The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP006636	Escherichia coli PCN061 chromosome, complete genome	4603777	249920	339893	4603777	transposase,protease,integrase,lysis,head,tail,plate,terminase,holin,capsid,portal	Shigella_phage(50.0%)	100	240714:240773	329699:330466
240714:240773	attL	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGC	NA	NA	NA	NA
WP_000006261.1|249920_250418_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001338275.1|250633_252373_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_076604657.1|252317_253103_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|253173_254229_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554757.1|254280_254574_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_029403942.1|254576_254975_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059847.1|254984_255437_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001321003.1|255670_255937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001293003.1|256462_257920_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|258180_258639_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189541.1|258730_259975_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174677.1|260032_260434_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749881.1|260472_261528_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|261815_262919_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|262930_264184_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_000051887.1|264388_265552_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000433939.1|265428_265779_-	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	100.0	4.9e-61
WP_000206732.1|265778_266084_-	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_001242749.1|266083_266446_-	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000008236.1|266436_266973_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_000016389.1|267517_267952_+	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
WP_000549623.1|267923_268130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450735.1|268377_269004_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	5.5e-47
WP_000205494.1|269101_269302_+	cell division protein	NA	NA	NA	NA	NA
WP_077788566.1|269339_269891_+	hypothetical protein	NA	S5FXP0	Shigella_phage	98.4	2.2e-100
WP_001250269.1|270066_270246_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_047928509.1|270235_271177_+	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.4	3.6e-143
WP_001332382.1|271173_271668_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	99.4	1.9e-87
WP_021518589.1|271667_271994_+	LexA repressor	NA	A0A291AWY9	Escherichia_phage	99.1	4.5e-53
WP_000767113.1|271990_272380_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_023352843.1|272399_273197_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	4.4e-150
WP_047928510.1|273204_274194_+	DUF968 domain-containing protein	NA	S5FV02	Shigella_phage	99.7	1.2e-194
WP_080086273.1|274208_274589_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	90.0	6.1e-57
WP_000357056.1|274603_275623_-	hypothetical protein	NA	A0A0R6PIZ6	Moraxella_phage	32.5	2.4e-39
WP_000917724.1|275942_276146_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_047928511.1|276296_277349_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	98.6	1.7e-205
WP_001120497.1|277425_277752_+|holin	phage holin, lambda family	holin	S5FM86	Shigella_phage	99.1	1.5e-56
WP_025269812.1|277755_278232_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	8.6e-85
WP_123000755.1|278448_278631_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	95.0	1.2e-15
WP_000738423.1|278721_279015_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_016236635.1|279539_279890_+	HNH endonuclease	NA	Q8HA82	Salmonella_phage	94.8	3.4e-62
WP_000929185.1|280015_280510_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	98.8	3.3e-87
WP_065312442.1|280743_282240_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.6	1.7e-299
WP_000605606.1|282251_282434_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_000466255.1|282433_283675_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_001193631.1|283652_284303_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000257492.1|284317_285523_+|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.5	9.1e-224
WP_000601365.1|285572_285773_+	hypothetical protein	NA	S5FNU1	Shigella_phage	100.0	3.4e-27
WP_000927707.1|285775_286099_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	98.1	3.3e-56
WP_021535159.1|286095_286506_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	97.1	1.7e-73
WP_047928514.1|286480_286987_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	3.8e-91
WP_000779293.1|286983_287544_+	hypothetical protein	NA	S5FM61	Shigella_phage	100.0	4.7e-106
WP_000497751.1|287552_287723_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_021535156.1|287706_289203_+|tail	phage tail sheath protein	tail	S5FKL0	Shigella_phage	99.2	4.0e-277
WP_000090998.1|289202_289559_+	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_000661054.1|289558_289828_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_047928517.1|289969_291805_+|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.0	1.2e-304
WP_047928518.1|291865_293194_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.2	1.9e-243
WP_000999511.1|293190_294270_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	2.6e-206
