The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010855	Marinovum algicola DG 898 chromosome, complete genome	3727131	1653896	1694165	3727131	protease,integrase,terminase,tail,portal	Pandoravirus(13.33%)	49	1666233:1666251	1682855:1682873
WP_048531492.1|1653896_1654424_-|tail	phage tail protein	tail	E3T4R8	Cafeteria_roenbergensis_virus	38.8	2.0e-18
WP_048531494.1|1654677_1655988_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_048531496.1|1656073_1656997_-	site-specific tyrosine recombinase XerD	NA	A0A1P8DJJ6	Virus_Rctr41k	28.8	1.4e-19
WP_048531498.1|1657002_1658559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170850513.1|1658548_1658698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048531500.1|1658841_1659387_+	shikimate kinase	NA	NA	NA	NA	NA
WP_048531502.1|1659386_1660499_+	3-dehydroquinate synthase	NA	A9YVT7	Ostreococcus_tauri_virus	30.2	3.0e-19
WP_048531504.1|1660585_1661227_-	DUF1638 domain-containing protein	NA	NA	NA	NA	NA
WP_048531506.1|1661223_1661925_-	cobalamin-dependent protein	NA	NA	NA	NA	NA
WP_048531507.1|1662103_1663189_+	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
WP_048531509.1|1663291_1664308_-	betaine--homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_048531510.1|1664517_1664832_-	DUF1476 domain-containing protein	NA	NA	NA	NA	NA
WP_048531512.1|1664993_1665755_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	42.2	1.1e-46
WP_048531514.1|1665847_1666078_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_048531516.1|1666123_1666798_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
1666233:1666251	attL	CGCTGCCCGAGGGGGTCGA	NA	NA	NA	NA
WP_048531518.1|1666850_1668635_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_048531520.1|1668661_1669999_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_048531522.1|1670053_1671175_+	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	45.3	8.1e-49
WP_082154581.1|1671183_1671786_+	aminotransferase class IV	NA	A0A0B5J984	Pandoravirus	30.7	1.2e-09
WP_048531525.1|1671861_1672938_-	ornithine cyclodeaminase	NA	A0A1V0SL93	Klosneuvirus	46.7	1.7e-83
WP_048531526.1|1672937_1673864_-	arginase	NA	A0A1V0SJM8	Klosneuvirus	34.1	4.3e-24
WP_048531527.1|1673982_1674408_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_048531529.1|1674425_1674893_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_048531531.1|1674892_1675471_-	DedA family protein	NA	NA	NA	NA	NA
WP_048531533.1|1675751_1676795_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_048531535.1|1676791_1677004_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_048531537.1|1677006_1677234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048531539.1|1677230_1677818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148562841.1|1677814_1678057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148562842.1|1678268_1678625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148562843.1|1679061_1679397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158499022.1|1679393_1679570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158499023.1|1679718_1679859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048531545.1|1679963_1680698_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_048531547.1|1680690_1681281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048531549.1|1681277_1681931_+	hypothetical protein	NA	G8DGC1	Emiliania_huxleyi_virus	46.0	5.8e-39
WP_048531551.1|1682058_1682673_+	hypothetical protein	NA	A0A0K1LLF3	Rhodobacter_phage	37.6	1.6e-27
WP_048531553.1|1682799_1683453_+	DUF1441 family protein	NA	NA	NA	NA	NA
1682855:1682873	attR	CGCTGCCCGAGGGGGTCGA	NA	NA	NA	NA
WP_048531555.1|1683457_1685599_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	35.4	2.3e-92
WP_048531557.1|1685609_1685813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048531560.1|1685818_1687285_+|portal	phage portal protein	portal	Q9JMM5	Wolbachia_phage	33.6	1.5e-50
WP_048531561.1|1687271_1689395_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	C7BGG9	Burkholderia_phage	34.6	1.9e-14
WP_048531563.1|1689500_1689827_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_048531565.1|1689826_1690159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148562844.1|1690158_1690356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148562845.1|1690327_1690747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048531568.1|1690779_1691172_+	hypothetical protein	NA	A0A291AUU2	Sinorhizobium_phage	36.9	8.5e-14
