The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011770	Croceicoccus naphthovorans strain PQ-2 chromosome, complete genome	3543806	30925	135469	3543806	integrase,tRNA,transposase,protease	Staphylococcus_phage(14.29%)	85	53175:53190	105001:105020
WP_156170621.1|30925_31698_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	46.1	1.9e-25
WP_053058900.1|31748_32174_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_047819470.1|32185_33628_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_179944988.1|33660_34443_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.1	8.5e-21
WP_082134999.1|34824_35130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047819471.1|35231_36575_+	TldD/PmbA family protein	NA	NA	NA	NA	NA
WP_047819472.1|36568_37963_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_047819473.1|37978_38518_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	49.7	7.6e-45
WP_047822890.1|38688_39921_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_047822893.1|39945_41013_+	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_047822896.1|41019_41862_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_082134713.1|42145_42886_+	DUF4167 domain-containing protein	NA	NA	NA	NA	NA
WP_082134714.1|42918_44538_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_047819474.1|44608_45856_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	45.3	1.2e-90
WP_053058902.1|45944_46622_+	hypothetical protein	NA	M4STA9	Rhodobacter_phage	37.2	9.0e-11
WP_179944948.1|46655_48398_+	5'-nucleotidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_047819475.1|48399_48936_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_082134715.1|48962_49598_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_053058903.1|49612_50410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047819477.1|50415_51123_-	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_179944989.1|51260_53990_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
53175:53190	attL	TTAGGCGGCGGGGTGC	NA	NA	NA	NA
WP_047819478.1|53986_54466_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
53175:53190	attL	TTAGGCGGCGGGGTGC	NA	NA	NA	NA
WP_047819479.1|54478_55279_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_047819480.1|55461_56181_+	M23 family metallopeptidase	NA	A8ATH6	Listeria_phage	50.0	4.9e-23
WP_053058904.1|56261_59816_-	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	36.4	1.1e-51
WP_047819481.1|59924_60806_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	44.7	4.2e-61
WP_156170622.1|60904_61597_-	FkbM family methyltransferase	NA	NA	NA	NA	NA
WP_156170623.1|61699_62870_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.0	1.5e-45
WP_047819485.1|62895_63672_-	DUF2813 domain-containing protein	NA	NA	NA	NA	NA
WP_047819486.1|63759_64899_-	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	36.9	2.9e-62
WP_146029798.1|64895_65087_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_047819487.1|65207_66416_-|integrase	site-specific integrase	integrase	A0A221SAN4	Ralstonia_phage	30.7	1.7e-36
WP_047819488.1|66412_67585_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A221SAN4	Ralstonia_phage	30.4	2.5e-37
WP_169749280.1|69007_70357_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_082134717.1|70552_71731_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	NA	NA	NA	NA
WP_047819490.1|71989_72565_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_169749280.1|72635_73985_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_047819491.1|74268_74649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169749281.1|74731_75331_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_156170624.1|76305_77007_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
75840:75855	attR	GCACCCCGCCGCCTAA	NA	NA	NA	NA
WP_156170625.1|77439_77892_+	hypothetical protein	NA	NA	NA	NA	NA
75840:75855	attR	GCACCCCGCCGCCTAA	NA	NA	NA	NA
WP_047819496.1|78020_78722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047819497.1|78718_79225_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_047819498.1|79290_80514_+	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_053058906.1|80618_81023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053058907.1|81026_81464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053058908.1|81596_82400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156170626.1|82717_84083_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_053058909.1|84507_85335_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_047819503.1|87897_95196_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_066561085.1|95297_97436_+	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_047819505.1|98852_99260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047819506.1|99675_99966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047819507.1|99955_100708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047819508.1|100708_103555_+	conjugative relaxase	NA	NA	NA	NA	NA