WP_001259084.1|294269_294818_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.9	5.1e-97
WP_047928519.1|294817_295243_+|tail	phage tail protein	tail	U5P0R9	Shigella_phage	98.6	3.3e-80
WP_016244979.1|295229_296288_+|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	99.1	2.1e-200
WP_047928520.1|296278_296863_+	YmfQ family protein	NA	O22003	Shigella_phage	98.5	2.7e-112
WP_047928521.1|296866_297793_+	hypothetical protein	NA	U5P0I1	Shigella_phage	84.3	1.2e-50
WP_047928522.1|297792_298203_+|tail	tail fiber assembly protein	tail	U5P0S4	Shigella_phage	80.3	2.5e-24
WP_024046811.1|298174_298612_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.5	1.6e-48
WP_047928524.1|298613_299000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000957441.1|302074_302740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032247022.1|302739_303138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001619161.1|303130_303976_-	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	38.0	5.0e-35
WP_000878218.1|305009_305876_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000169527.1|305872_306172_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001327840.1|306603_306819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001550537.1|306886_307084_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000684813.1|307401_308040_-	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_033554225.1|308280_309450_+	oligogalacturonate lyase	NA	NA	NA	NA	NA
WP_000345753.1|309482_310283_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_047928532.1|310337_310661_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000134162.1|311026_312541_+	MFS transporter	NA	NA	NA	NA	NA
WP_032206705.1|312542_314777_+	exopolygalacturonate lyase	NA	NA	NA	NA	NA
WP_001353968.1|314884_315850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047928533.1|316160_316517_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_047928534.1|316796_317777_+|transposase	IS5 family transposase	transposase	A0A077SK28	Escherichia_phage	97.9	4.9e-183
WP_047928535.1|317924_321041_-	HsdR family type I site-specific deoxyribonuclease	NA	NA	NA	NA	NA
WP_042047042.1|321162_322377_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_000200813.1|322373_323930_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.9	2.2e-105
WP_047928536.1|324193_325066_+	GTPase family protein	NA	NA	NA	NA	NA
WP_033554199.1|327075_327768_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	99.6	1.3e-126
WP_001191674.1|327865_328126_+	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_000515845.1|328118_328670_+	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_071589348.1|328845_329025_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	70.4	2.7e-15
WP_071884764.1|329014_329404_+	DUF968 domain-containing protein	NA	U5P0A0	Shigella_phage	97.5	1.9e-37
WP_000866436.1|330669_330810_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
329699:330466	attR	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGCTTCTGTTTCTATCAGCTGTCCCTCCTGTTCAGCTACTGACGGGGTGGTGCGTAACGGCAAAAGCACCGCCGGACATCAGCGCTATCTCTGCTCTCACTGCCGTAAAACATGGCAACTGCAGTTCACTTACACCGCTTCTCAACCCGGTACGCACCAGAAAATCATTGATATGGCCATGAATGGCGTTGGATGCCGGGCAACTGCCCGCATTATGGGCGTTGGCCTCAACACGATTTTACGTCACTTAAAAAACTCAGGCCGCAGTCGGTAACCTCGCGCATACAGCCGGGCAGTGACGTCATCGTCTGCGCGGAAATGGACGAACAGTGGGGCTATGTCGGGGCTAAATCGCGCCAGCGCTGGCTGTTTTACGCGTATGACAGTCTCCGGAAGACGGTTGTTGCGCACGTATTCGGTGAGCGCACTATGGCGACGCTGGGGCGTCTTATGAGCCTGCTGTCACCCTTTGACGTGGTGATATGGATGACGGATGGCTGGCCGCTGTATGAATCCCGCCTGAAGGGAAAGCTGCACGTAATCAGCAAGCGATATACGCAGCGAATTGAGCGGCATAACCTGAATCTGAGGCAGCACCTGGCACGGCTGGGACGGAAGTCGCTGTCGTTCTCAAAATCGGTGGAGCTGCATGACAAAGTCATCGGGCATTATCTGAACATAAAACACTATCAATAAGTTGGAGTCATTACC	NA	NA	NA	NA
WP_000803998.1|330809_331073_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000662258.1|331436_331538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024250650.1|332652_336909_+	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_077788543.1|337048_337423_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000422741.1|337476_337902_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|337898_338249_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080200.1|338279_339893_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	1.8e-182
>prophage 2
NZ_CP006636	Escherichia coli PCN061 chromosome, complete genome	4603777	348892	365642	4603777	holin,transposase	Bluetongue_virus(16.67%)	16	NA	NA
WP_006250222.1|348892_350101_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	99.8	3.0e-235
WP_000428546.1|350614_351208_+	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_001089068.1|351320_352526_-	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
WP_000088605.1|352607_353231_+	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001284954.1|353208_353895_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000460651.1|353902_354289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000562370.1|354281_354602_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000599530.1|355045_356251_+	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_001352368.1|356616_357825_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_001159094.1|358037_359708_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001514956.1|359721_361194_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001335745.1|361207_361795_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_047928541.1|361923_363957_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.2	7.6e-21
