The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011975	Yersinia aleksiciae strain 159 chromosome, complete genome	4000307	346	8087	4000307	terminase	Pectobacterium_phage(25.0%)	12	NA	NA
WP_048615641.1|346_1990_-|terminase	phage terminase large subunit	terminase	H9C191	Pectobacterium_phage	85.2	2.8e-292
WP_012105237.1|2116_2356_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	63.3	5.2e-22
WP_048615643.1|2345_2630_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	77.7	2.2e-35
WP_048615646.1|2640_3657_-|terminase	terminase small subunit	terminase	I6X6R5	Burkholderia_virus	42.5	1.5e-41
WP_048615648.1|3738_4182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025378495.1|4383_4638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048615652.1|4640_5255_-	hypothetical protein	NA	C9E2P8	Enterococcus_phage	62.2	1.6e-67
WP_074007556.1|5251_5761_-	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	46.6	1.1e-34
WP_048615654.1|6064_6631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048615656.1|7016_7349_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_048615657.1|7341_7872_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	71.9	3.9e-70
WP_019082932.1|7871_8087_-	peptidoglycan-binding protein LysM	NA	H9C183	Pectobacterium_phage	55.6	4.0e-13
>prophage 2
NZ_CP011975	Yersinia aleksiciae strain 159 chromosome, complete genome	4000307	11171	23894	4000307	integrase	Pectobacterium_phage(61.54%)	19	7409:7422	30891:30904
7409:7422	attL	TTATTTGAGCGGAT	NA	NA	NA	NA
WP_048620131.1|11171_11519_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	72.5	2.7e-43
WP_048615663.1|11560_11845_-	DUF1364 domain-containing protein	NA	H9C174	Pectobacterium_phage	79.8	6.1e-38
WP_048615665.1|11853_12447_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	57.9	1.3e-61
WP_048615667.1|12520_12703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048615669.1|12850_14911_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	53.0	6.7e-235
WP_048615672.1|14907_15408_-	hypothetical protein	NA	H9C166	Pectobacterium_phage	43.1	5.6e-18
WP_048620132.1|15425_15809_-	hypothetical protein	NA	S4TQ39	Salmonella_phage	61.7	2.4e-37
WP_048615676.1|16968_17220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025378514.1|17233_17674_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	55.6	3.7e-34
WP_042546153.1|17714_17912_-	helix-turn-helix domain-containing protein	NA	H9C161	Pectobacterium_phage	47.5	1.6e-08
WP_048615678.1|17994_18387_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	54.5	8.5e-30
WP_025378516.1|18559_18778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100273932.1|18799_18973_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_048615680.1|18986_19319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048615682.1|19507_19822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048615684.1|19835_21989_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.9	2.1e-101
WP_025378520.1|21985_22498_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	46.5	3.3e-34
WP_025378521.1|22570_22837_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	42.9	1.1e-09
WP_048615686.1|22811_23894_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.6	6.9e-106
30891:30904	attR	TTATTTGAGCGGAT	NA	NA	NA	NA
>prophage 3
NZ_CP011975	Yersinia aleksiciae strain 159 chromosome, complete genome	4000307	83298	118694	4000307	head,plate,integrase,lysis,portal,tail,capsid,holin	Salmonella_phage(51.61%)	47	83061:83120	118813:118936
83061:83120	attL	CACAAAAAAACCGCCTCACGGCGGCTAACGACATACTCATACTACTTTGTTTTACTTAGA	NA	NA	NA	NA
WP_048615808.1|83298_84306_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	53.9	1.7e-98
WP_048615810.1|84305_84686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048615812.1|84755_85400_-	membrane protein	NA	NA	NA	NA	NA
WP_048615815.1|85413_85806_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_048615816.1|85884_86076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048615817.1|86088_86292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048615819.1|86301_86511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048615821.1|86507_86822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048615823.1|86806_87001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048615824.1|87035_87341_+	DUF5347 family protein	NA	NA	NA	NA	NA
