7	6.7e-137
WP_047743966.1|4229349_4231494_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	48.9	5.6e-200
WP_023308926.1|4231466_4231877_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	45.1	4.6e-18
WP_023308925.1|4231873_4232113_-	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	43.2	2.9e-12
WP_045404711.1|4232356_4232683_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_023308923.1|4232843_4233188_+	YgaC family protein	NA	NA	NA	NA	NA
WP_047743969.1|4233220_4233670_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_047743970.1|4234166_4234571_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_023308920.1|4234609_4234789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047743972.1|4234868_4235390_-	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_023308918.1|4235399_4235699_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023308917.1|4235878_4236037_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_033146353.1|4236033_4236963_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047744346.1|4237065_4237989_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.7	3.6e-172
WP_087451024.1|4238136_4239256_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_000614783.1|4242121_4243018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023337657.1|4243014_4243911_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_047743978.1|4243900_4245457_-	recombinase family protein	NA	A0A0A7RTP8	Clostridium_phage	30.0	3.2e-19
WP_087855188.1|4245622_4246773_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.5	5.4e-48
WP_023337654.1|4246986_4248216_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	85.8	6.7e-206
4248382:4248426	attL	TTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTTCTACA	NA	NA	NA	NA
WP_047744516.1|4248540_4249518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047743979.1|4249531_4250548_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUN9	Cronobacter_phage	87.2	3.5e-176
WP_047743981.1|4250544_4251123_-	phage repressor protein CI	NA	F1BUN8	Cronobacter_phage	71.7	2.1e-77
WP_047743983.1|4251522_4252026_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	68.9	1.2e-55
WP_047743984.1|4252035_4252245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047743986.1|4252594_4254613_+	replication endonuclease	NA	F1BUS0	Erwinia_phage	58.9	1.8e-211
WP_047743988.1|4254731_4254944_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	53.1	7.1e-07
WP_047743989.1|4254917_4255241_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	83.8	1.6e-45
WP_047743991.1|4255237_4256269_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	81.1	4.2e-161
WP_047743994.1|4256265_4258041_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	82.9	6.8e-284
WP_047744519.1|4258198_4259008_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	54.0	7.8e-78
WP_047743996.1|4259061_4260591_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	80.9	3.5e-127
WP_071845529.1|4260583_4261222_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	77.2	1.9e-79
WP_052948745.1|4261230_4261923_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	71.2	4.1e-59
WP_052948748.1|4261861_4262098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047743998.1|4262072_4262618_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	68.7	9.6e-56
WP_047744000.1|4262621_4264319_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	71.6	2.3e-212
WP_047744001.1|4264880_4265165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008502505.1|4265682_4266165_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
4265229:4265273	attR	TTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTTCTACA	NA	NA	NA	NA
>prophage 9
NZ_CP011591	Enterobacter asburiae strain CAV1043, complete genome	4753402	4651071	4728234	4753402	portal,tail,capsid,protease,plate,holin,integrase,transposase,head	Salmonella_phage(19.51%)	84	4643478:4643493	4686562:4686577
4643478:4643493	attL	ACAGCGATGAAGAATT	NA	NA	NA	NA
WP_047744222.1|4651071_4651575_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_008500962.1|4651784_4652045_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_047744224.1|4652182_4653370_+	MFS transporter	NA	NA	NA	NA	NA
WP_047744226.1|4653587_4654775_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1GN00	Marinobacter_phage	30.2	2.3e-33
WP_001515618.1|4654777_4654987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047363398.1|4655031_4655604_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	83.5	1.2e-93
WP_047744230.1|4655584_4655806_-	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	59.7	1.5e-12
WP_047363404.1|4656275_4656488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016247402.1|4656494_4656716_-	TraR/DksA family transcriptional regulator	NA	A0A0P0ZCX5	Stx2-converting_phage	56.5	8.2e-14