WP_048531570.1|1691168_1691663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048531572.1|1691804_1694165_+|tail	phage tail tape measure protein	tail	A0A0K1LLB8	Rhodobacter_phage	49.4	2.6e-57
>prophage 2
NZ_CP010855	Marinovum algicola DG 898 chromosome, complete genome	3727131	1710060	1761145	3727131	integrase,protease,transposase,head	Corynebacterium_phage(42.86%)	55	1754437:1754482	1766980:1767025
WP_048528913.1|1710060_1711266_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	49.0	2.3e-97
WP_148562848.1|1711837_1712494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148562849.1|1712495_1714802_+	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_148562850.1|1714990_1715227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048531601.1|1715321_1715645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048531605.1|1716653_1717136_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_048531607.1|1717281_1718232_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_048531609.1|1718315_1719935_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_148562851.1|1719947_1720139_+	DUF2783 domain-containing protein	NA	NA	NA	NA	NA
WP_048531613.1|1720164_1720542_-	DUF1428 domain-containing protein	NA	NA	NA	NA	NA
WP_048531615.1|1720566_1721049_-	VOC family protein	NA	NA	NA	NA	NA
WP_048531617.1|1721045_1721477_-	VOC family protein	NA	NA	NA	NA	NA
WP_048531618.1|1722030_1722609_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_048531620.1|1722693_1723710_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_048531621.1|1723706_1724987_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_048531622.1|1724983_1725547_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_048531623.1|1725613_1726597_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_048531625.1|1726752_1727406_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_048531628.1|1727466_1728411_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_074835802.1|1728401_1728887_-	RidA family protein	NA	NA	NA	NA	NA
WP_148562919.1|1729196_1730612_+	amidase	NA	NA	NA	NA	NA
WP_048531632.1|1730598_1731585_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_048531633.1|1731605_1732115_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_048531635.1|1732124_1733399_+	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_048531637.1|1733617_1734931_-	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_048531639.1|1734935_1735472_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_082154455.1|1735543_1736230_-	TRAP transporter substrate-binding protein DctP	NA	NA	NA	NA	NA
WP_048528918.1|1736290_1737856_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_048528916.1|1737788_1738517_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	33.2	1.8e-33
WP_082154456.1|1738565_1738910_-	heme-binding protein	NA	NA	NA	NA	NA
WP_048531641.1|1738999_1739608_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_048533766.1|1739604_1741074_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_082154583.1|1741502_1741850_-	RidA family protein	NA	NA	NA	NA	NA
WP_053083350.1|1741852_1742620_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_048531645.1|1742622_1743312_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_048531647.1|1743378_1744170_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_048531648.1|1744193_1744964_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	39.8	1.2e-32
WP_048531651.1|1744960_1746349_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_048531653.1|1746341_1746659_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_048531655.1|1746624_1747749_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_158499024.1|1747887_1748754_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_048531658.1|1749547_1749796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048528913.1|1750129_1751335_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	49.0	2.3e-97
WP_148562852.1|1751451_1751934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148562853.1|1752038_1754306_-	hypothetical protein	NA	NA	NA	NA	NA
1754437:1754482	attL	TTGGCTCCGGCGGTAGGGATCGAACCTACGACCAATTGATTAACAG	NA	NA	NA	NA
WP_048531662.1|1754522_1755647_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A076G7B8	Sinorhizobium_phage	50.7	1.5e-106
