The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007686	Listeria monocytogenes strain L2624 chromosome, complete genome	2932501	126180	132707	2932501	tail	Listeria_phage(33.33%)	10	NA	NA
WP_003728215.1|126180_126633_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A059T7S0	Listeria_phage	47.9	4.0e-31
WP_003721740.1|126638_126974_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JAR9	uncultured_Caudovirales_phage	52.5	4.0e-20
WP_009927883.1|127190_127619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731177.1|127630_128047_+	hypothetical protein	NA	A8ASQ1	Listeria_phage	37.9	6.5e-20
WP_003728212.1|128326_128716_+	DUF5072 family protein	NA	NA	NA	NA	NA
WP_003721744.1|128728_129241_+|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	62.7	1.2e-47
WP_003721745.1|129288_129591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003740367.1|129632_130037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047921199.1|130023_131892_+	membrane protein	NA	A0A097PAU2	Streptococcus_pyogenes_phage	45.8	4.5e-20
WP_003734720.1|131888_132707_+|tail	phage tail family protein	tail	A0A060AFE1	Staphylococcus_phage	35.0	7.2e-39
>prophage 2
NZ_CP007686	Listeria monocytogenes strain L2624 chromosome, complete genome	2932501	1129032	1161474	2932501	integrase,transposase	Streptococcus_phage(64.0%)	33	1123033:1123053	1165788:1165808
1123033:1123053	attL	AATATGAGTATTTTAGTAACA	NA	NA	NA	NA
WP_003730941.1|1129032_1129416_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	40.7	1.4e-16
WP_003727002.1|1129437_1130421_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	33.8	2.0e-11
WP_023550414.1|1130435_1131449_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	31.2	1.8e-10
WP_003721509.1|1131657_1133148_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	49.7	9.5e-114
WP_023550416.1|1133159_1133984_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.2	1.3e-67
WP_009929872.1|1133996_1134305_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_009929871.1|1134365_1134770_+	PTS lactose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_023550418.1|1134898_1136455_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	29.2	6.0e-18
WP_000237798.1|1136522_1137716_-|integrase	site-specific integrase	integrase	A0A0S2MV79	Bacillus_phage	34.0	2.4e-43
WP_000633909.1|1137742_1137943_-	DUF3173 domain-containing protein	NA	NA	NA	NA	NA
WP_000845144.1|1138438_1138669_-	helix-turn-helix domain-containing protein	NA	A0A1S5SEX1	Streptococcus_phage	78.9	7.9e-28
WP_000804878.1|1138665_1139088_-	sigma-70 family RNA polymerase sigma factor	NA	A0A1S5SEW0	Streptococcus_phage	70.0	1.0e-49
WP_001227349.1|1139619_1139973_+	helix-turn-helix domain-containing protein	NA	A0A1S5SFA6	Streptococcus_phage	90.5	1.3e-53
WP_032506803.1|1140030_1140219_-	cysteine-rich KTR domain-containing protein	NA	D0R0F6	Streptococcus_phage	61.4	7.4e-16
WP_000691737.1|1140316_1142236_-	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A1S5SF82	Streptococcus_phage	97.2	0.0e+00
WP_077941411.1|1142251_1142368_-	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_000584387.1|1142612_1143542_-	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	56.6	1.1e-83
WP_000768374.1|1143558_1144581_-	bifunctional lysozyme/C40 family peptidase	NA	A0A1S5SEZ8	Streptococcus_phage	75.5	1.4e-132
WP_000192390.1|1144577_1146605_-	hypothetical protein	NA	A0A1S5SF30	Streptococcus_phage	65.7	1.8e-195
WP_000941001.1|1146601_1149055_-	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	79.1	0.0e+00
WP_000723886.1|1149038_1149434_-	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	75.0	1.7e-49
WP_000234705.1|1149504_1150530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000195404.1|1150608_1151775_-|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	76.0	1.2e-106
WP_000421245.1|1151937_1152438_-	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	61.1	5.4e-53
WP_000678782.1|1152499_1153279_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_001009054.1|1153320_1153542_-	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	93.2	3.1e-29
WP_000055367.1|1153538_1153811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000426691.1|1153807_1154992_-	replication initiation factor domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	67.6	1.0e-158
WP_001130247.1|1155173_1156577_-	DNA translocase FtsK	NA	A0A1S5SFB5	Streptococcus_phage	67.2	2.3e-178
WP_000185760.1|1156598_1157372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001234189.1|1157381_1157759_-	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	77.2	5.6e-47
WP_000421280.1|1157779_1158094_-	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	76.7	7.0e-43
WP_049948768.1|1159296_1161474_+	ATP-dependent helicase	NA	S5MMD7	Bacillus_phage	27.2	2.7e-48
1165788:1165808	attR	AATATGAGTATTTTAGTAACA	NA	NA	NA	NA
>prophage 3
NZ_CP007686	Listeria monocytogenes strain L2624 chromosome, complete genome	2932501	1305788	1362627	2932501	protease,tRNA	Bacillus_virus(16.67%)	56	NA	NA
WP_003734523.1|1305788_1306928_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003723563.1|1307007_1307403_-	helix-turn-helix transcriptional regulator	NA	A9D9J6	Lactobacillus_prophage	57.4	1.3e-14
WP_003727524.1|1307553_1307769_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003727523.1|1307892_1308426_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003731300.1|1308441_1309107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003727521.1|1309368_1310307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003723884.1|1310421_1311705_+	trigger factor	NA	NA	NA	NA	NA
WP_003723886.1|1311889_1313149_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.2	1.4e-145
WP_003726393.1|1313267_1313834_+	type I signal peptidase SipX	NA	NA	NA	NA	NA
WP_003726394.1|1313868_1314438_+	type I signal peptidase SipY	NA	NA	NA	NA	NA