WP_122997413.1|364262_364337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000169527.1|364479_364779_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878218.1|364775_365642_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
>prophage 3
NZ_CP006636	Escherichia coli PCN061 chromosome, complete genome	4603777	585869	591019	4603777	protease	Stx_converting_phage(50.0%)	7	NA	NA
WP_023281837.1|585869_586550_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	5.1e-131
WP_000100847.1|586546_587332_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995439.1|587337_587634_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_001741311.1|587709_587853_-	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	97.9	5.1e-17
WP_001198861.1|587821_587986_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000253838.1|588897_590346_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	NA	NA	NA	NA
WP_000770953.1|590335_591019_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
>prophage 4
NZ_CP006636	Escherichia coli PCN061 chromosome, complete genome	4603777	1517159	1618857	4603777	transposase,protease,tail,holin,portal	Enterobacteria_phage(29.82%)	108	NA	NA
WP_000169527.1|1517159_1517459_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878218.1|1517455_1518322_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_023281919.1|1519215_1520808_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_000154352.1|1520886_1521840_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_033554413.1|1522088_1523624_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	1.7e-20
WP_047928720.1|1523617_1524646_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001222721.1|1524645_1525638_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000172488.1|1525649_1526672_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000558527.1|1527597_1527888_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_001286597.1|1527944_1528703_+	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_000637082.1|1528706_1529621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854624.1|1529827_1531279_-	tagaturonate reductase	NA	NA	NA	NA	NA
WP_047928721.1|1531505_1532453_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.6	4.8e-18
WP_001191019.1|1532564_1532924_-	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_000257409.1|1532923_1533850_-	glutaminase B	NA	NA	NA	NA	NA
WP_001338596.1|1533913_1535302_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000366502.1|1535402_1536284_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001741693.1|1536361_1537156_+	putative protein YneK	NA	NA	NA	NA	NA
WP_000169527.1|1537218_1537518_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878218.1|1537514_1538381_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000210799.1|1538887_1540078_+	L-arabinose MFS transporter	NA	NA	NA	NA	NA
WP_000885024.1|1540102_1540768_-	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_000843419.1|1540978_1541413_+	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000091199.1|1541432_1541816_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803522.1|1541847_1542066_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_001741702.1|1542122_1543562_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	2.8e-30
WP_001459752.1|1545314_1545626_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_047928724.1|1545653_1546976_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_000722572.1|1547090_1547402_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000577192.1|1547600_1548320_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000087216.1|1548342_1549242_-	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_001741704.1|1549436_1550624_+	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000901367.1|1550750_1550846_+	protein MgtS	NA	NA	NA	NA	NA
WP_023281925.1|1551064_1551955_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	3.7e-20
WP_000671731.1|1552209_1552602_-	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_001024565.1|1552876_1553395_+	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_000210376.1|1553439_1555485_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_001324973.1|1555621_1556368_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_000215549.1|1556456_1557143_+	DNA-binding transcriptional regulator YdfH	NA	NA	NA	NA	NA
WP_000214712.1|1557319_1557523_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_047928726.1|1559107_1560391_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|1560992_1561106_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_047928729.1|1561174_1561408_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_000086522.1|1561724_1562315_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	1.5e-25
WP_077788548.1|1562586_1566366_-	peptidase S74	NA	A0A2D1UII2	Escherichia_phage	82.4	0.0e+00
WP_047928731.1|1566430_1567030_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	96.0	2.7e-107
WP_047928732.1|1567098_1570578_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.1	0.0e+00
WP_076604797.1|1570638_1571286_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.3	1.5e-111
WP_047928734.1|1571183_1571927_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	1.6e-149
WP_047928735.1|1571932_1572631_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	97.0	1.5e-130