WP_047819509.1|103555_104842_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q8W6M6	Sinorhizobium_phage	47.1	1.7e-106
WP_047819510.1|105353_106184_+	DUF1134 domain-containing protein	NA	NA	NA	NA	NA
WP_047819511.1|106308_107478_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_047819512.1|107485_108004_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_047819513.1|108000_108621_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.8	2.5e-20
WP_082135000.1|108631_109576_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	39.8	1.6e-34
WP_156170628.1|109589_110078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156170879.1|110145_110826_-	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_047819515.1|110906_111395_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_082134720.1|111382_112012_-	SCO family protein	NA	NA	NA	NA	NA
WP_047822931.1|112124_112748_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_047819516.1|112755_113436_+	COQ9 family protein	NA	NA	NA	NA	NA
WP_047819517.1|113521_113827_+	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_047819518.1|113823_115674_+	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_047819519.1|115840_116401_+	single-stranded DNA-binding protein	NA	A0A0U2C0X4	Paracoccus_phage	76.7	8.4e-47
WP_047819520.1|116407_116929_-	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_047819521.1|116925_117435_-	ubiquinol-cytochrome C chaperone family protein	NA	NA	NA	NA	NA
WP_047822933.1|117651_118134_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_047819522.1|118203_118782_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_047819523.1|118796_120095_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	28.9	5.3e-36
WP_047819524.1|120134_120479_+	DUF2322 family protein	NA	NA	NA	NA	NA
WP_047819525.1|120489_121980_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	61.2	3.1e-157
WP_047819526.1|122145_122547_+	GFA family protein	NA	NA	NA	NA	NA
WP_047819527.1|122553_124374_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	29.2	1.2e-49
WP_053058914.1|124435_125365_-|protease	aspartyl protease family protein	protease	NA	NA	NA	NA
WP_082135001.1|131198_132851_-	recombinase family protein	NA	R9TP69	Rhizobium_phage	37.0	9.3e-86
WP_047819530.1|132870_133095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047819531.1|133364_133664_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_047819532.1|133668_134178_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_047822938.1|134536_135469_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	36.8	3.9e-49
>prophage 2
NZ_CP011770	Croceicoccus naphthovorans strain PQ-2 chromosome, complete genome	3543806	459961	490267	3543806	integrase,transposase	Ralstonia_phage(25.0%)	24	460766:460780	475523:475537
WP_047819756.1|459961_461125_-|integrase	site-specific integrase	integrase	A0A221SAN4	Ralstonia_phage	34.3	6.4e-41
460766:460780	attL	CTTCCAGGTCGGAGA	NA	NA	NA	NA
WP_047819757.1|461121_462114_-|integrase	site-specific integrase	integrase	A0A221SAN4	Ralstonia_phage	34.3	9.7e-38
WP_047819758.1|462716_462938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156170886.1|463177_463558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047819760.1|463738_464137_-	single-stranded DNA-binding protein	NA	E8ZD59	Streptococcus_phage	32.0	1.1e-08
WP_156170623.1|464837_466009_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.0	1.5e-45
WP_047819761.1|466202_467420_-|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	40.4	3.4e-85
WP_047819762.1|467895_468843_+	complex I NDUFA9 subunit family protein	NA	NA	NA	NA	NA
WP_047819763.1|468845_469517_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_047819764.1|469682_470228_+	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_047819765.1|470277_470760_+	UPF0262 family protein	NA	NA	NA	NA	NA
WP_082134759.1|470764_471475_+	glycoside hydrolase family 25 protein	NA	NA	NA	NA	NA
WP_047823132.1|471587_472142_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	66.1	1.8e-65
WP_047819767.1|472164_473007_-	glutathione-dependent disulfide-bond oxidoreductase	NA	NA	NA	NA	NA
WP_047819768.1|473386_474625_+|integrase	site-specific integrase	integrase	S5M9V8	Brevibacillus_phage	26.9	1.2e-05
WP_047819769.1|475053_475974_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
475523:475537	attR	TCTCCGACCTGGAAG	NA	NA	NA	NA