WP_048615826.1|87422_87620_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_048615828.1|87626_88445_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	E5G6L8	Salmonella_phage	53.0	7.1e-71
WP_048615829.1|88441_89506_+	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	56.7	5.8e-105
WP_048615830.1|89502_92058_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	37.2	3.8e-126
WP_048615831.1|92038_92269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048615832.1|92265_92610_+	hypothetical protein	NA	H9C172	Pectobacterium_phage	43.5	9.1e-20
WP_048615834.1|92791_94471_-	ATP-dependent helicase	NA	A0A1V0SG90	Hokovirus	22.8	7.7e-11
WP_048615836.1|94467_96504_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_144413882.1|97218_97833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048615840.1|97929_98967_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	64.5	1.2e-131
WP_048615842.1|98966_100730_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	63.2	4.4e-227
WP_048615843.1|100900_101716_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	71.1	7.3e-76
WP_048615844.1|101752_102808_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	62.8	1.8e-122
WP_048615845.1|102814_103471_+	hypothetical protein	NA	F1BUQ7	Erwinia_phage	47.4	5.1e-43
WP_048615846.1|103568_104051_+|head	head completion/stabilization protein	head	A0A1S5NNA6	Burkholderia_phage	48.4	2.3e-32
WP_048615852.1|104050_104254_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	68.7	1.2e-22
WP_071840454.1|104291_104678_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_048615854.1|104664_105060_+	M15 family metallopeptidase	NA	A9DET4	Yersinia_phage	70.2	3.8e-46
WP_048615859.1|105063_105489_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	46.1	1.6e-21
WP_048615860.1|105587_106055_+|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	55.3	8.8e-42
WP_048615862.1|106051_106504_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	49.7	2.5e-33
WP_048615864.1|106505_106796_-	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	40.8	6.3e-06
WP_048615866.1|106776_107049_-	BrnT family toxin	NA	NA	NA	NA	NA
WP_048615868.1|107185_107821_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	60.1	6.6e-64
WP_048615870.1|107817_108174_+	GPW/gp25 family protein	NA	F1BUP4	Erwinia_phage	60.0	2.0e-33
WP_048615872.1|108173_109082_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	68.9	5.8e-114
WP_048615874.1|109074_109683_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	72.4	9.3e-84
WP_053082167.1|109679_110870_+|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	42.6	1.1e-96
WP_048615875.1|110866_111484_+	hypothetical protein	NA	F1BUP0	Erwinia_phage	51.7	2.1e-22
WP_048615876.1|111603_112779_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	77.0	2.7e-172
WP_048615877.1|112790_113306_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	67.4	5.5e-61
WP_048615879.1|113465_113777_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	53.6	4.5e-18
WP_004705491.1|113791_113911_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_048615881.1|113903_116828_+|tail	phage tail tape measure protein	tail	Q9ZXK0	Pseudomonas_virus	54.1	4.3e-158
WP_048615882.1|116839_117304_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	63.1	4.2e-44
WP_048615884.1|117300_118404_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	64.8	8.3e-123
WP_048615886.1|118478_118694_+	ogr/Delta-like zinc finger family protein	NA	S4TNZ3	Salmonella_phage	59.2	5.3e-18
118813:118936	attR	CACAAAAAAACCGCCTCACGGCGGCTAACGACATACTCATACTACTTTGTTTTACTTAGAATATTTTCCATGGTGCCCGGGGCGGGACTTGAACCCGCACAGCCATAAGCCGAGGGATTTTAAA	NA	NA	NA	NA
>prophage 4
NZ_CP011975	Yersinia aleksiciae strain 159 chromosome, complete genome	4000307	215092	226976	4000307		Paramecium_bursaria_Chlorella_virus(16.67%)	7	NA	NA
