The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011024	Lactobacillus reuteri strain IRT chromosome, complete genome	1993967	245554	307313	1993967	protease,tRNA,transposase	Pseudomonas_phage(15.0%)	59	NA	NA
WP_003667184.1|245554_247582_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	36.6	1.1e-91
WP_003667185.1|247574_248393_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_003667186.1|248389_248956_+	ribonuclease M5	NA	NA	NA	NA	NA
WP_003667187.1|248948_249842_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003665581.1|249932_250175_+	Veg family protein	NA	NA	NA	NA	NA
WP_003667188.1|250360_251212_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_003667189.1|251351_252263_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003667190.1|252270_252942_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.2	3.3e-13
WP_003667191.1|252941_253739_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_003667193.1|253970_254816_+	pur operon repressor	NA	NA	NA	NA	NA
WP_003667195.1|254819_256187_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.6	5.4e-31
WP_003667197.1|256261_257251_+	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	34.2	6.5e-42
WP_003667199.1|257426_258164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003667200.1|258242_259064_-	sugar-phosphatase	NA	NA	NA	NA	NA
WP_003667202.1|259063_260431_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	31.4	4.3e-28
WP_003667203.1|260432_261257_-	ligase	NA	NA	NA	NA	NA
WP_130125636.1|261454_261865_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	62.6	5.2e-46
WP_003667207.1|261864_263040_+|transposase	transposase	transposase	A0A0P0ICY9	Lactobacillus_phage	55.2	6.6e-118
WP_003667208.1|263266_263665_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_011953385.1|263710_264268_+	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_003667210.1|264443_266048_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.9	1.3e-148
WP_003667212.1|266560_267943_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.8	1.4e-29
WP_003667214.1|268226_269504_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_003665599.1|269596_269842_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_011953387.1|270003_271320_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003667221.1|271303_272194_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003667224.1|272243_272948_+	class A sortase	NA	NA	NA	NA	NA
WP_003667227.1|273348_274128_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_003667230.1|274139_275006_+	class II fructose-1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_003667231.1|275025_275682_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_003667233.1|275720_276185_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_003667234.1|276314_276884_+	LemA family protein	NA	NA	NA	NA	NA
WP_003667235.1|276886_277783_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_003667237.1|277936_279316_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_003667239.1|279387_280884_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	39.0	3.4e-71
WP_003667241.1|280964_281801_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.4	6.5e-27
WP_003667242.1|282266_283208_+	glutaminase	NA	NA	NA	NA	NA
WP_003664118.1|283353_283812_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	37.0	3.9e-18
WP_003667243.1|284467_285850_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.8	1.7e-27
WP_011953388.1|285933_287223_-	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
WP_003667244.1|287215_287455_-	D-alanine--poly(phosphoribitol) ligase subunit DltC	NA	NA	NA	NA	NA
WP_003667245.1|287474_288692_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	29.3	4.1e-22
WP_003667246.1|288691_290218_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	26.0	1.2e-39
WP_003665629.1|290239_290380_-	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_003667247.1|290710_291073_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_003667248.1|291072_292200_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.0	2.5e-29
WP_003667249.1|292218_292593_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A291I9M9	Lactobacillus_phage	36.0	2.1e-09
WP_003667250.1|292783_294160_+	cytosine permease	NA	NA	NA	NA	NA
WP_003667251.1|294150_295389_+	cytosine deaminase	NA	NA	NA	NA	NA
WP_003667252.1|295773_296565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011953389.1|296673_297312_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_011953390.1|297517_298078_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_003667257.1|298096_301636_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_003667258.1|301632_301905_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_003667261.1|302005_302362_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_003665652.1|302545_303040_+	RNA-binding protein S1	NA	NA	NA	NA	NA
WP_003673314.1|303041_304436_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A0N7G7K4	Chrysochromulina_ericina_virus	27.1	2.8e-14
WP_003667265.1|304428_304971_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	26.8	6.1e-10
WP_003665658.1|305204_307313_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	H8ZJI5	Ostreococcus_tauri_virus	48.4	4.6e-106
>prophage 2