WP_053058944.1|475976_479243_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_047819770.1|479239_480127_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_047819771.1|480362_481205_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047819772.1|481258_482683_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_047819773.1|482685_485874_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_047819774.1|485877_487026_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_047819775.1|487982_488606_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_047823140.1|488617_490267_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	44.3	2.2e-111
>prophage 4
NZ_CP011770	Croceicoccus naphthovorans strain PQ-2 chromosome, complete genome	3543806	1477003	1506537	3543806	head,capsid,terminase,integrase,portal,tail	Sinorhizobium_phage(25.0%)	35	1474987:1475003	1512576:1512592
1474987:1475003	attL	CAAGTTCGGCAAGCAGC	NA	NA	NA	NA
WP_047820552.1|1477003_1479145_+|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	28.7	5.1e-60
WP_047820553.1|1479318_1479558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047820554.1|1479557_1481261_+|portal	phage portal protein	portal	A0A291AUT1	Sinorhizobium_phage	30.4	5.9e-51
WP_169749317.1|1481247_1482651_+	S49 family peptidase	NA	V5Q7L6	Xylella_phage	40.2	4.6e-33
WP_082134833.1|1482709_1483081_+|head	head decoration protein	head	A0A291AUM0	Sinorhizobium_phage	56.8	3.0e-16
WP_053059045.1|1483170_1484205_+|capsid	major capsid protein	capsid	A0A2D1GMR5	Marinobacter_phage	34.6	5.7e-41
WP_156170730.1|1484357_1484726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047820557.1|1484729_1485089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047820558.1|1485090_1485876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047820559.1|1485875_1486343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047820560.1|1486373_1486622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047820561.1|1486653_1487817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047820562.1|1487824_1488448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156170731.1|1488612_1488777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047820563.1|1488795_1491609_+|tail	phage tail length tape measure family protein	tail	NA	NA	NA	NA
WP_047820564.1|1491605_1492229_+	DUF2460 domain-containing protein	NA	A0A0B5A2K3	Paracoccus_phage	47.1	4.6e-46
WP_047820565.1|1492229_1493183_+	DUF2163 domain-containing protein	NA	NA	NA	NA	NA
WP_053059046.1|1493179_1493614_+	C40 family peptidase	NA	A0A0K1Y740	Rhodobacter_phage	36.9	3.0e-07
WP_047820566.1|1493613_1496478_+	hypothetical protein	NA	M4QNR6	Tetraselmis_viridis_virus	28.8	2.8e-37
WP_053059047.1|1496490_1497843_+	DUF2793 domain-containing protein	NA	F8TV94	EBPR_siphovirus	43.9	7.3e-28
WP_156170732.1|1497854_1499258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053059048.1|1499265_1500120_-	phytanoyl-CoA dioxygenase family protein	NA	NA	NA	NA	NA
WP_156170733.1|1500195_1500339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047820569.1|1500335_1500755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047820570.1|1500759_1501260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053059049.1|1501301_1501862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047820571.1|1501858_1502116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047820572.1|1502117_1502498_+	hypothetical protein	NA	A0A2H4J4R3	uncultured_Caudovirales_phage	39.6	2.9e-11
WP_047820573.1|1502494_1502968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047820574.1|1502964_1503192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047820575.1|1503188_1503509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156170737.1|1503420_1503813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047820577.1|1503960_1504767_+	DNA adenine methylase	NA	A0A291AUP9	Sinorhizobium_phage	63.8	1.7e-88
WP_169749318.1|1504794_1505043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047823582.1|1505283_1506537_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	40.5	5.1e-76
1512576:1512592	attR	GCTGCTTGCCGAACTTG	NA	NA	NA	NA
>prophage 5
NZ_CP011770	Croceicoccus naphthovorans strain PQ-2 chromosome, complete genome	3543806	2041852	2111765	3543806	integrase,transposase	Leptospira_phage(27.27%)	60	2041840:2041899	2100700:2101549
2041840:2041899	attL	CTAGGCTCAGGACTCATTGATCGAGCCAGAAGATGACGGTTGCGGCGATGCAGATGGCGG	NA	NA	NA	NA
WP_156170784.1|2041852_2042613_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	34.9	4.1e-12
WP_169749343.1|2042914_2044954_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_047820934.1|2045014_2045944_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047820935.1|2046058_2046592_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_082134886.1|2046588_2047584_+	ornithine cyclodeaminase family protein	NA	NA	NA	NA	NA