WP_048616058.1|215092_217792_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	26.0	2.5e-43
WP_048616060.1|218015_218714_-	MgtC family protein	NA	G3MA03	Bacillus_virus	41.0	1.1e-14
WP_048616061.1|219565_221305_+	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.9	1.4e-07
WP_071840455.1|221424_221664_-	protein DsrB	NA	NA	NA	NA	NA
WP_002210893.1|221962_222175_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	80.0	2.0e-25
WP_048616067.1|222655_223681_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	54.6	2.6e-86
WP_048616069.1|223829_226976_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	62.1	0.0e+00
>prophage 5
NZ_CP011975	Yersinia aleksiciae strain 159 chromosome, complete genome	4000307	1115764	1182330	4000307	plate,protease,tRNA,transposase	Paramecium_bursaria_Chlorella_virus(33.33%)	52	NA	NA
WP_048617451.1|1115764_1116277_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_048617453.1|1116375_1117083_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_048617455.1|1117262_1117994_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_048617457.1|1118019_1118973_+	glutathione synthase	NA	NA	NA	NA	NA
WP_048620194.1|1119721_1120285_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_005157116.1|1120284_1120707_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_048617460.1|1120890_1121775_+	N-carbamoylputrescine amidase	NA	A7IVZ1	Paramecium_bursaria_Chlorella_virus	50.7	4.1e-80
WP_048617461.1|1121778_1122903_+	agmatine deiminase	NA	A7RCL2	Paramecium_bursaria_Chlorella_virus	49.2	5.2e-96
WP_048617463.1|1122976_1124101_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_048617465.1|1124120_1124816_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_048617467.1|1125007_1125829_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_048617469.1|1125932_1126487_+	YggT family protein	NA	NA	NA	NA	NA
WP_162489028.1|1126471_1126774_+	YggU family protein	NA	NA	NA	NA	NA
WP_048617473.1|1126838_1127432_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_048617475.1|1127424_1128555_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_048617478.1|1128570_1129722_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.2	5.8e-42
WP_048617480.1|1129851_1137948_-	VCBS repeat-containing protein	NA	NA	NA	NA	NA
WP_048617482.1|1138209_1138947_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_162489029.1|1138966_1139914_-	glutaminase B	NA	NA	NA	NA	NA
WP_032815284.1|1140019_1140346_-	YggL family protein	NA	NA	NA	NA	NA
WP_048620195.1|1140345_1141065_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_048617486.1|1141388_1142501_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_004876892.1|1142564_1142837_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_048617488.1|1143019_1144096_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_048617490.1|1144293_1146456_-	ornithine decarboxylase SpeF	NA	NA	NA	NA	NA
WP_048617492.1|1147673_1149071_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_048617494.1|1149094_1149538_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_048617496.1|1149539_1150082_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_048617498.1|1150056_1151163_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_048617500.1|1151117_1152881_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_048617502.1|1152912_1154499_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_048617503.1|1154498_1157900_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_048617505.1|1157883_1159059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048617507.1|1159062_1159329_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_074007675.1|1159483_1159957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082146896.1|1160244_1162161_-	lipase family protein	NA	G9E505	Ostreococcus_lucimarinus_virus	25.3	2.4e-08