NZ_CP011024	Lactobacillus reuteri strain IRT chromosome, complete genome	1993967	732396	752663	1993967	terminase,protease,head,portal,tail,capsid	Staphylococcus_phage(27.27%)	23	NA	NA
WP_003666838.1|732396_733647_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.2	2.3e-137
WP_003668240.1|733664_734255_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_003674350.1|734256_734556_+	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A1S7FYY8	Listeria_phage	49.0	5.0e-22
WP_003668237.1|734599_734737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003668235.1|734880_736692_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_003668233.1|736756_738073_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_003668232.1|738105_739035_+	ribonuclease Z	NA	NA	NA	NA	NA
WP_012390529.1|739052_739886_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003668229.1|740025_740493_+	hypothetical protein	NA	A7KV88	Bacillus_phage	43.3	4.1e-15
WP_003668227.1|740506_740827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668226.1|740946_741219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668224.1|741236_741737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668222.1|741762_743154_+	primase	NA	A0A0M4RE09	Enterococcus_phage	31.5	4.7e-30
WP_003668220.1|743583_743943_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_003668217.1|743951_744365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668215.1|744368_744893_+	HNH endonuclease	NA	H0USW1	Bacillus_phage	32.7	1.8e-11
WP_003668211.1|745239_745704_+|terminase	phage terminase small subunit P27 family	terminase	A0A1J0MG04	Staphylococcus_phage	33.6	9.2e-15
WP_003668210.1|745703_747413_+|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	38.5	9.9e-107
WP_003668208.1|747577_748696_+|portal	phage portal protein	portal	A0A1D6Z2A2	Staphylococcus_phage	31.9	8.6e-43
WP_011953433.1|748673_750194_+|capsid	phage major capsid protein	capsid	A0A1Q1PVX2	Staphylococcus_phage	35.0	9.3e-40
WP_003668206.1|750250_750673_+	transcriptional regulator	NA	E3W8E2	Leuconostoc_phage	32.7	1.2e-08
WP_003668205.1|750688_750967_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_003668204.1|751994_752663_+	viroplasmin family protein	NA	C1KFJ1	Lactobacillus_virus	33.9	1.2e-31
>prophage 3
NZ_CP011024	Lactobacillus reuteri strain IRT chromosome, complete genome	1993967	782606	791810	1993967	integrase	Lactobacillus_phage(28.57%)	9	776101:776115	789864:789878
776101:776115	attL	AGAAAAATAAGAAGA	NA	NA	NA	NA
WP_003668169.1|782606_784472_+	molecular chaperone DnaK	NA	A0A2P1EIW2	Megavirus	46.6	1.1e-135
WP_003665811.1|784600_785752_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.1	1.3e-30
WP_003668167.1|785882_787718_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.9	4.3e-23
WP_003668165.1|787868_789029_-|integrase	site-specific integrase	integrase	A0A2I7SCV1	Paenibacillus_phage	43.6	8.0e-84
WP_003668163.1|789152_789887_-	hypothetical protein	NA	U5U717	Lactobacillus_phage	38.0	1.1e-38
789864:789878	attR	TCTTCTTATTTTTCT	NA	NA	NA	NA
WP_003668162.1|789891_790128_+	hypothetical protein	NA	U5U783	Lactobacillus_phage	53.4	1.8e-14
WP_003668161.1|790179_790629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003668160.1|790727_791186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080502980.1|791648_791810_-	hypothetical protein	NA	A0A2I6PDG6	Staphylococcus_phage	65.9	1.4e-10
>prophage 4
NZ_CP011024	Lactobacillus reuteri strain IRT chromosome, complete genome	1993967	848169	856234	1993967	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_003666054.1|848169_848445_+	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	68.5	2.6e-25
WP_011953444.1|848580_849846_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003668104.1|849971_851183_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	G3MAR3	Bacillus_virus	39.7	3.8e-36
WP_003668103.1|851184_853095_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.4	1.4e-56
WP_003668102.1|853113_854076_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	61.2	2.5e-115
WP_003666061.1|854091_854580_+	dihydrofolate reductase	NA	A0A1B2IBQ4	Erwinia_phage	40.8	4.3e-23
WP_003666062.1|854568_855213_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_003668100.1|855391_856234_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	33.3	2.3e-16
>prophage 5
NZ_CP011024	Lactobacillus reuteri strain IRT chromosome, complete genome	1993967	870885	909568	1993967	terminase,head,transposase,portal,tail,capsid	Lactobacillus_phage(46.67%)	58	NA	NA
WP_003668074.1|870885_871854_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003668071.1|872047_872452_+	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_003668066.1|872928_873108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668064.1|873135_873630_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003668062.1|873784_874168_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_003666092.1|874185_874377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003668061.1|874391_874937_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_003668059.1|875116_876646_-	gluconokinase	NA	NA	NA	NA	NA
WP_003668057.1|876696_877716_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_080502967.1|877795_878980_-	gluconate permease	NA	NA	NA	NA	NA