WP_048528913.1|1756005_1757211_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	49.0	2.3e-97
WP_082154458.1|1757129_1757396_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_048531664.1|1757482_1757725_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_148562854.1|1757721_1758348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148562855.1|1758348_1758609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048531668.1|1758601_1758991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148562856.1|1758987_1760001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048531671.1|1759997_1760561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158499025.1|1760557_1761145_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1B2APW1	Phage_Wrath	30.7	4.0e-07
1766980:1767025	attR	TTGGCTCCGGCGGTAGGGATCGAACCTACGACCAATTGATTAACAG	NA	NA	NA	NA
>prophage 3
NZ_CP010855	Marinovum algicola DG 898 chromosome, complete genome	3727131	1874991	1885921	3727131	transposase,terminase	Streptococcus_phage(25.0%)	11	NA	NA
WP_048531815.1|1874991_1875477_-|terminase	phage terminase small subunit P27 family	terminase	Q6DMU4	Streptococcus_phage	40.3	2.8e-22
WP_048531816.1|1876187_1876931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048531818.1|1876940_1877981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048531819.1|1878282_1878984_-	recombinase family protein	NA	A0A0F7L6S1	uncultured_marine_virus	45.7	3.4e-37
WP_053083352.1|1879061_1879568_-|terminase	phage terminase small subunit P27 family	terminase	Q6DMU4	Streptococcus_phage	42.9	1.1e-21
WP_048531820.1|1879564_1880011_-	hypothetical protein	NA	A0A0R6PHW5	Moraxella_phage	58.8	1.9e-25
WP_048531821.1|1880010_1880229_-	hypothetical protein	NA	K4I1E3	Acidithiobacillus_phage	53.5	1.4e-10
WP_048531823.1|1880225_1881503_-	site-specific DNA-methyltransferase	NA	A0A0A8ILE7	Aurantimonas_phage	56.9	3.6e-130
WP_048531824.1|1882023_1883589_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_048528916.1|1883521_1884250_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	33.2	1.8e-33
WP_048531825.1|1884412_1885921_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	50.7	1.4e-125
>prophage 4
NZ_CP010855	Marinovum algicola DG 898 chromosome, complete genome	3727131	2193837	2207712	3727131	protease,head,tail,capsid,portal	Paracoccus_phage(30.0%)	16	NA	NA
WP_048532093.1|2193837_2197833_-	glycoside hydrolase TIM-barrel-like domain-containing protein	NA	A0A0B5A7K5	Paracoccus_phage	39.9	1.6e-232
WP_048532094.1|2197832_2198276_-	peptidase	NA	A0A1V0DYB6	Dinoroseobacter_phage	49.3	6.9e-28
WP_048532095.1|2198272_2199160_-	DUF2163 domain-containing protein	NA	A0A0K0PVK1	Roseobacter_phage	38.1	7.8e-55
WP_048532096.1|2199156_2199789_-	DUF2460 domain-containing protein	NA	A0A0B5A2K3	Paracoccus_phage	46.9	1.8e-53
WP_048532097.1|2199805_2200456_-|tail	phage tail tape measure protein	tail	D6PFD6	uncultured_phage	31.8	7.8e-12
WP_074836801.1|2200455_2200626_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_048532099.1|2200649_2200976_-	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_048532100.1|2200979_2201393_-|tail	phage major tail protein, TP901-1 family	tail	A0A1J0GVL1	Pseudoalteromonas_phage	31.9	5.9e-05
WP_048532101.1|2201416_2201827_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_048532102.1|2201823_2202162_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_048533815.1|2202158_2202764_-	gene transfer agent protein	NA	NA	NA	NA	NA
WP_048532103.1|2202927_2204106_-|capsid	phage major capsid protein	capsid	B0VK33	Azospirillum_phage	41.7	1.9e-64
WP_193388040.1|2204128_2204683_-|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	46.3	6.8e-33
WP_048532105.1|2204756_2204978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048532106.1|2204970_2206149_-|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	36.9	4.1e-59
WP_193388041.1|2206344_2207712_-	DNA-packaging protein	NA	A0A1V0DY66	Dinoroseobacter_phage	39.0	4.7e-75
>prophage 5
NZ_CP010855	Marinovum algicola DG 898 chromosome, complete genome	3727131	2500280	2551545	3727131	protease,transposase,head,tail	Thiobacimonas_phage(34.21%)	58	NA	NA
WP_048532364.1|2500280_2501546_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.3	5.6e-131
WP_048532365.1|2501671_2502301_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	60.8	7.9e-62