WP_047744232.1|4656712_4657216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016247400.1|4657212_4657410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047744234.1|4657397_4657937_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	75.4	2.0e-74
WP_047352165.1|4658072_4658903_-	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	77.5	1.8e-117
WP_047744238.1|4658956_4659328_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	89.4	1.9e-55
WP_032448896.1|4660382_4661078_-	helix-turn-helix domain-containing protein	NA	Q8HAA0	Salmonella_phage	69.6	2.1e-87
WP_047744242.1|4661175_4661439_+	helix-turn-helix transcriptional regulator	NA	A0A0P0ZCZ7	Stx2-converting_phage	58.6	4.5e-19
WP_047744243.1|4661431_4661980_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	67.6	1.1e-67
WP_024191785.1|4662152_4662338_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	67.3	1.7e-12
WP_001515603.1|4662321_4663254_+	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	51.7	3.3e-80
WP_047744244.1|4663250_4664585_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	50.8	2.2e-117
WP_047744245.1|4665272_4665965_+	antirepressor	NA	G0ZND1	Cronobacter_phage	55.1	5.3e-59
WP_047744246.1|4665961_4667023_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	56.3	4.9e-112
WP_047744248.1|4667044_4667737_+	antitermination protein	NA	NA	NA	NA	NA
WP_000016608.1|4668206_4668962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000116520.1|4668961_4669366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047744255.1|4669575_4670628_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	81.7	6.8e-175
WP_047744257.1|4670696_4671038_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	53.3	2.4e-28
WP_155404508.1|4671021_4671465_+	glycoside hydrolase family protein	NA	A0A0M4R365	Salmonella_phage	68.5	1.7e-47
WP_047744261.1|4671461_4672007_+	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	82.9	6.6e-65
WP_047744263.1|4672149_4672701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047744265.1|4672834_4673476_+	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	32.1	8.2e-06
WP_000210383.1|4673714_4674284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016239512.1|4674225_4676349_+	hypothetical protein	NA	A0A2K9V3X4	Faecalibacterium_phage	35.9	2.3e-97
WP_000483309.1|4676357_4676621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001045359.1|4676620_4678258_+|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	35.2	3.3e-91
WP_001052909.1|4678254_4679121_+	S49 family peptidase	NA	A0A2D1GN02	Marinobacter_phage	37.9	4.8e-49
WP_047744268.1|4679122_4679692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001472189.1|4679691_4680096_+|head	head decoration protein	head	NA	NA	NA	NA
WP_047744270.1|4680193_4681243_+|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	33.7	4.7e-51
WP_047744272.1|4681214_4681625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000537794.1|4681629_4681989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045888904.1|4681985_4682531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000497745.1|4682534_4682732_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_047744274.1|4682728_4684231_+|tail	tail protein	tail	B5TK67	Pseudomonas_phage	42.2	2.5e-101
WP_000896638.1|4684234_4684606_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_047744276.1|4684607_4684886_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_047744279.1|4685027_4686887_+	hypothetical protein	NA	T1SBJ1	Salmonella_phage	40.1	3.8e-19
4686562:4686577	attR	ACAGCGATGAAGAATT	NA	NA	NA	NA
WP_047744281.1|4686949_4687684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047744539.1|4687746_4689150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001548480.1|4689146_4690232_+	hypothetical protein	NA	M1PVV2	Vibrio_phage	31.2	1.3e-43
WP_000900614.1|4690270_4690813_+|plate	baseplate assembly protein	plate	A0A077KAY0	Edwardsiella_phage	30.8	5.9e-05
WP_001279799.1|4690809_4691247_+	hypothetical protein	NA	B5TK74	Pseudomonas_phage	45.8	4.0e-12
WP_047744284.1|4691248_4692391_+|plate	baseplate J/gp47 family protein	plate	A0A0A8WEY6	Clostridium_phage	27.9	3.1e-11
WP_047744286.1|4692387_4692981_+	YmfQ family protein	NA	NA	NA	NA	NA
WP_047744288.1|4694832_4695099_-	DinI family protein	NA	K7PKR6	Enterobacteria_phage	93.2	1.4e-39
WP_000343760.1|4695198_4696419_-|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
WP_047744290.1|4696523_4696763_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	93.6	2.6e-37
WP_047744292.1|4696762_4697083_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	76.4	1.9e-43