WP_003727520.1|1314539_1315082_+	type I signal peptidase SipZ	NA	NA	NA	NA	NA
WP_003726396.1|1315091_1315955_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_003727519.1|1315951_1316737_+	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	37.6	6.7e-26
WP_003727518.1|1316870_1317731_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_003727517.1|1318003_1320082_+	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	37.5	5.4e-107
WP_003726401.1|1320144_1321449_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_023550485.1|1321731_1322634_+	tyrosine recombinase XerC	NA	A0A142K7N4	Mycobacterium_phage	29.5	1.8e-14
WP_003724001.1|1322654_1323194_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_003727514.1|1323207_1324617_+|protease	ATP-dependent protease ATPase subunit HslU	protease	W6AS21	Erwinia_phage	27.8	7.5e-44
WP_003726695.1|1324637_1325417_+	GTP-sensing pleiotropic transcriptional regulator CodY	NA	NA	NA	NA	NA
WP_023550487.1|1325519_1325939_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003724130.1|1325961_1326273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003726697.1|1326275_1327148_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_003726698.1|1327189_1327786_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003727511.1|1327943_1328351_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_003727510.1|1328531_1330499_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	42.5	5.1e-123
WP_010958880.1|1330495_1332955_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.8	1.1e-101
WP_003726814.1|1333037_1333505_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_023550490.1|1334132_1335941_+	class 1 internalin InlK	NA	NA	NA	NA	NA
WP_003727507.1|1335973_1337860_-	peptidoglycan O-acetyltransferase OatA	NA	B5WZU0	Pseudomonas_phage	32.2	3.8e-43
WP_023550494.1|1338072_1338771_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	31.9	8.4e-12
WP_003723738.1|1339003_1340680_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_003726658.1|1340806_1341724_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003719566.1|1341845_1342079_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_012681271.1|1342189_1343413_+	GTPase HflX	NA	NA	NA	NA	NA
WP_003727505.1|1343405_1344632_+	methionine gamma-lyase family protein	NA	NA	NA	NA	NA
WP_003719570.1|1344833_1345202_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003723435.1|1345272_1346607_+	type I glutamate--ammonia ligase	NA	A0A1V0SJ53	Klosneuvirus	26.4	2.0e-06
WP_023550496.1|1346750_1348046_+	arsenic transporter	NA	A0A2H4PQU3	Staphylococcus_phage	62.1	2.2e-146
WP_003734519.1|1348079_1348604_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_009928625.1|1348634_1349249_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.1	9.3e-15
WP_003734518.1|1349404_1349734_+	cell division suppressor protein YneA	NA	NA	NA	NA	NA
WP_003727501.1|1349827_1350055_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_009928628.1|1350201_1352196_+	transketolase	NA	NA	NA	NA	NA
WP_003726667.1|1352416_1352656_+	YneF family protein	NA	NA	NA	NA	NA
WP_003726668.1|1352704_1353436_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	58.0	2.3e-81
WP_003726669.1|1353457_1353964_-	ParB-like nuclease domain-containing protein	NA	A0A220GKT8	Streptococcus_phage	66.7	1.4e-56
WP_003731336.1|1353973_1355278_-	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	52.1	1.2e-133
WP_012681273.1|1355267_1356473_-	helicase SNF2	NA	L0P6E9	Lactobacillus_phage	46.6	7.0e-91
WP_003727498.1|1356450_1356825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723449.1|1357117_1357846_+	UMP kinase	NA	NA	NA	NA	NA
WP_003723450.1|1357845_1358403_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_003727497.1|1358633_1359392_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	42.1	4.4e-22
WP_003727496.1|1359405_1360194_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003726414.1|1360208_1361351_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_003726415.1|1361364_1362627_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
>prophage 4
NZ_CP007686	Listeria monocytogenes strain L2624 chromosome, complete genome	2932501	1853722	1862008	2932501		Synechococcus_phage(33.33%)	8	NA	NA
WP_003726209.1|1853722_1854289_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.4	8.3e-26
WP_003726210.1|1854285_1855335_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.4	3.2e-63
WP_003722245.1|1855353_1856781_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.6	1.1e-53
WP_009918191.1|1856765_1858985_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.8	6.5e-159
WP_003726212.1|1858977_1859661_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003722248.1|1859664_1859910_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003726214.1|1859921_1860635_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F9V5	Synechococcus_phage	38.3	2.0e-40
WP_003729814.1|1860715_1862008_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.0	2.5e-17
>prophage 5
NZ_CP007686	Listeria monocytogenes strain L2624 chromosome, complete genome	2932501	2534108	2541950	2932501		Streptococcus_phage(50.0%)	7	NA	NA
WP_003725407.1|2534108_2535080_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.4	5.2e-52
WP_003731212.1|2535087_2536056_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	43.6	1.8e-68
WP_003722606.1|2536057_2536933_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.7	1.9e-08
WP_003725409.1|2537040_2538771_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	53.1	9.5e-174
WP_009918600.1|2538812_2539874_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_009918601.1|2539890_2540874_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.7	3.1e-52
WP_003722610.1|2540990_2541950_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.7	2.0e-88