WP_048617512.1|1162466_1163072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048617514.1|1163072_1165796_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_048620197.1|1165862_1166204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048617516.1|1166323_1166866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156312877.1|1166858_1167011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048617518.1|1168172_1168439_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_048617520.1|1168814_1169036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048617522.1|1169094_1169748_-	DUF2931 family protein	NA	NA	NA	NA	NA
WP_048617524.1|1169744_1171328_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_048617526.1|1171324_1173853_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	42.0	5.9e-07
WP_048617528.1|1174386_1175025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048617530.1|1175030_1177679_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	32.0	3.3e-85
WP_004877984.1|1178119_1178611_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_048617533.1|1178614_1180339_-	OmpA family protein	NA	NA	NA	NA	NA
WP_071840475.1|1180342_1180996_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_048617535.1|1180992_1182330_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 6
NZ_CP011975	Yersinia aleksiciae strain 159 chromosome, complete genome	4000307	1459208	1527967	4000307	head,protease,tRNA,integrase,terminase,portal,tail,capsid	uncultured_Caudovirales_phage(66.67%)	65	1461323:1461337	1534626:1534640
WP_048617945.1|1459208_1459943_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_048617947.1|1460546_1462208_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
1461323:1461337	attL	CCGGTGGCATTAGCG	NA	NA	NA	NA
WP_048617949.1|1462290_1463706_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_048617951.1|1464036_1464984_-	HTH-type transcriptional regulator TreR	NA	NA	NA	NA	NA
WP_048617953.1|1465476_1468209_+	magnesium-translocating P-type ATPase	NA	M1HN09	Paramecium_bursaria_Chlorella_virus	26.5	4.9e-39
WP_048620222.1|1468729_1470628_-	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_048617955.1|1470744_1471968_-	lactonase family protein	NA	NA	NA	NA	NA
WP_048617957.1|1472004_1472745_-	KDGP aldolase family protein	NA	NA	NA	NA	NA
WP_048617959.1|1472748_1473861_-	DgaE family pyridoxal phosphate-dependent ammonia lyase	NA	NA	NA	NA	NA
WP_048617961.1|1473844_1475014_-	amidohydrolase/deacetylase family metallohydrolase	NA	NA	NA	NA	NA
WP_032896643.1|1475096_1475747_-	DUF4310 family protein	NA	NA	NA	NA	NA
WP_004701420.1|1475768_1476545_-	DUF4311 domain-containing protein	NA	NA	NA	NA	NA
WP_048617965.1|1476630_1476927_-	DUF4312 family protein	NA	NA	NA	NA	NA
WP_004392359.1|1476926_1477292_-	glycine-rich SFCGS family protein	NA	NA	NA	NA	NA
WP_048617967.1|1477315_1477660_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_032815605.1|1478054_1478465_+	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_048617969.1|1478555_1478942_-	cytochrome b562	NA	NA	NA	NA	NA
WP_048617970.1|1479167_1480508_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_048617971.1|1480676_1481225_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_048617973.1|1481367_1481634_-	barstar family protein	NA	NA	NA	NA	NA
WP_048617975.1|1481638_1482112_-	ribonuclease	NA	NA	NA	NA	NA
WP_048620223.1|1482210_1483680_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_048617977.1|1483799_1485755_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_048617979.1|1485756_1486692_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_048617981.1|1486699_1486903_-	AaeX family protein	NA	NA	NA	NA	NA
WP_048617983.1|1487249_1488161_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_048617985.1|1488542_1489988_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_048617987.1|1490000_1490855_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_048617989.1|1490851_1494709_-	AsmA2 domain-containing protein YhdP	NA	NA	NA	NA	NA
WP_048617993.1|1494786_1496256_-	ribonuclease G	NA	NA	NA	NA	NA
WP_048617995.1|1496245_1496839_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_048617997.1|1496852_1497341_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_048617999.1|1497337_1498321_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_004875762.1|1498431_1499475_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.0e-06