WP_037486818.1|2047598_2048693_+	AraC family ligand binding domain-containing protein	NA	NA	NA	NA	NA
WP_081796453.1|2048692_2049535_+	2-oxo-hepta-3-ene-1,7-dioic acid hydratase	NA	NA	NA	NA	NA
WP_037486817.1|2049558_2050359_+	4-hydroxy-2-oxoheptanedioate aldolase	NA	NA	NA	NA	NA
WP_047820936.1|2050379_2051756_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_047823845.1|2052036_2052837_+	2-oxo-hepta-3-ene-1,7-dioic acid hydratase	NA	NA	NA	NA	NA
WP_007015354.1|2052865_2053636_+	alpha-dehydro-beta-deoxy-D-glucarate aldolase	NA	NA	NA	NA	NA
WP_053059275.1|2053700_2054798_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_047820938.1|2054866_2057326_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_047820939.1|2057798_2058596_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_037486800.1|2058652_2059888_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_156170623.1|2061569_2062740_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.0	1.5e-45
WP_082134888.1|2062765_2062939_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_169749344.1|2063015_2064191_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_047820943.1|2064126_2065035_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_053059114.1|2065279_2065855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082134890.1|2065895_2067236_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_053059115.1|2067251_2067851_-	2-hydroxychromene-2-carboxylate isomerase	NA	NA	NA	NA	NA
WP_156170913.1|2067861_2068791_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_047823857.1|2068880_2071295_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_047820947.1|2072725_2073634_-	VOC family protein	NA	NA	NA	NA	NA
WP_047820948.1|2073683_2074169_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_047820949.1|2075442_2076504_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_047820950.1|2077204_2077519_-	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_169749280.1|2077954_2079304_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_047823859.1|2079480_2080386_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_156170746.1|2080452_2081623_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	4.5e-50
WP_169749345.1|2083181_2083847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047823865.1|2085583_2086048_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_047820953.1|2086047_2086278_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_047820954.1|2087699_2088209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047820955.1|2088205_2088499_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_082134893.1|2088851_2090195_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.0	2.5e-81
WP_047820956.1|2090500_2091733_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_053059118.1|2092767_2093370_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047820957.1|2093792_2094200_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_047820958.1|2094196_2094550_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_053059119.1|2094618_2095206_+|transposase	IS66 family transposase zinc-finger binding domain-containing protein	transposase	S5VTD3	Leptospira_phage	34.0	1.4e-15
WP_047820959.1|2095420_2096458_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_053059120.1|2096550_2097117_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	39.8	3.2e-30
WP_053059121.1|2097155_2097539_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_047823873.1|2098730_2099459_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	33.1	5.8e-32
WP_047820960.1|2099486_2099906_-|transposase	IS200/IS605 family transposase	transposase	G9CU69	Helicobacter_phage	35.1	3.8e-20
WP_053059122.1|2099978_2100524_-	DUF4102 domain-containing protein	NA	A0A291LA13	Bordetella_phage	36.6	3.5e-05
WP_156170784.1|2100712_2101473_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	34.9	4.1e-12
WP_179944972.1|2102108_2102939_-	aldo/keto reductase	NA	NA	NA	NA	NA
2100700:2101549	attR	CTAGGCTCAGGACTCATTGATCGAGCCAGAAGATGACGGTTGCGGCGATGCAGATGGCGGACATGAAGGTATGGGCGCAGCGGTCGTATCGCGTGTGGATGCGGCGCCAGTCCTTGAGTTTGCCGAACATGTTCTCGACCCTGTGGCGCTGGCGATAGAGTGTGCGATCGTGCGGGATCTGTACCTTTCGATTGGCCTTTGAAGGGATACAGGCGGTGATGCCGCGGTTGGCCAGAGCTGCGCGGAACCAGTCGGCATCATAGCCTTTATCACCGAGCAGTGCCTTGGCCCTGGGCAGGGAGTCGAGCATCAGCGCAGCGCCCTTGAAGTCGCTCATCTGGCCTTCGCTGAGCAGCATGACCAGTGGCCGCCCCTGGCCGTCGCAGACCGCATGAAGCTTGGAGTTCAAGCCGCCTTTGGTGCGTCCGATACATCTGGGAAGAGCCCCTTTTTAAAGAGGCTGGCAGCTGTTCGGTGAGCCTTGAGATGCGTGGCATCGATCATCAGTTGATCCGGCTTGCCACCCTTGGCAGCCAGCGCGGCAAAGATATTGTTGAACACGCCCAGTCGGCTCCAGCGGATGAACCGGTTGTAGATCGTTTTGTGCGGACCATACTCGCGCGGTGCATCTCGCCAGCGCAACCCGTTCCTGATCACGAAGATGATCCCGCTAACGATCCGACGATCATCGACCCGCGGCACTCCGTGCGACAGTGGGAAATACGGCTCGATCCGGCGCATCTGCGCCTCCGACAACCAGATCAGATCACTCACGACAACACCTCCTCAGCGGTGCCGTTGAATCAGAATATCGAGCCCTTGGGAATCCCTTTAATAGGTCCTGAGCCTA	NA	NA	NA	NA