WP_080502968.1|879037_880414_-	recombinase family protein	NA	D2KRD2	Lactobacillus_phage	53.3	3.0e-106
WP_003668052.1|880770_881628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011953447.1|881648_882170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003668049.1|882183_882588_-	hypothetical protein	NA	E9LUL0	Lactobacillus_phage	61.3	2.2e-17
WP_003668048.1|882641_883046_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_003668047.1|883062_883437_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Y2R0	Lactobacillus_phage	49.5	9.9e-20
WP_003668046.1|883558_883774_+	helix-turn-helix transcriptional regulator	NA	A0A059T7X5	Listeria_phage	59.3	3.5e-09
WP_003668044.1|883792_884566_+	phage repressor protein/antirepressor Ant	NA	B8R674	Lactobacillus_phage	71.2	6.3e-93
WP_003668042.1|884841_885045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668040.1|885041_885290_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003668039.1|885267_885471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668038.1|885485_885662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668037.1|885661_885934_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003668036.1|885926_886856_+	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	52.8	1.2e-74
WP_003668035.1|886839_887664_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	E9LUM4	Lactobacillus_phage	64.5	1.8e-106
WP_003668034.1|887641_888526_+	DnaD domain protein	NA	Q8SDH3	Lactococcus_phage	43.3	5.4e-16
WP_003666901.1|888518_888848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003666903.1|888844_889216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003666905.1|889291_889570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003666907.1|889754_889907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003666908.1|889950_890145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003666909.1|890144_890405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003666911.1|890404_890746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003666912.1|890745_890934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003666913.1|890941_891202_+	hypothetical protein	NA	A0A2K9VD68	Lactobacillus_phage	37.8	1.3e-05
WP_003666914.1|891201_891513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003666915.1|891575_891719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003666916.1|891800_892223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668032.1|893170_893377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668031.1|893434_894133_+	phosphoadenosine phosphosulfate reductase family protein	NA	NA	NA	NA	NA
WP_003668030.1|894132_894558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668029.1|894571_895351_+	ParB N-terminal domain-containing protein	NA	A0A1B1P7B5	Bacillus_phage	39.5	1.3e-13
WP_003668028.1|895367_895871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668027.1|895845_897141_+|terminase	PBSX family phage terminase large subunit	terminase	H9A0U5	Staphylococcus_phage	54.7	5.9e-128
WP_003668026.1|897140_898802_+|portal	phage portal protein	portal	D2IZF6	Enterococcus_phage	33.2	1.7e-63
WP_003668025.1|898801_899752_+|capsid	minor capsid protein	capsid	NA	NA	NA	NA
WP_003668024.1|899762_900008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668023.1|900137_900791_+	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_003668021.1|900805_901882_+	hypothetical protein	NA	D7RWJ0	Brochothrix_phage	30.3	3.1e-37
WP_003668019.1|901894_902260_+|head,tail	phage head-tail connector protein	head,tail	Q77K22	Lactococcus_phage	34.8	8.5e-08
WP_003668018.1|902259_902574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668016.1|902563_903124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668015.1|903132_903543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668014.1|903545_904193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668013.1|904212_904758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668011.1|904850_905030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668009.1|905033_908684_+	hypothetical protein	NA	A0A2I6QQX2	Streptococcus_phage	28.9	2.4e-49
WP_003668007.1|908680_909568_+|tail	phage tail family protein	tail	NA	NA	NA	NA
>prophage 6
NZ_CP011024	Lactobacillus reuteri strain IRT chromosome, complete genome	1993967	1040703	1096923	1993967	integrase,transposase	Lactococcus_phage(20.0%)	50	1032917:1032934	1106478:1106495
1032917:1032934	attL	TGAAGATGGTAATGATAT	NA	NA	NA	NA
WP_080502969.1|1040703_1041054_-|integrase	tyrosine-type recombinase/integrase	integrase	E9LUK6	Lactobacillus_phage	68.1	8.4e-37
WP_003667773.1|1042805_1043264_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	36.3	1.9e-17
WP_173030300.1|1043491_1044352_-	alpha/beta hydrolase	NA	A0A088FQA2	Mycobacterium_phage	28.1	8.4e-14
WP_003667771.1|1044654_1045302_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_003667770.1|1045434_1045788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003667768.1|1046972_1047737_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_003667767.1|1047747_1048524_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_169471569.1|1048516_1049365_-	acetyl-CoA carboxylase, carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_003667763.1|1049361_1050732_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_003667761.1|1050740_1051175_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_003667760.1|1051167_1051620_-	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_003667758.1|1051626_1052859_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_003667757.1|1052869_1053604_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	NA	NA	NA	NA
