The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011348	Mycoplasma bovis strain NM2012, complete genome	990348	77393	88754	990348	tRNA	Bodo_saltans_virus(28.57%)	8	NA	NA
WP_013954527.1|77393_78374_+	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	27.1	3.9e-15
WP_013954528.1|78377_79199_+	alpha/beta hydrolase	NA	G9E3U1	Emiliania_huxleyi_virus	32.5	2.3e-08
WP_013954529.1|79282_80047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954530.1|80039_81020_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	40.6	8.1e-53
WP_013954531.1|81144_85521_+	PolC-type DNA polymerase III	NA	A0A0K2SUJ2	Clostridium_phage	31.8	6.2e-12
WP_013954532.1|85926_87150_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	35.1	1.5e-61
WP_013456569.1|87139_88105_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	40.9	3.6e-29
WP_013954533.1|88094_88754_+	uracil-DNA glycosylase	NA	A0A068EP41	Falconid_herpesvirus	36.4	1.6e-28
>prophage 2
NZ_CP011348	Mycoplasma bovis strain NM2012, complete genome	990348	148694	158301	990348	transposase	Mycoplasma_phage(57.14%)	7	NA	NA
WP_013455927.1|148694_149711_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.6	8.4e-37
WP_048349600.1|150038_151880_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	19.1	3.5e-17
WP_013954581.1|152141_153554_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	68.7	1.6e-81
WP_013954582.1|153537_154374_+	ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	62.0	1.5e-87
WP_013954583.1|154366_155260_+	spermidine/putrescine ABC transporter permease	NA	Q6GZ01	Mycoplasma_phage	62.1	2.1e-92
WP_013954584.1|155246_157148_+	membrane protein	NA	Q6GZ00	Mycoplasma_phage	34.7	1.8e-80
WP_013455927.1|157284_158301_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.6	8.4e-37
>prophage 3
NZ_CP011348	Mycoplasma bovis strain NM2012, complete genome	990348	214434	289052	990348	tRNA,transposase,integrase	Bacillus_virus(12.5%)	58	278455:278503	287285:287333
WP_078086163.1|214434_215463_-|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	6.5e-21
WP_014829881.1|217128_218562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048349644.1|219199_220531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041323925.1|220524_222840_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_013954624.1|223014_223464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954625.1|223785_225627_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_013954626.1|225613_226066_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_049773792.1|226176_227892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954628.1|228035_229055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954629.1|229055_229604_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_013455969.1|229671_230232_+	peptide deformylase	NA	NA	NA	NA	NA
WP_013954630.1|230244_231642_+	CvpA family protein	NA	NA	NA	NA	NA
WP_013954631.1|231755_233672_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	41.9	5.7e-119
WP_013954632.1|233685_236271_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	29.6	9.8e-90
WP_013954633.1|236412_237342_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_013954634.1|237343_238060_+	ribonuclease HIII	NA	NA	NA	NA	NA
WP_013954635.1|238247_239222_+	DNA cytosine methyltransferase	NA	R4TMW4	Halovirus	38.4	1.6e-48
WP_013954636.1|239214_239922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456076.1|240391_240721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954691.1|241071_242316_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	5.3e-09
WP_048349607.1|242346_243003_-	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_014829885.1|242986_243973_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	35.7	2.2e-42
WP_013954642.1|244190_244913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038582854.1|245516_246284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954646.1|246969_247914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954647.1|248012_249959_+	transketolase	NA	NA	NA	NA	NA
WP_013954648.1|250021_250576_-	inorganic diphosphatase	NA	A0A1B1ISK6	uncultured_Mediterranean_phage	39.1	2.1e-21
WP_013456603.1|250654_250924_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_013954649.1|251037_251625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954650.1|251718_253887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954651.1|253898_255281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954652.1|255280_255616_+	HIT family protein	NA	B5LJ12	Mycobacterium_phage	33.8	3.6e-05
WP_013954653.1|255734_256433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004024364.1|256486_256639_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_013456491.1|257104_257590_+	thiol peroxidase	NA	NA	NA	NA	NA
WP_013456378.1|257627_257864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954655.1|257853_258918_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_013954656.1|258986_259271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014829889.1|259292_260843_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	35.7	1.9e-80