WP_047820963.1|2103014_2103635_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009823890.1|2103731_2104721_+	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_047820964.1|2104923_2105214_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_156170787.1|2105330_2106084_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_156170788.1|2106113_2107075_-|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	24.4	2.7e-13
WP_047820966.1|2107140_2108121_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024717194.1|2108355_2108649_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_047820968.1|2109343_2110441_+	alkene reductase	NA	NA	NA	NA	NA
WP_047820969.1|2110553_2110949_+	heme-binding protein	NA	NA	NA	NA	NA
WP_156170914.1|2111008_2111765_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP011770	Croceicoccus naphthovorans strain PQ-2 chromosome, complete genome	3543806	3015168	3032971	3543806	transposase	Stx2-converting_phage(50.0%)	12	NA	NA
WP_047823140.1|3015168_3016818_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	44.3	2.2e-111
WP_047819776.1|3016891_3017233_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	57.3	3.9e-31
WP_047819777.1|3017229_3017595_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_082134965.1|3017672_3017897_+	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_169749367.1|3018000_3019350_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_082134966.1|3019428_3020661_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_156170621.1|3020990_3021763_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	46.1	1.9e-25
WP_082134967.1|3022307_3022700_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_156170621.1|3025353_3026126_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	46.1	1.9e-25
WP_047822127.1|3026420_3028085_+	autotransporter-associated beta strand repeat-containing protein	NA	NA	NA	NA	NA
WP_156170842.1|3028132_3029941_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_082134968.1|3032065_3032971_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP011770	Croceicoccus naphthovorans strain PQ-2 chromosome, complete genome	3543806	3208760	3232203	3543806	integrase,transposase,protease	Stx2-converting_phage(33.33%)	24	3196039:3196055	3236298:3236314
3196039:3196055	attL	GGCGCTGGCGATCACCG	NA	NA	NA	NA
WP_047822363.1|3208760_3209162_+|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	44.0	7.4e-05
WP_047822365.1|3209158_3209506_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	58.9	3.3e-33
WP_047822367.1|3209590_3211114_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	47.0	3.1e-120
WP_047822368.1|3211110_3211713_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_156170856.1|3211704_3212187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047822373.1|3212458_3212974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047822375.1|3213277_3213520_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_047822378.1|3213608_3215369_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_169749374.1|3215335_3216448_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_053059218.1|3216814_3218605_+	recombinase family protein	NA	A0A097BYD1	Leuconostoc_phage	25.8	3.5e-22
WP_089217550.1|3219441_3219810_+	lasso peptide biosynthesis B2 protein	NA	NA	NA	NA	NA
WP_047822384.1|3219809_3221360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052208628.1|3221290_3221941_-	hypothetical protein	NA	A0A0E3FKE3	Synechococcus_phage	45.4	7.0e-21
WP_039581785.1|3222121_3222607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047822388.1|3223705_3224080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047822390.1|3224151_3224670_+	MmcB family DNA repair protein	NA	B2ZY91	Ralstonia_phage	43.8	7.9e-07
WP_082135071.1|3224814_3225507_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_169749375.1|3225503_3225935_+	DUF2141 domain-containing protein	NA	NA	NA	NA	NA
WP_047822393.1|3226000_3226846_+	CoA ester lyase	NA	NA	NA	NA	NA
WP_053059219.1|3226920_3227778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047822394.1|3227834_3228962_+	DUF2183 domain-containing protein	NA	NA	NA	NA	NA
WP_047822396.1|3229032_3230403_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_053059220.1|3230413_3231202_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_053059221.1|3231201_3232203_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
3236298:3236314	attR	GGCGCTGGCGATCACCG	NA	NA	NA	NA