WP_003667755.1|1053587_1054538_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_003674025.1|1054537_1054780_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_003667751.1|1054799_1055774_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_003663667.1|1055793_1056240_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003667749.1|1056326_1056773_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_003667748.1|1057097_1058177_+	tyrosine recombinase XerS	NA	A0A0E3XA96	Gordonia_phage	29.6	6.9e-05
WP_003667747.1|1058249_1058408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011953475.1|1060332_1061187_+	patatin family protein	NA	NA	NA	NA	NA
WP_003663651.1|1061203_1061851_+|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	30.7	2.5e-18
WP_003667741.1|1061959_1062850_+	DMT family transporter	NA	NA	NA	NA	NA
WP_003667418.1|1063033_1064644_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	39.3	1.0e-97
WP_003667738.1|1066169_1066859_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_012390566.1|1066851_1067430_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_003667734.1|1067422_1068982_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	37.1	7.1e-19
WP_003667732.1|1068971_1072637_-	nitrate reductase subunit alpha	NA	NA	NA	NA	NA
WP_003667730.1|1072782_1073802_+	HesA/MoeB/ThiF family protein	NA	NA	NA	NA	NA
WP_003667728.1|1073798_1074296_+	MogA/MoaB family molybdenum cofactor biosynthesis protein	NA	NA	NA	NA	NA
WP_003667726.1|1074285_1075503_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_003667725.1|1075481_1075970_+	molybdopterin-guanine dinucleotide biosynthesis protein B	NA	NA	NA	NA	NA
WP_003667723.1|1075969_1076542_+	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_003667721.1|1076531_1076816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012390567.1|1076966_1078022_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003667719.1|1078014_1078668_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003667718.1|1078763_1079036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003667717.1|1079041_1080010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003663626.1|1080014_1080920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003667716.1|1080980_1082174_-	NarK/NasA family nitrate transporter	NA	NA	NA	NA	NA
WP_003667715.1|1082220_1082466_-	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_035161426.1|1082465_1082867_-	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_003667713.1|1082997_1083447_+	flavodoxin	NA	NA	NA	NA	NA
WP_035164271.1|1083439_1084435_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_003667711.1|1084431_1085208_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.2	1.1e-15
WP_163622757.1|1085261_1086281_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_080502971.1|1088520_1088724_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003667706.1|1088706_1090089_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.0	7.9e-30
WP_041816918.1|1090683_1094352_-	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_003664118.1|1096464_1096923_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	37.0	3.9e-18
1106478:1106495	attR	TGAAGATGGTAATGATAT	NA	NA	NA	NA
>prophage 7
NZ_CP011024	Lactobacillus reuteri strain IRT chromosome, complete genome	1993967	1100931	1173889	1993967	transposase	Lactobacillus_phage(21.43%)	56	NA	NA
WP_003667693.1|1100931_1102476_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	24.2	1.4e-22
WP_003667691.1|1102622_1104512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003667690.1|1104512_1104818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003667689.1|1105097_1105907_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_012390570.1|1105899_1106718_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003667687.1|1106714_1107362_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_003667685.1|1107437_1108697_-	chloride channel protein	NA	NA	NA	NA	NA
WP_003667683.1|1108854_1111161_-	DUF4968 domain-containing protein	NA	NA	NA	NA	NA
WP_035164274.1|1111305_1111947_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_003667102.1|1112119_1112308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003667088.1|1112297_1112654_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_003667087.1|1112720_1114250_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_003667086.1|1119943_1120432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003667085.1|1120462_1121470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003667084.1|1121656_1121938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003667083.1|1122052_1122889_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_003673269.1|1123052_1123757_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_011953477.1|1123753_1124314_-	Fic family protein	NA	S4TP71	Salmonella_phage	28.8	7.7e-08