WP_048532366.1|2502417_2504397_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_048532367.1|2504513_2505101_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.6	4.4e-22
WP_048532368.1|2505199_2506492_+	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_148562923.1|2506628_2507759_+	polysaccharide biosynthesis/export family protein	NA	NA	NA	NA	NA
WP_048532370.1|2507763_2509797_+	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_048532371.1|2509805_2510876_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	32.4	1.7e-40
WP_048532372.1|2510917_2511385_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_048532373.1|2511638_2513393_-	DNA methylase	NA	A0A2L1IZ21	Streptomyces_phage	44.8	8.6e-122
WP_148562866.1|2513590_2516701_-	hypothetical protein	NA	A0A076GD25	Sinorhizobium_phage	54.6	3.5e-17
WP_048532374.1|2516720_2520044_-	hypothetical protein	NA	A0A1B0T6D1	Thiobacimonas_phage	45.8	2.9e-251
WP_048532375.1|2520040_2520451_-	C40 family peptidase	NA	M4SRS7	Rhodobacter_phage	50.4	1.1e-30
WP_048532376.1|2520447_2520972_-	hypothetical protein	NA	A0A1B0T6D7	Thiobacimonas_phage	56.3	8.7e-46
WP_048532377.1|2520968_2521391_-	hypothetical protein	NA	A0A1B0T6E0	Thiobacimonas_phage	55.3	1.4e-25
WP_048532378.1|2521387_2524183_-|tail	phage tail length tape measure family protein	tail	I3UM47	Rhodobacter_phage	38.2	3.2e-14
WP_082154504.1|2524184_2524469_-	DUF1799 domain-containing protein	NA	NA	NA	NA	NA
WP_048532379.1|2524534_2524855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048532380.1|2524870_2525800_-	hypothetical protein	NA	A0A1B0T6E1	Thiobacimonas_phage	53.9	5.4e-91
WP_158499038.1|2525800_2525950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048532381.1|2525946_2526375_-	hypothetical protein	NA	A0A1B0T6E9	Thiobacimonas_phage	44.8	1.2e-29
WP_048532382.1|2526374_2526803_-	DUF1320 domain-containing protein	NA	M4SPQ8	Rhodobacter_phage	59.9	1.5e-43
WP_048532383.1|2527077_2527434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048532384.1|2527446_2528340_-|head	Mu-like prophage major head subunit gpT family protein	head	M4SRT6	Rhodobacter_phage	74.4	8.8e-131
WP_048532385.1|2528352_2528787_-	hypothetical protein	NA	A0A1B0T6E4	Thiobacimonas_phage	66.7	6.1e-45
WP_048532386.1|2528786_2529833_-	hypothetical protein	NA	A0A1B0T6E7	Thiobacimonas_phage	52.8	4.2e-92
WP_048532387.1|2529937_2530435_-	phage virion morphogenesis protein	NA	M4ST99	Rhodobacter_phage	45.0	9.8e-31
WP_048532388.1|2530437_2530617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053083364.1|2530613_2531552_-	hypothetical protein	NA	A0A1B0T6H8	Thiobacimonas_phage	68.4	1.1e-96
WP_048532389.1|2531544_2533191_-	DUF935 domain-containing protein	NA	A0A1B0T6F2	Thiobacimonas_phage	63.9	3.6e-199
WP_148562924.1|2533307_2534963_-	hypothetical protein	NA	A0A219VH72	Ochrobactrum_phage	63.4	3.1e-182
WP_048532391.1|2534983_2535169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048532392.1|2535165_2535435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053083365.1|2535431_2535785_-	hypothetical protein	NA	M4T564	Rhodobacter_phage	61.4	8.2e-24
WP_048532393.1|2535781_2536363_-	DUF3486 family protein	NA	A0A1B0T6K5	Pelagibaca_phage	52.3	7.6e-43
WP_048532394.1|2536367_2536667_-	hypothetical protein	NA	A0A1B1P718	Rhodovulum_phage	65.7	1.6e-28
WP_048532395.1|2536667_2537063_-	DUF2730 family protein	NA	A0A1B0T6F6	Thiobacimonas_phage	43.0	2.4e-16
WP_048532396.1|2537035_2537563_-	hypothetical protein	NA	M4SRV1	Rhodobacter_phage	50.3	1.1e-40
WP_048532397.1|2537562_2538474_-	peptidoglycan-binding protein	NA	G8GWD3	Rhodobacter_phage	52.4	1.6e-71
WP_048532398.1|2538593_2538986_-	hypothetical protein	NA	M4SNV1	Rhodobacter_phage	46.3	2.9e-22
WP_082154595.1|2538982_2539588_-	S-adenosylmethionine-binding protein	NA	M4SPS7	Rhodobacter_phage	72.2	2.1e-80
WP_082154505.1|2539590_2539845_-	hypothetical protein	NA	A0A1B0T6G9	Thiobacimonas_phage	38.6	2.9e-07
WP_048533877.1|2539841_2540300_-	regulatory protein GemA	NA	A0A1B0T6H1	Thiobacimonas_phage	60.5	2.3e-42
WP_158499039.1|2540412_2540586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048532400.1|2540591_2540912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048532401.1|2540913_2541555_-	DUF3164 family protein	NA	M4STB6	Rhodobacter_phage	60.2	3.1e-69
WP_148562867.1|2541551_2541941_-	hypothetical protein	NA	W6MW33	Pseudomonas_phage	65.2	1.3e-09