WP_000447248.1|1572640_1572970_-|tail	phage tail protein	tail	A0A291AWW9	Escherichia_phage	100.0	1.7e-60
WP_047928736.1|1572969_1576035_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.2	0.0e+00
WP_001161009.1|1576006_1576336_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001696001.1|1576344_1576731_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	99.2	1.4e-64
WP_001401822.1|1576791_1577535_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	98.8	1.9e-131
WP_001401823.1|1577545_1577947_-|tail	phage tail protein	tail	K7PJP5	Enterobacteria_phage	99.2	7.0e-72
WP_000677106.1|1577943_1578522_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
WP_001283144.1|1578533_1578809_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	8.6e-45
WP_047928737.1|1578801_1579125_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	99.1	2.5e-51
WP_001546838.1|1579211_1581239_-|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.7	0.0e+00
WP_077788550.1|1581216_1582764_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.6	1.1e-282
WP_001072975.1|1582691_1582904_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000422741.1|1584613_1585039_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|1585035_1585386_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080200.1|1585416_1587030_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	1.8e-182
WP_000421825.1|1587548_1588088_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_000548593.1|1588638_1588845_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_001019207.1|1589138_1589312_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001443523.1|1589484_1589640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071528545.1|1589786_1589975_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000072434.1|1589985_1590198_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	75.7	2.4e-23
WP_047928740.1|1590561_1591059_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_001101173.1|1591055_1591589_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.8	1.4e-96
WP_001557934.1|1591702_1591963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000189900.1|1591910_1592462_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	51.1	1.0e-36
WP_000839588.1|1592466_1592682_-|holin	holin	holin	A5LH82	Enterobacteria_phage	91.5	1.2e-30
WP_001146313.1|1592872_1593586_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000169527.1|1594203_1594503_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878218.1|1594499_1595366_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000780584.1|1596405_1596930_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	52.9	1.0e-46
WP_001204787.1|1597085_1597463_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.5	1.8e-53
WP_047928741.1|1597480_1598530_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	58.2	2.3e-114
WP_001410105.1|1598531_1598810_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
WP_001013626.1|1598976_1599189_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	9.9e-25
WP_122083109.1|1599233_1599341_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_047928742.1|1599719_1600745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046080786.1|1600972_1601398_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.3	3.5e-61
WP_047928743.1|1601438_1602509_-	phage replisome organizer	NA	A0A088CD36	Shigella_phage	65.7	8.5e-64
WP_047662441.1|1602580_1603006_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001072337.1|1603002_1603257_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000233320.1|1603336_1603756_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_000379578.1|1604053_1604209_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	2.3e-07
WP_001171942.1|1604368_1604587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001299931.1|1604590_1604755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|1605154_1605343_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_047928744.1|1605339_1605519_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_089078998.1|1605515_1606788_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	8.0e-170
WP_047928745.1|1606960_1609432_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.2	3.8e-59
WP_001296941.1|1609519_1609756_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_001389342.1|1611071_1611200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836067.1|1611257_1612277_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|1612288_1613503_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1613708_1614035_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|1614169_1614511_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|1614545_1615106_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1615108_1615819_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001300836.1|1615926_1616232_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_032298142.1|1616430_1618857_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.7e-213
>prophage 5
NZ_CP006636	Escherichia coli PCN061 chromosome, complete genome	4603777	2015726	2022364	4603777	tail	Enterobacterial_phage(50.0%)	6	NA	NA
WP_047928776.1|2015726_2016569_-|tail	phage tail protein	tail	K7PKN5	Enterobacterial_phage	42.8	1.6e-17
WP_024250321.1|2017445_2017898_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	87.2	1.3e-66
WP_004202052.1|2017926_2018190_-	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	46.6	1.8e-12