WP_048618001.1|1499808_1501728_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_048618003.1|1502007_1502985_+	oxidoreductase	NA	NA	NA	NA	NA
WP_048618005.1|1503194_1504256_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_048618007.1|1504255_1504855_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_048618009.1|1505074_1505527_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_048618011.1|1505684_1506149_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_005271359.1|1506160_1507510_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_048618015.1|1507846_1508089_+	YhdT family protein	NA	NA	NA	NA	NA
WP_048618016.1|1508078_1509533_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_048618018.1|1509625_1510510_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_050125812.1|1510927_1511893_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_002210061.1|1511917_1512214_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_048618020.1|1512661_1514389_+	AIPR family protein	NA	D0UIM0	Aggregatibacter_phage	32.4	5.5e-73
WP_048618022.1|1514491_1516153_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	80.8	1.0e-273
WP_048618025.1|1516139_1516493_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	73.5	2.5e-44
WP_048618027.1|1516781_1517225_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	59.9	3.3e-46
WP_048618028.1|1517224_1517527_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	68.4	4.1e-32
WP_144413896.1|1517523_1518726_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	73.2	7.8e-175
WP_048618033.1|1518727_1519285_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	73.7	8.3e-71
WP_048618035.1|1519327_1520500_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	72.5	2.5e-157
WP_048618036.1|1520706_1521060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048618038.1|1521186_1521441_-	pyocin activator PrtN family protein	NA	A0A1W6JP35	Morganella_phage	57.7	3.7e-18
WP_048618040.1|1521728_1523456_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	49.2	2.9e-122
WP_048618042.1|1523452_1523791_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	53.0	3.9e-23
WP_048618044.1|1523787_1524090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048618046.1|1524082_1524403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048618048.1|1524395_1524599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158506228.1|1524591_1525431_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_050163129.1|1525528_1525762_-	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	67.9	2.6e-18
WP_048618054.1|1525877_1526747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048618056.1|1526743_1527967_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	69.3	2.2e-177
1534626:1534640	attR	CCGGTGGCATTAGCG	NA	NA	NA	NA
>prophage 7
NZ_CP011975	Yersinia aleksiciae strain 159 chromosome, complete genome	4000307	3279168	3319256	4000307	head,protease,integrase,lysis,terminase,portal,capsid	Enterobacteria_phage(20.45%)	63	3279079:3279103	3319442:3319466
3279079:3279103	attL	GCGCTTTACCTTGCAAAGGTTCCCC	NA	NA	NA	NA
WP_048619579.1|3279168_3280245_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	K7PHK0	Enterobacteria_phage	49.3	2.6e-97
WP_071840509.1|3280210_3280453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048619580.1|3280449_3280680_-	hypothetical protein	NA	A0A2H4J398	uncultured_Caudovirales_phage	56.9	1.2e-15
WP_144413919.1|3280664_3280907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048619583.1|3281016_3281559_-	phage N-6-adenine-methyltransferase	NA	G9L688	Escherichia_phage	67.7	8.4e-60
WP_048619584.1|3281555_3282266_-	hypothetical protein	NA	A0A2I7R4M7	Vibrio_phage	60.8	6.8e-78
WP_048619585.1|3282262_3282466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164971240.1|3282465_3282642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048619587.1|3282870_3283185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048619589.1|3283326_3284031_-	hypothetical protein	NA	A0A0U4KRZ0	Arthrobacter_phage	62.5	4.5e-05
WP_048619590.1|3284030_3284480_-	hypothetical protein	NA	Q9MCR3	Enterobacteria_phage	36.8	2.0e-11