WP_013954658.1|260845_261652_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_013456627.1|261651_263841_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.5	1.0e-71
WP_013456572.1|263843_264086_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_013456283.1|264428_265016_+	guanylate kinase	NA	A0A0M5KCK5	Mollivirus	38.6	1.2e-08
WP_013456579.1|265021_265774_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_013456514.1|265791_266790_+	serine/threonine protein kinase	NA	Q85453	Moloney_murine_sarcoma_virus	32.2	4.3e-17
WP_013456585.1|266801_267647_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_013455939.1|267633_268296_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_013954660.1|269230_270619_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013954661.1|270787_273013_-	AAA family ATPase	NA	A0A218KCE8	Bacillus_phage	27.7	3.4e-30
WP_048349608.1|273158_274592_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013954662.1|275064_276108_+	AAA family ATPase	NA	A0A2H4UTU5	Bodo_saltans_virus	29.0	9.9e-09
WP_013954663.1|276109_278380_+	S8 family peptidase	NA	NA	NA	NA	NA
278455:278503	attL	ATAATTATGTTTTCTTGTTTTATGCTTAAACTGGGAAACGTAGGAAAAT	NA	NA	NA	NA
WP_013954664.1|278609_281750_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	24.8	2.3e-24
WP_013954666.1|283377_283929_+	C-terminal truncated type I restriction modification DNA specificity domain-containing protein	NA	NA	NA	NA	NA
WP_013954667.1|283925_284618_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_013954668.1|284796_285972_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_013954669.1|286045_287014_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	29.2	3.8e-31
WP_013456559.1|287378_289052_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
287285:287333	attR	ATTTTCCTACGTTTCCCAGTTTAAGCATAAAACAAGAAAACATAATTAT	NA	NA	NA	NA
>prophage 4
NZ_CP011348	Mycoplasma bovis strain NM2012, complete genome	990348	294238	377522	990348	tRNA,transposase	Orpheovirus(13.33%)	56	NA	NA
WP_013954674.1|294238_296905_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	27.3	4.2e-80
WP_013954675.1|296917_297628_+	signal peptidase II	NA	NA	NA	NA	NA
WP_048349609.1|297888_299562_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_013954660.1|300249_301638_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013456429.1|301678_303538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954676.1|304487_305084_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_013456191.1|305064_306027_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	26.5	1.5e-06
WP_048349610.1|306063_308430_+	membrane protein	NA	NA	NA	NA	NA
WP_013456468.1|308500_309367_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_013456636.1|309359_310202_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_013456459.1|310233_311121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456065.1|311211_311478_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_013455955.1|311631_312423_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_013456385.1|313799_314774_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_013456634.1|314760_315585_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_048349611.1|315733_317503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954682.1|317542_318610_-	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_013954683.1|318899_320900_+	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_013954684.1|320880_321336_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_013954685.1|321325_322801_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	33.5	6.0e-52
WP_013456244.1|322800_324093_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_013954686.1|324451_325471_+	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_014829901.1|325880_326255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048349612.1|326905_327667_+	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_013954691.1|329418_330663_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	5.3e-09
WP_013456216.1|331104_332454_+	SidA/IucD/PvdA family monooxygenase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.0	1.0e-13
WP_013954692.1|332446_334057_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_013954693.1|334122_335562_-	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_013954694.1|335673_337761_-	peptidase S41	NA	NA	NA	NA	NA
WP_013954695.1|337724_339116_-	leucine-rich repeat protein	NA	NA	NA	NA	NA
WP_013954696.1|339118_341428_-	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
WP_013954697.1|341746_343108_-	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_013954698.1|343627_344461_+	DNA adenine methylase	NA	A0A1S5PRR3	Streptococcus_phage	45.7	3.6e-54
WP_013954699.1|344767_345721_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_013954700.1|345770_346667_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_013954702.1|348597_349101_-	hypothetical protein	NA	S6AVW3	Thermus_phage	32.8	5.6e-10
WP_048349613.1|349403_351077_-|transposase	IS1634-like element ISMbov3 family transposase	transposase	NA	NA	NA	NA
WP_013954704.1|351390_352755_-	NADH oxidase	NA	NA	NA	NA	NA
WP_048349614.1|353138_354812_+|transposase	IS1634-like element ISMbov3 family transposase	transposase	NA	NA	NA	NA