WP_003667079.1|1124315_1124729_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003667077.1|1124838_1127097_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_011953478.1|1127302_1127980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003667074.1|1128619_1131721_-	SMC family ATPase	NA	NA	NA	NA	NA
WP_003667073.1|1131722_1132841_-	exonuclease SbcCD subunit D	NA	A0A143FIT9	Bacillus_phage	25.7	7.1e-05
WP_003667071.1|1132993_1133170_-	hypothetical protein	NA	A0A0A1ERA5	Lactobacillus_phage	55.6	6.1e-12
WP_003667070.1|1133188_1133965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003667066.1|1137611_1139504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003667064.1|1139813_1140605_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_003667062.1|1140625_1141426_-	helix-turn-helix transcriptional regulator	NA	A8ATJ9	Listeria_phage	32.7	8.7e-05
WP_003667061.1|1141619_1141877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003667060.1|1141955_1143359_-	amino acid permease	NA	NA	NA	NA	NA
WP_003667059.1|1143351_1144284_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_003667058.1|1144728_1145154_-	protein-export chaperone SecB	NA	A0A2D1GPE1	Lactobacillus_phage	37.7	3.4e-16
WP_003667057.1|1145445_1146414_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003667055.1|1146415_1147333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003667054.1|1147421_1148180_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	48.2	8.7e-63
WP_011953482.1|1148184_1149396_-|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	45.7	2.1e-90
WP_003667051.1|1149572_1150664_-	ATP-dependent helicase	NA	A0A1V0SG90	Hokovirus	21.7	2.4e-05
WP_003667049.1|1150648_1152262_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_003667043.1|1153503_1155522_-	NTPase KAP	NA	NA	NA	NA	NA
WP_003667042.1|1156932_1158591_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_003667041.1|1158615_1159461_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.7	4.2e-34
WP_003667039.1|1160792_1161794_-	LCP family protein	NA	NA	NA	NA	NA
WP_003667038.1|1162190_1162589_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003667037.1|1162694_1163219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003667036.1|1163353_1164529_-|transposase	transposase	transposase	A0A0P0ICY9	Lactobacillus_phage	55.4	7.8e-119
WP_035167525.1|1164528_1164927_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	62.1	4.3e-45
WP_003667034.1|1165042_1165285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003667032.1|1165477_1166053_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003667031.1|1166062_1166299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003667030.1|1166340_1166853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003667028.1|1166899_1168402_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_003663508.1|1168536_1168722_-	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_003676754.1|1168804_1170634_-	monovalent cation:proton antiporter family protein	NA	NA	NA	NA	NA
WP_003667025.1|1170772_1172176_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003667023.1|1172327_1173041_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	36.6	1.5e-27
WP_003667021.1|1173037_1173889_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	24.5	3.4e-15
>prophage 8
NZ_CP011024	Lactobacillus reuteri strain IRT chromosome, complete genome	1993967	1326773	1392457	1993967	protease,tRNA,integrase,transposase	Enterococcus_phage(26.67%)	57	1387735:1387754	1397642:1397661
WP_003668531.1|1326773_1327451_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003668533.1|1327434_1327680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003668535.1|1327796_1328720_-	ribokinase	NA	NA	NA	NA	NA
WP_003668536.1|1328776_1329793_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003668538.1|1329874_1330483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003664204.1|1330698_1331331_+	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	46.4	2.1e-46
WP_003668540.1|1331365_1332412_-	glucosaminidase domain-containing protein	NA	A0A249Y0X5	Enterococcus_phage	32.2	6.9e-10
WP_003668541.1|1332501_1333014_-	universal stress protein	NA	NA	NA	NA	NA
WP_003668542.1|1333039_1334443_-	dipeptidase PepV	NA	NA	NA	NA	NA
WP_003668543.1|1334531_1335392_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_003673339.1|1335455_1337105_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_003668545.1|1337219_1337483_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_003668546.1|1337547_1339968_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	68.1	0.0e+00
WP_003668547.1|1340289_1341477_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	67.7	3.6e-148
WP_003668549.1|1341637_1342177_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_003668551.1|1342599_1344039_-	MFS transporter	NA	NA	NA	NA	NA
WP_003675841.1|1344162_1344618_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_003668553.1|1344649_1345996_-	amino acid permease	NA	NA	NA	NA	NA
WP_003668554.1|1346086_1346698_+	VanZ family protein	NA	NA	NA	NA	NA