WP_082146927.1|3284537_3285053_-	3'-5' exoribonuclease	NA	A0A1P8DTS7	Salmonella_phage	60.4	2.1e-52
WP_048619591.1|3285075_3285462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048619592.1|3285487_3285958_-	phage protein	NA	A0A2I6PID1	Escherichia_phage	64.8	4.3e-36
WP_048619593.1|3285957_3286659_-	recombinase	NA	A0A192Y617	Salmonella_phage	56.3	4.7e-71
WP_155411013.1|3286645_3286813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048619594.1|3286809_3286989_-	DUF5444 family protein	NA	NA	NA	NA	NA
WP_144413920.1|3286985_3287117_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	NA	NA	NA	NA
WP_048619595.1|3287181_3287400_-	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	44.9	2.4e-05
WP_048619596.1|3287466_3287808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048619597.1|3287967_3288222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048619598.1|3288342_3288699_-	hypothetical protein	NA	I6S652	Salmonella_phage	42.6	6.0e-06
WP_156312869.1|3288763_3288928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144413922.1|3289195_3289606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048619600.1|3289790_3290087_-	hypothetical protein	NA	A0A2H4FNC7	Salmonella_phage	47.1	1.0e-11
WP_048619601.1|3290150_3290783_-	hypothetical protein	NA	K7PGR7	Enterobacteria_phage	75.7	1.0e-61
WP_048619602.1|3290875_3291106_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_048619603.1|3291227_3291518_+	hypothetical protein	NA	I6RSP4	Salmonella_phage	59.4	6.3e-22
WP_048619604.1|3291684_3292587_+	replication protein	NA	C6ZR51	Salmonella_phage	48.7	1.1e-37
WP_048619605.1|3292586_3293924_+	AAA family ATPase	NA	A0A2I7REC3	Vibrio_phage	38.1	9.5e-81
WP_147653259.1|3293936_3294257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156312870.1|3294468_3294630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156312871.1|3294629_3294800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053082182.1|3294809_3295277_+	DUF551 domain-containing protein	NA	K9L5K9	Pectobacterium_phage	53.6	1.1e-07
WP_048619608.1|3295273_3295492_+	hypothetical protein	NA	C0LP33	Escherichia_virus	50.0	6.2e-06
WP_048619609.1|3295484_3295931_+	recombination protein NinB	NA	A0A2H4J8D9	uncultured_Caudovirales_phage	61.1	1.1e-46
WP_048619610.1|3295927_3296317_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	76.9	1.6e-52
WP_071840510.1|3296291_3296654_+	DUF2591 domain-containing protein	NA	A0A2I7RFQ2	Vibrio_phage	41.3	1.0e-13
WP_048619611.1|3296925_3297519_+	recombination protein NinG	NA	A0A2R2Z332	Escherichia_phage	44.1	5.2e-39
WP_048619612.1|3297515_3297707_+	protein ninH	NA	A0A0P0ZGE1	Escherichia_phage	57.4	1.1e-09
WP_048619613.1|3297703_3298192_+	antiterminator	NA	M1FPN0	Enterobacteria_phage	67.9	2.7e-57
WP_048620322.1|3298479_3298761_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	50.0	4.1e-18
WP_048619614.1|3298760_3299273_+	lysozyme	NA	I6PBN2	Cronobacter_phage	59.2	2.4e-48
WP_048619615.1|3299257_3299716_+|lysis	lysis protein	lysis	A5LH84	Enterobacteria_phage	43.1	2.6e-22
WP_156312873.1|3299732_3299891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048619616.1|3300139_3300553_+	phage family protein	NA	K7PH35	Enterobacteria_phage	64.8	2.9e-36
WP_048619617.1|3300613_3300847_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	49.3	1.7e-09
WP_048619618.1|3300855_3301188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048619619.1|3301195_3301657_+	hypothetical protein	NA	C7U0W1	Enterobacteria_phage	81.2	2.1e-64
WP_048619620.1|3301653_3303069_+|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	87.3	4.8e-248
WP_048619621.1|3303071_3305300_+|portal	portal protein	portal	Q716H2	Shigella_phage	77.3	3.6e-298
WP_048619622.1|3305310_3306198_+|capsid	phage capsid scaffolding protein	capsid	B6SD23	Bacteriophage	58.5	5.9e-79
WP_048619623.1|3306209_3307484_+|head	head protein	head	Q716H0	Shigella_phage	86.7	7.2e-211
WP_048619624.1|3307527_3307710_+	hypothetical protein	NA	Q716G9	Shigella_phage	56.7	3.5e-10
WP_048619625.1|3307690_3308179_+	packaged DNA stabilization protein p27	NA	Q2A0B6	Sodalis_phage	61.7	8.9e-53