WP_004184740.1|2018291_2018768_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	45.3	2.0e-12
WP_047928777.1|2021279_2021579_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	47.6	3.2e-13
WP_047633073.1|2021578_2022364_+	hypothetical protein	NA	A4JX52	Burkholderia_virus	51.0	3.1e-63
>prophage 6
NZ_CP006636	Escherichia coli PCN061 chromosome, complete genome	4603777	2091096	2101014	4603777		Escherichia_phage(28.57%)	8	NA	NA
WP_029487637.1|2091096_2092512_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.9	1.4e-53
WP_000429205.1|2094039_2094162_+	small membrane protein	NA	NA	NA	NA	NA
WP_029487822.1|2094585_2095752_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.5	9.1e-112
WP_023297948.1|2095932_2096487_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	5.0e-52
WP_047928785.1|2096501_2097392_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.1	5.3e-27
WP_023297950.1|2097423_2098293_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	5.7e-111
WP_029487815.1|2098319_2099384_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.1	1.2e-102
WP_029487813.1|2099607_2101014_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	1.1e-37
>prophage 7
NZ_CP006636	Escherichia coli PCN061 chromosome, complete genome	4603777	2802840	2816023	4603777		Escherichia_phage(50.0%)	12	NA	NA
WP_001272898.1|2802840_2805402_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_001141322.1|2805507_2806164_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001272547.1|2806214_2807012_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.0	1.3e-69
WP_000847985.1|2807177_2808086_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590390.1|2808082_2809345_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	9.8e-136
WP_001278994.1|2809341_2809980_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136934.1|2809984_2810761_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104441.1|2810849_2812214_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000081550.1|2812307_2813300_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272590.1|2813362_2814502_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|2814641_2815268_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|2815261_2816023_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 8
NZ_CP006636	Escherichia coli PCN061 chromosome, complete genome	4603777	2994182	3034302	4603777	integrase,tRNA,transposase,protease	Staphylococcus_phage(25.0%)	39	3004016:3004032	3029643:3029659
WP_001295379.1|2994182_2994941_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_000105566.1|2995146_2996067_-	agmatinase	NA	NA	NA	NA	NA
WP_047928857.1|2996204_2998181_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001297406.1|2998189_2998321_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001303650.1|2998456_2998672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001298919.1|2998668_2998836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|2998975_3000130_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|3000565_3001960_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_000858396.1|3002036_3002534_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|3002628_3003336_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222508.1|3003415_3004147_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
3004016:3004032	attL	GCAGATGAAATTGCCAT	NA	NA	NA	NA
WP_000593273.1|3004159_3005110_+	glutathione synthase	NA	NA	NA	NA	NA
WP_000126441.1|3005146_3005782_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017111.1|3005781_3006198_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_071884781.1|3006373_3007354_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|3007371_3008076_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|3008093_3008660_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|3008656_3008947_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174735.1|3008954_3009548_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239916.1|3009540_3010677_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000745210.1|3010831_3011839_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394125.1|3011955_3013002_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|3013177_3013897_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107564.1|3014080_3014407_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|3014406_3015126_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_032298508.1|3015286_3016339_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|3016366_3016642_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_000760323.1|3016706_3017786_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001049791.1|3017987_3019244_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_032298507.1|3019293_3021429_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234514.1|3021826_3022534_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_047928858.1|3022912_3024175_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	37.8	1.3e-76
WP_000169527.1|3024586_3024886_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878218.1|3024882_3025749_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_071526750.1|3026453_3027896_-	amino acid permease	NA	NA	NA	NA	NA
WP_000671170.1|3028027_3030397_-	arginine decarboxylase	NA	NA	NA	NA	NA
3029643:3029659	attR	ATGGCAATTTCATCTGC	NA	NA	NA	NA
WP_001331566.1|3030501_3031971_-	amino acid permease	NA	NA	NA	NA	NA