WP_047744294.1|4698639_4700400_-	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_008500958.1|4700419_4700647_-	YejL family protein	NA	NA	NA	NA	NA
WP_021241524.1|4700781_4701789_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.9	7.7e-83
WP_023312497.1|4701841_4702126_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_047744296.1|4702251_4704012_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.4	1.7e-101
WP_045354252.1|4704164_4704872_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_047744298.1|4706362_4706707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047744300.1|4706710_4708300_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.8	1.0e-17
WP_032641492.1|4708301_4709327_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_023312491.1|4709326_4710421_-	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_047744301.1|4710430_4712236_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_047744304.1|4712310_4713867_-	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_008500946.1|4713994_4714564_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	3.6e-13
WP_047744305.1|4714991_4715705_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_047744307.1|4715726_4716713_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_047744309.1|4716837_4718304_-	fructuronate reductase	NA	E5EQS6	Micromonas_sp._RCC1109_virus	30.0	6.9e-40
WP_047744311.1|4718509_4719700_+	mannonate dehydratase	NA	NA	NA	NA	NA
WP_008500940.1|4719819_4720392_-	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_071845539.1|4720752_4721007_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_045414638.1|4721187_4721877_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_045414636.1|4722342_4722561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045414634.1|4723050_4723665_-	serine recombinase	NA	A0A0A8WJD4	Clostridium_phage	27.5	4.6e-06
WP_047744314.1|4724018_4724393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045414632.1|4725084_4725675_-	hypothetical protein	NA	K4F7I7	Cronobacter_phage	76.0	4.6e-80
WP_045414749.1|4725950_4726520_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_085950818.1|4727113_4728234_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
>prophage 1
NZ_CP011588	Enterobacter asburiae strain CAV1043 plasmid pCAV1043-58, complete sequence	58427	5421	19198	58427	integrase,protease,transposase	Escherichia_phage(33.33%)	16	7994:8008	11635:11649
WP_010455375.1|5421_6543_-|transposase	ISAs1-like element ISPa60 family transposase	transposase	NA	NA	NA	NA
WP_010454871.1|6897_7701_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	36.2	5.2e-34
WP_024012635.1|7693_9193_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	26.7	1.8e-11
7994:8008	attL	CGGCAGATCAGCAAA	NA	NA	NA	NA
WP_047741489.1|10114_10306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047741491.1|10338_10635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047741493.1|10649_11609_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJ76	Virus_Rctr85	29.0	1.4e-12
WP_047389784.1|11667_12363_-|transposase	IS6-like element ISEas1 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	37.0	4.9e-36
11635:11649	attR	CGGCAGATCAGCAAA	NA	NA	NA	NA
WP_052132604.1|12673_12976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047389782.1|13126_13747_+	ParA family protein	NA	A2I303	Vibrio_virus	35.0	1.8e-21
WP_047389780.1|13785_14013_+	DNA partition complex ParG	NA	NA	NA	NA	NA
WP_047389778.1|14144_14429_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_047389775.1|14421_14664_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_087451024.1|15220_16341_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_052132603.1|16949_17192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047389771.1|18008_18269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040080118.1|18379_19198_-|protease	metalloprotease	protease	NA	NA	NA	NA
>prophage 1
NZ_CP011590	Enterobacter asburiae strain CAV1043 plasmid pCAV1043-97, complete sequence	96842	10208	50387	96842	transposase,integrase	Escherichia_phage(23.53%)	40	23730:23747	42123:42140
WP_001067855.1|10208_10913_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_071845418.1|11416_11944_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_003032103.1|11967_12492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032192077.1|13341_14106_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003032097.1|14332_15118_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003032095.1|15122_16097_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_003032093.1|16109_16922_+	PfkB domain-containing protein	NA	NA	NA	NA	NA
WP_047741574.1|18063_18987_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.7	4.6e-175