WP_048619626.1|3308150_3309566_+	Packaged DNA stabilization protein gp10	NA	Q9AYZ4	Salmonella_phage	71.4	3.4e-201
WP_071840511.1|3309565_3310309_+	hypothetical protein	NA	A0A2D1GLK3	Escherichia_phage	44.2	6.5e-39
WP_048619628.1|3310324_3310786_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	68.5	3.3e-57
WP_048619629.1|3310779_3311457_+	hypothetical protein	NA	G5DA80	Enterobacteria_phage	68.7	5.2e-59
WP_048619630.1|3311456_3312899_+	phage DNA ejection protein	NA	Q76H14	Enterobacteria_phage	54.7	1.7e-123
WP_048619631.1|3312898_3314830_+	hypothetical protein	NA	Q716G2	Shigella_phage	57.4	5.8e-196
WP_158506223.1|3315104_3317165_+	right-handed parallel beta-helix repeat-containing protein	NA	A0A2D1GLP5	Escherichia_phage	29.0	3.3e-40
WP_048619633.1|3317288_3319256_+	acyltransferase	NA	B5WZU0	Pseudomonas_phage	31.6	6.3e-65
3319442:3319466	attR	GCGCTTTACCTTGCAAAGGTTCCCC	NA	NA	NA	NA
>prophage 8
NZ_CP011975	Yersinia aleksiciae strain 159 chromosome, complete genome	4000307	3500200	3537508	4000307	tail,protease	Pseudomonas_phage(28.57%)	29	NA	NA
WP_048619761.1|3500200_3500707_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_048619762.1|3500998_3501256_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	53.0	2.6e-19
WP_048619763.1|3501259_3502390_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	9.0e-173
WP_048619764.1|3502569_3504855_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	5.5e-286
WP_048619765.1|3505352_3506081_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_048619766.1|3506249_3508907_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	A0A172JHV7	Bacillus_phage	31.5	1.6e-103
WP_048619767.1|3509078_3511949_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	28.3	2.6e-43
WP_004875319.1|3512120_3512777_-	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_048619768.1|3512779_3515473_-	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_048619769.1|3515495_3516668_-	MFS transporter	NA	NA	NA	NA	NA
WP_048619770.1|3517359_3517767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048619772.1|3518631_3519750_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.0	2.0e-116
WP_048619773.1|3520244_3521387_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	NA	NA	NA	NA
WP_048619774.1|3521610_3523137_-	MFS transporter	NA	NA	NA	NA	NA
WP_048619775.1|3523549_3524539_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_048619776.1|3524594_3526382_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	51.2	1.4e-10
WP_048619777.1|3526712_3527654_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_048619778.1|3527828_3528071_-	DinI family protein	NA	K7PKR6	Enterobacteria_phage	67.5	4.3e-24
WP_048619779.1|3528320_3529043_-	LexA family transcriptional regulator	NA	F1C599	Cronobacter_phage	50.2	2.0e-61
WP_048619780.1|3529316_3529796_+	DUF1133 family protein	NA	S5M7R9	Escherichia_phage	62.5	3.6e-38
WP_048619781.1|3530101_3530362_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	52.2	8.2e-13
WP_048619782.1|3530411_3530942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048619783.1|3530946_3531141_+	DUF2635 domain-containing protein	NA	B5TK66	Pseudomonas_phage	55.1	5.9e-08
WP_048619784.1|3531137_3532646_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B5TK67	Pseudomonas_phage	44.2	5.7e-106
WP_048619785.1|3532787_3533156_+|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_048619786.1|3533157_3533457_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_048619787.1|3533577_3534924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048619788.1|3535034_3536441_+	DNA circularization protein	NA	NA	NA	NA	NA
WP_048620330.1|3536452_3537508_+|tail	tail protein	tail	M1PVV2	Vibrio_phage	30.4	1.4e-39
>prophage 9
NZ_CP011975	Yersinia aleksiciae strain 159 chromosome, complete genome	4000307	3826548	3859924	4000307	head,protease,plate,lysis,integrase,portal,tail,capsid,holin	Salmonella_phage(53.57%)	42	3839552:3839565	3858512:3858525
WP_048619986.1|3826548_3826788_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	50.0	1.0e-09