WP_048532403.1|2541933_2542263_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_048532404.1|2542252_2542630_-	hypothetical protein	NA	A0A1B0T6M5	Pelagibaca_phage	55.4	1.1e-29
WP_048532405.1|2542626_2543196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082154506.1|2543192_2543936_-	AAA family ATPase	NA	M4SPU5	Rhodobacter_phage	45.6	9.1e-49
WP_048532407.1|2544004_2546158_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A1B1P6Z4	Rhodovulum_phage	47.8	2.9e-180
WP_048532408.1|2546150_2547011_-	ParB N-terminal domain-containing protein	NA	A0A1B0T6H9	Thiobacimonas_phage	38.5	1.6e-41
WP_048532409.1|2547010_2547484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048532410.1|2547953_2548226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148562868.1|2548313_2549072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148562869.1|2549108_2549660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048528913.1|2550339_2551545_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	49.0	2.3e-97
>prophage 6
NZ_CP010855	Marinovum algicola DG 898 chromosome, complete genome	3727131	2555778	2563778	3727131	transposase	Pelagibaca_phage(33.33%)	12	NA	NA
WP_048528916.1|2555778_2556507_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	33.2	1.8e-33
WP_048532415.1|2556613_2556937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048532416.1|2556929_2557259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048532417.1|2557248_2557626_-	hypothetical protein	NA	A0A1B0T6M5	Pelagibaca_phage	55.7	1.4e-29
WP_048532418.1|2557622_2558192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082154508.1|2558188_2558932_-	AAA family ATPase	NA	M4SPU5	Rhodobacter_phage	45.6	5.9e-48
WP_048532420.1|2558999_2561153_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A1B1P6Z4	Rhodovulum_phage	48.7	1.0e-185
WP_048532421.1|2561145_2561982_-	ParB N-terminal domain-containing protein	NA	A0A1B1P710	Rhodovulum_phage	44.0	5.3e-45
WP_048532422.1|2561981_2562236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048532423.1|2562232_2562703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148562871.1|2562702_2562951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048532425.1|2563058_2563778_+	hypothetical protein	NA	A0A1B0T6N0	Pelagibaca_phage	31.4	6.6e-12
>prophage 1
NZ_CP010865	Marinovum algicola DG 898 plasmid pMaD10, complete sequence	52512	0	2779	52512		Enterobacteria_phage(100.0%)	1	NA	NA
WP_048536046.1|1390_2779_+	AAA family ATPase	NA	Q1MVJ3	Enterobacteria_phage	26.2	5.4e-10
>prophage 2
NZ_CP010865	Marinovum algicola DG 898 plasmid pMaD10, complete sequence	52512	12057	22808	52512		Enterobacteria_phage(25.0%)	9	NA	NA
WP_048536059.1|12057_14766_-	S8 family serine peptidase	NA	A0A1V0S9L2	Catovirus	26.1	4.1e-14
WP_048536060.1|14956_15520_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	47.5	6.5e-39
WP_048536062.1|15516_16617_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	48.2	2.5e-87
WP_048536063.1|16613_17456_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.1	3.7e-30
WP_048536064.1|17455_18370_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	55.3	2.6e-85
WP_158499077.1|18317_19124_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_053083434.1|19484_20453_-	DUF2793 domain-containing protein	NA	A0A0K1LM54	Rhodobacter_phage	38.1	1.4e-28
WP_048536066.1|20652_21654_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.4	8.8e-39
WP_048536069.1|21650_22808_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2K9L0G1	Tupanvirus	30.9	2.1e-28
>prophage 3
NZ_CP010865	Marinovum algicola DG 898 plasmid pMaD10, complete sequence	52512	29333	30404	52512		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_048536078.1|29333_30404_+	pseudaminic acid synthase	NA	A0A1B1IVE2	uncultured_Mediterranean_phage	33.5	6.6e-24
>prophage 4
NZ_CP010865	Marinovum algicola DG 898 plasmid pMaD10, complete sequence	52512	44952	49791	52512		Paramecium_bursaria_Chlorella_virus(50.0%)	4	NA	NA
WP_048536093.1|44952_46773_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1HMK6	Paramecium_bursaria_Chlorella_virus	38.9	9.6e-100
WP_082154730.1|46908_47733_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_048536112.1|47842_49120_+	sugar transporter	NA	NA	NA	NA	NA
WP_048536095.1|49125_49791_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.6	2.2e-06