WP_001616050.1|3033534_3033882_+	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_000747051.1|3033951_3034302_+|transposase	transposase	transposase	Q716C1	Shigella_phage	98.9	1.8e-39
>prophage 9
NZ_CP006636	Escherichia coli PCN061 chromosome, complete genome	4603777	4445828	4507486	4603777	integrase,tRNA,transposase	Enterobacteria_phage(17.65%)	52	4456290:4456313	4497991:4498014
WP_000416390.1|4445828_4448684_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.8	2.1e-141
WP_000786399.1|4448683_4449127_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|4449260_4450772_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584117.1|4451038_4452139_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|4452138_4453221_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001514874.1|4453381_4454884_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	7.9e-84
WP_001300770.1|4455013_4456033_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.4e-44
4456290:4456313	attL	GTTCGAGTCCGGCCTTCGGCACCA	NA	NA	NA	NA
WP_001218930.1|4456499_4457765_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.0	2.2e-79
WP_032152094.1|4458088_4459588_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_001477155.1|4459761_4460502_-	porin family protein	NA	NA	NA	NA	NA
WP_047928957.1|4461114_4462764_+	DNA phosphorothioation-dependent restriction protein DptF	NA	NA	NA	NA	NA
WP_000114120.1|4464075_4469130_+	DNA phosphorothioation-dependent restriction protein DptH	NA	NA	NA	NA	NA
WP_001327223.1|4469167_4469686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000071509.1|4469686_4469992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071533805.1|4470040_4470847_+	DGQHR domain-containing protein	NA	NA	NA	NA	NA
WP_000937304.1|4470905_4471262_-	DNA sulfur modification protein DndE	NA	NA	NA	NA	NA
WP_000905896.1|4471261_4473262_-	DNA sulfur modification protein DndD	NA	NA	NA	NA	NA
WP_000041168.1|4473251_4474886_-	DNA phosphorothioation system sulfurtransferase DndC	NA	R9TRT5	Rhizobium_phage	27.9	6.1e-21
WP_000179014.1|4474882_4475968_-	DNA sulfur modification protein DndB	NA	NA	NA	NA	NA
WP_000258195.1|4476430_4476604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000166952.1|4476600_4476945_+	ProQ/FinO family protein	NA	Q2A0A1	Sodalis_phage	38.4	3.1e-07
WP_032152093.1|4476963_4477512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000958149.1|4477754_4477991_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000991584.1|4478059_4478635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001352368.1|4479465_4480674_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_000038138.1|4482596_4483037_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_000769116.1|4484793_4485672_-	DUF3644 domain-containing protein	NA	NA	NA	NA	NA
WP_001075464.1|4485999_4486731_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000169527.1|4487878_4488178_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878218.1|4488174_4489041_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_047928958.1|4489470_4490601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000010408.1|4490785_4491670_+	GTPase	NA	NA	NA	NA	NA
WP_001282919.1|4491872_4492553_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_001097301.1|4492700_4493378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032150870.1|4493407_4493617_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_001175175.1|4493706_4494525_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	6.7e-45
WP_000213716.1|4494616_4495102_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.7	5.3e-13
WP_001186780.1|4495117_4495594_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692350.1|4495680_4495902_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001285607.1|4495981_4496350_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_001094443.1|4496439_4496817_+	toxin	NA	NA	NA	NA	NA
WP_000761685.1|4496813_4497302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001327226.1|4497321_4497519_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_161470833.1|4498734_4499214_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	98.6	3.4e-73
4497991:4498014	attR	GTTCGAGTCCGGCCTTCGGCACCA	NA	NA	NA	NA
WP_000839179.1|4499259_4499664_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|4499660_4500008_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_001741392.1|4501658_4502792_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000416151.1|4503730_4504762_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	1.4e-18
WP_000916805.1|4505032_4505476_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_001741394.1|4505491_4505779_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000345347.1|4505791_4507048_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001305336.1|4507294_4507486_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	65.6	8.3e-15
>prophage 1
NZ_CP006642	Escherichia coli PCN061 plasmid PCN061p6, complete sequence	145722	5857	59561	145722	integrase,transposase	Escherichia_phage(31.25%)	50	NA	NA
WP_001067852.1|5857_6562_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	4.0e-139
WP_000018329.1|6712_7528_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|7717_8422_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_047929042.1|8688_10125_+	glutathione synthase	NA	NA	NA	NA	NA
WP_047929043.1|10542_11547_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_032193599.1|11971_12676_-	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	28.7	6.4e-20