WP_003664220.1|1346709_1346877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668555.1|1347044_1347569_+	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_003668556.1|1347592_1348036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003668557.1|1348035_1349538_-	LytTR family transcriptional regulator	NA	Q6DMX4	Streptococcus_phage	27.2	4.4e-34
WP_003664225.1|1349664_1350096_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_003668559.1|1350228_1351077_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_003668560.1|1351174_1352473_-	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_003668561.1|1352465_1353707_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003668562.1|1354002_1354764_+	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	42.0	7.6e-51
WP_003668563.1|1354885_1355593_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0E3XCL7	Enterococcus_phage	46.4	9.3e-27
WP_003668564.1|1355921_1357622_-	phosphoenolpyruvate carboxykinase	NA	NA	NA	NA	NA
WP_011953516.1|1357776_1358538_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003668566.1|1358922_1359816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003664234.1|1359824_1360403_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A0C5K925	Enterococcus_phage	59.7	3.6e-53
WP_003668567.1|1360468_1362703_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	59.4	1.8e-249
WP_003668569.1|1363108_1364506_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_003668571.1|1364543_1365098_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003668573.1|1371892_1372141_-	YkuJ family protein	NA	NA	NA	NA	NA
WP_003668575.1|1372198_1373212_-	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_011953518.1|1373211_1374240_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_003668578.1|1374242_1375460_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_003668580.1|1375693_1377424_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	27.0	1.5e-14
WP_003664342.1|1377423_1377690_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_003664345.1|1377811_1377997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003668582.1|1378272_1380477_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	41.1	3.3e-123
WP_003668584.1|1380527_1381136_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_003668586.1|1381285_1382011_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_003668588.1|1382141_1382828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003668591.1|1382827_1383694_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	1.4e-19
WP_011953520.1|1383671_1384055_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003668595.1|1384218_1385193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003668597.1|1385126_1386569_-	glycosyl hydrolase 53 family protein	NA	NA	NA	NA	NA
WP_003668598.1|1387134_1387689_-	cell wall-binding protein	NA	NA	NA	NA	NA
WP_003668600.1|1387598_1387958_-	hypothetical protein	NA	NA	NA	NA	NA
1387735:1387754	attL	GGATCAAAGTAGTAATATGT	NA	NA	NA	NA
WP_003668601.1|1388090_1388309_-|transposase	transposase	transposase	A0A1B1P773	Bacillus_phage	40.8	6.2e-06
WP_003668602.1|1388339_1388714_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1B1P773	Bacillus_phage	37.8	1.2e-12
WP_003668604.1|1388746_1389598_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	24.8	3.4e-15
WP_003668612.1|1392109_1392457_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
1397642:1397661	attR	GGATCAAAGTAGTAATATGT	NA	NA	NA	NA
>prophage 9
NZ_CP011024	Lactobacillus reuteri strain IRT chromosome, complete genome	1993967	1638004	1657231	1993967	protease,integrase,transposase	Streptococcus_phage(40.0%)	19	1640739:1640753	1668395:1668409
WP_003668960.1|1638004_1638691_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_011953550.1|1638714_1639329_-	sugar permease	NA	NA	NA	NA	NA
WP_003668962.1|1639634_1640690_-	zinc-dependent alcohol dehydrogenase family protein	NA	K7Z7U2	Megavirus	23.0	8.5e-08
1640739:1640753	attL	GAAAAAGCTGATAAC	NA	NA	NA	NA
WP_003668964.1|1642010_1642157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080502982.1|1642157_1642340_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003668965.1|1642456_1643851_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	39.5	1.8e-29
WP_003668966.1|1644065_1645313_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.9	5.7e-11
WP_003668967.1|1645380_1645623_-	cytochrome b5	NA	NA	NA	NA	NA
WP_011953551.1|1645714_1646185_-|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.2	1.6e-11
WP_003668972.1|1646832_1647420_-	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_003668974.1|1647873_1649085_+	putative hydroxymethylpyrimidine transporter CytX	NA	NA	NA	NA	NA
WP_003668975.1|1649158_1649680_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003668976.1|1649895_1650360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003668977.1|1650372_1651440_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011953553.1|1651532_1652693_-	MFS transporter	NA	NA	NA	NA	NA
WP_035164165.1|1652711_1653248_+	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_003668981.1|1653439_1654312_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_003668982.1|1654382_1655621_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_003668983.1|1656013_1657231_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	28.0	2.7e-21
1668395:1668409	attR	GTTATCAGCTTTTTC	NA	NA	NA	NA