WP_048619987.1|3826829_3827960_-	phage late control D family protein	NA	A0A0M4REC6	Salmonella_phage	66.2	2.5e-130
WP_048619988.1|3828100_3829279_+|tail	phage tail sheath protein	tail	A0A0M4S6M1	Salmonella_phage	68.0	1.6e-156
WP_048619989.1|3829290_3829806_+|tail	phage major tail tube protein	tail	A0A0M5M1I5	Salmonella_phage	72.5	2.3e-67
WP_048619990.1|3829821_3830145_+|tail	phage tail assembly protein	tail	A0A0M4RCV2	Salmonella_phage	61.7	5.7e-24
WP_071840548.1|3830141_3830273_+|tail	GpE family phage tail protein	tail	E5E3Q0	Burkholderia_phage	51.2	5.3e-05
WP_048619991.1|3830276_3833486_+|tail	phage tail tape measure protein	tail	A0A0M4R2V3	Salmonella_phage	38.5	1.6e-158
WP_048619992.1|3833488_3833914_+|tail	phage tail protein	tail	A0A1J0I2L5	Salmonella_phage	60.9	4.3e-43
WP_048619993.1|3833985_3834465_-|tail	phage tail protein	tail	F1BUP0	Erwinia_phage	50.6	5.5e-39
WP_054888092.1|3834466_3835762_-|tail	phage tail protein	tail	F1BUP1	Erwinia_phage	55.5	1.0e-116
WP_048619994.1|3835758_3836367_-|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	72.6	9.0e-87
WP_048619995.1|3836359_3837268_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	76.5	1.4e-120
WP_048619996.1|3837264_3837615_-	GPW/gp25 family protein	NA	F1BUP4	Erwinia_phage	53.6	5.1e-26
WP_048619997.1|3837611_3838250_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	51.9	1.3e-51
WP_048619998.1|3838364_3838952_-	putative adenosine monophosphate-protein transferase Fic	NA	NA	NA	NA	NA
WP_042661620.1|3838948_3839137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048619999.1|3839230_3839848_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	36.7	1.2e-30
3839552:3839565	attL	GATCGCGTTACGGT	NA	NA	NA	NA
WP_048620000.1|3839900_3840362_-|tail	phage tail protein	tail	A0A0M4R2U5	Salmonella_phage	53.0	1.1e-36
WP_048620001.1|3840460_3840886_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	43.5	3.4e-16
WP_048620002.1|3840890_3841286_-	M15 family metallopeptidase	NA	A9DET4	Yersinia_phage	70.8	1.5e-45
WP_071840517.1|3841272_3841659_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_048620003.1|3841695_3841899_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	68.7	2.8e-21
WP_048620004.1|3841899_3842382_-|head	head completion/stabilization protein	head	A0A1S5NNA6	Burkholderia_phage	51.6	1.7e-35
WP_048620005.1|3843420_3844461_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	58.8	1.3e-114
WP_048620006.1|3844493_3845348_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1J0I2E9	Salmonella_phage	47.9	2.7e-65
WP_048620007.1|3845505_3847224_+	oxidoreductase	NA	A0A0M4S6K7	Salmonella_phage	59.8	1.2e-192
WP_048620349.1|3847232_3848258_+|portal	phage portal protein	portal	A0A0M5M1H6	Salmonella_phage	64.3	2.7e-128
WP_048620008.1|3848728_3850084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144413930.1|3850114_3850453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048620010.1|3850436_3851210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048620011.1|3853687_3854497_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L011	Salmonella_phage	53.1	5.2e-74
WP_048620012.1|3854493_3854718_-	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	58.1	9.5e-18
WP_048620013.1|3854717_3854945_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_048620014.1|3855018_3855348_-	DUF5347 family protein	NA	NA	NA	NA	NA
WP_048620015.1|3855372_3855597_-	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_048620350.1|3855593_3855806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048620016.1|3855841_3856108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048620017.1|3856196_3856496_+	helix-turn-helix transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	53.7	2.6e-23
WP_048620018.1|3856559_3857540_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	49.2	2.0e-88
WP_048620019.1|3857672_3858452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048620020.1|3858441_3858837_+	hypothetical protein	NA	NA	NA	NA	NA
3858512:3858525	attR	ACCGTAACGCGATC	NA	NA	NA	NA
WP_050125988.1|3859012_3859924_-|protease	aspartyl protease family protein	protease	NA	NA	NA	NA