WP_001067858.1|12705_13410_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_077881175.1|13386_13701_+	hypothetical protein	NA	U5P0U6	Shigella_phage	100.0	5.4e-35
WP_025670887.1|13694_14003_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	50.6	8.8e-14
WP_000790483.1|14146_14578_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_000555737.1|14828_16304_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_000697969.1|16296_16977_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.1e-31
WP_000475512.1|17166_18552_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246155.1|18579_18933_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_001381488.1|19046_20339_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_020219104.1|20349_23496_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.4	2.1e-62
WP_000758229.1|23582_24023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001398208.1|24120_26598_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.4	2.9e-83
WP_000843497.1|26638_26836_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_077783444.1|27179_28148_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	8.5e-172
WP_105278499.1|28184_28442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|28868_29573_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001288435.1|30020_31454_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.9	1.4e-106
WP_001532073.1|31487_32702_-	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	2.1e-34
WP_047929045.1|32941_33487_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	42.9	7.9e-34
WP_001067858.1|33533_34238_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000888203.1|34339_34819_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_000347934.1|34888_38041_-	multidrug efflux RND transporter permease subunit OqxB	NA	NA	NA	NA	NA
WP_002914189.1|38064_39240_-	multidrug efflux RND transporter periplasmic adaptor subunit OqxA	NA	NA	NA	NA	NA
WP_001067858.1|39559_40264_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000627495.1|40855_41878_+|transposase	IS21-like element ISSen3 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	85.3	1.9e-174
WP_001531258.1|41874_42657_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	96.5	6.1e-136
WP_000323025.1|42960_43248_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534857.1|43247_43487_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	2.0e-18
WP_001138064.1|44141_47108_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000147567.1|47110_47671_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|47796_48147_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|48349_49363_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001389366.1|49520_49994_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_001067855.1|50679_51384_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014837927.1|51420_52548_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_000248278.1|52598_52826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000951934.1|52849_53041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000587837.1|53522_54065_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557454.1|54077_54938_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_001067858.1|55690_56395_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_020219413.1|56406_56547_-	hypothetical protein	NA	Q1MVP5	Enterobacteria_phage	93.8	1.3e-09
WP_001235713.1|56710_57268_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|57450_58311_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_077783213.1|58592_59561_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	3.3e-184
>prophage 2
NZ_CP006642	Escherichia coli PCN061 plasmid PCN061p6, complete sequence	145722	71125	96265	145722	integrase,transposase,protease	Salmonella_phage(16.67%)	19	71070:71087	91411:91428
71070:71087	attL	GGCTTTGTTGAATAAATC	NA	NA	NA	NA
WP_077249520.1|71125_72094_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	3.0e-185
WP_015060510.1|72095_72389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000051064.1|72404_72635_-	partitioning protein	NA	NA	NA	NA	NA
WP_000864791.1|72686_73307_-	ParA family protein	NA	A2I303	Vibrio_virus	33.8	1.1e-18
WP_063102497.1|76279_76666_+	bleomycin binding protein	NA	NA	NA	NA	NA
WP_000084745.1|76985_77378_-	NimC/NimA family protein	NA	NA	NA	NA	NA
WP_001067858.1|77712_78417_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001162839.1|78748_80956_+	AAA domain-containing protein	NA	NA	NA	NA	NA
WP_000449742.1|80958_83541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085950818.1|83961_85082_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_004193081.1|85094_85463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000600827.1|85510_86488_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	34.9	1.1e-06
WP_047929052.1|87419_88214_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.6	1.6e-51
WP_032437525.1|89600_89906_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_032437523.1|89907_90126_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001261276.1|90725_90956_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000754566.1|90952_91369_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_000227969.1|92710_93787_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
91411:91428	attR	GGCTTTGTTGAATAAATC	NA	NA	NA	NA
WP_047929053.1|94189_96265_-|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