WP_013954705.1|354941_355727_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_013954706.1|355731_357261_-	RNA polymerase sigma factor	NA	G8CLC7	Synechococcus_phage	33.7	2.0e-29
WP_013954707.1|357253_359194_-	DNA primase	NA	A0A1S5RFD7	Helicobacter_phage	35.3	5.7e-42
WP_013954708.1|359235_360612_-|tRNA	glycine--tRNA ligase	tRNA	A0A2I2L3K8	Orpheovirus	32.0	3.9e-53
WP_013954709.1|360723_362511_-	membrane protein	NA	NA	NA	NA	NA
WP_013954710.1|362961_364317_+	alkylphosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013456298.1|364319_365252_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.0	1.3e-07
WP_013456124.1|365215_366967_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_013456114.1|367073_367319_-	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_013954711.1|367399_369919_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_038582866.1|370155_371202_+	zinc-dependent alcohol dehydrogenase family protein	NA	A0A0K0KVL7	Prochlorococcus_phage	26.9	1.0e-13
WP_013954712.1|371350_373189_-	type I DNA topoisomerase	NA	A0A2P1ELA0	Moumouvirus	32.1	4.8e-75
WP_013456432.1|373568_374006_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_013456362.1|374047_374446_+	single-stranded DNA-binding protein	NA	A0A0H3U4B5	Staphylococcus_phage	30.3	9.3e-08
WP_013456088.1|374465_374792_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_013954713.1|374926_376255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078086165.1|376493_377522_-|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	6.5e-21
>prophage 5
NZ_CP011348	Mycoplasma bovis strain NM2012, complete genome	990348	927533	972024	990348	tRNA,transposase,integrase	Staphylococcus_phage(25.0%)	40	959306:959323	969340:969357
WP_080963877.1|927533_928562_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	6.5e-21
WP_013955061.1|928772_929780_+	membrane protein	NA	NA	NA	NA	NA
WP_014829993.1|930326_931286_+	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_014829994.1|931328_932162_-	variable surface lipoprotein	NA	NA	NA	NA	NA
WP_013456123.1|932447_933197_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_013955063.1|933595_935440_+	ribonuclease J	NA	NA	NA	NA	NA
WP_048349638.1|935574_936726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014829996.1|936915_939333_+	DUF2779 domain-containing protein	NA	NA	NA	NA	NA
WP_013955066.1|939350_939659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013955067.1|939956_941378_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_013955068.1|941370_942684_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_013955069.1|942683_942989_-|tRNA	glutamyl-tRNA(Gln) amidotransferase	tRNA	NA	NA	NA	NA
WP_013955070.1|942994_943849_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_013456616.1|943860_944439_-	segregation/condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	29.7	1.2e-11
WP_013955071.1|944428_945190_-	segregation/condensation protein A	NA	NA	NA	NA	NA
WP_013456430.1|945182_945923_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_013456524.1|945932_946247_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_013456382.1|946420_947731_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_013456261.1|947733_948399_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_014829997.1|948469_948931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013955073.1|949218_950352_-	DnaJ domain-containing protein	NA	A0A1V0SBY2	Catovirus	32.2	3.0e-27
WP_013955074.1|950589_950931_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_013955075.1|951104_952340_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	33.2	3.3e-59
WP_013955076.1|952350_952953_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_013456246.1|953014_953917_+	DegV family protein	NA	NA	NA	NA	NA
WP_014829999.1|954077_954311_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_013955078.1|954350_955073_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_013456073.1|955072_956149_-	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_013955080.1|956274_956847_-	cell division protein Fic	NA	NA	NA	NA	NA
WP_013955081.1|956868_958290_-	YitT family protein	NA	NA	NA	NA	NA
959306:959323	attL	TGATAATAGAAGTGAAAA	NA	NA	NA	NA
WP_013954660.1|959744_961133_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013955084.1|961448_963416_+	type IIA DNA topoisomerase subunit B	NA	G3M9Z3	Bacillus_virus	41.5	8.7e-131
WP_013955085.1|963538_963853_+	thioredoxin family protein	NA	A0A1X9I9P5	Staphylococcus_phage	39.0	1.7e-12
WP_013955086.1|963905_964352_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	37.4	1.8e-12
WP_013955087.1|964472_965540_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_013955088.1|965622_967296_+|transposase	IS1634-like element ISMbov3 family transposase	transposase	NA	NA	NA	NA
WP_013955090.1|967600_968590_-	DUF285 domain-containing protein	NA	NA	NA	NA	NA
WP_048349639.1|969050_970010_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
969340:969357	attR	TTTTCACTTCTATTATCA	NA	NA	NA	NA
WP_013955092.1|970205_970601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456189.1|970779_972024_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	3.1e-09