WP_008502228.1|19268_19970_-	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_006687059.1|20035_21142_-	alkene reductase	NA	NA	NA	NA	NA
WP_008502229.1|21354_21684_+	thioredoxin family protein	NA	V9SJ74	Achromobacter_phage	34.7	9.7e-11
WP_000888080.1|21713_22052_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_008502230.1|22056_22638_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047741551.1|22779_23337_-	OsmC family protein	NA	NA	NA	NA	NA
WP_008502231.1|23522_24107_-	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	36.1	2.6e-22
23730:23747	attL	ATCCCGCTCAAACTCCGC	NA	NA	NA	NA
WP_155404497.1|24523_25730_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.9	2.3e-102
WP_148752318.1|25722_25989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015386429.1|26469_27678_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	1.6e-47
WP_047353163.1|28018_30016_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.2	2.0e-21
WP_023304011.1|30079_31372_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_047741556.1|31412_32393_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	4.4e-184
WP_004153649.1|33456_33663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152336.1|33708_34017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152337.1|34044_34374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152338.1|34441_34798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152339.1|34804_35137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152340.1|35136_35919_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	4.6e-51
WP_011977773.1|36810_37041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045340523.1|37132_37606_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_004152347.1|37986_38319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001553819.1|38761_41659_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_000509966.1|41753_42359_+	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
42123:42140	attR	GCGGAGTTTGAGCGGGAT	NA	NA	NA	NA
WP_047741558.1|42355_43339_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	62.4	7.0e-105
WP_004152349.1|43335_44541_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.0	7.3e-205
WP_004152350.1|44862_45759_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	53.8	3.3e-69
WP_004152351.1|46159_47431_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	3.6e-154
WP_004152352.1|47430_47862_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.5	1.0e-28
WP_047741561.1|48187_48940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568071.1|49058_49847_+	DsbA family protein	NA	NA	NA	NA	NA
WP_001568070.1|49850_50387_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	37.7	2.6e-21
>prophage 2
NZ_CP011590	Enterobacter asburiae strain CAV1043 plasmid pCAV1043-97, complete sequence	96842	68877	79311	96842	transposase	uncultured_Caudovirales_phage(37.5%)	10	NA	NA
WP_072199090.1|68877_69297_+	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	33.6	1.1e-06
WP_020806042.1|69333_69543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000427623.1|70117_71122_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_023316432.1|71296_71722_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.1	1.9e-51
WP_032409266.1|71734_73024_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.4	3.4e-168
WP_047721846.1|73068_73365_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	44.3	2.0e-15
WP_155404496.1|73488_74505_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.4e-185
WP_000817038.1|75422_76394_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.9	1.4e-150
WP_000523812.1|76393_77560_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	3.0e-224
WP_000200069.1|78300_79311_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	53.9	6.7e-87
>prophage 1
NZ_CP011589	Enterobacter asburiae strain CAV1043 plasmid pKPC_CAV1043, complete sequence	59138	0	9617	59138	integrase,transposase	Burkholderia_phage(42.86%)	8	3150:3167	10334:10351
WP_001749982.1|0_720_+	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	28.9	8.6e-20
WP_001749988.1|2676_3246_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
3150:3167	attL	CCTGATAGATTTGCTCAC	NA	NA	NA	NA
WP_000845048.1|3638_4652_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_004201280.1|4807_5281_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001144737.1|5501_5768_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_001389365.1|5910_6675_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_004098817.1|6935_8150_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001288432.1|8183_9617_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
10334:10351	attR	GTGAGCAAATCTATCAGG	NA	NA	NA	NA
