The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012040	Cyclobacterium amurskyense strain KCTC 12363 chromosome, complete genome	6158829	4228498	4315610	6158829	integrase,protease,transposase	Leptospira_phage(28.57%)	70	4243224:4243256	4289679:4289711
WP_157470520.1|4228498_4229422_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048643034.1|4229819_4230059_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	44.2	2.0e-10
WP_084011855.1|4230110_4230758_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	29.4	1.6e-09
WP_157470524.1|4231074_4231632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048643037.1|4232133_4233498_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	41.0	1.7e-80
WP_048643038.1|4233544_4234294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048643039.1|4234464_4235001_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_048643040.1|4235075_4235621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048643041.1|4235610_4236039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048643042.1|4236706_4237957_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.0	1.7e-26
WP_157470526.1|4238228_4238501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048640356.1|4238876_4240397_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	31.4	5.8e-58
WP_014019612.1|4240472_4240820_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_048643043.1|4240823_4241126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048643044.1|4241388_4241670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048643045.1|4241991_4242462_+	winged helix DNA-binding protein	NA	NA	NA	NA	NA
WP_048643047.1|4242663_4243143_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
4243224:4243256	attL	TCCCTTCGGCAGGCTCAGGGACCGTGCTCAGGG	NA	NA	NA	NA
WP_048643048.1|4243574_4244354_-	phytanoyl-CoA dioxygenase	NA	NA	NA	NA	NA
WP_048643049.1|4246311_4246566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048643050.1|4246930_4247263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048643051.1|4247622_4248072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084011857.1|4248560_4249700_+	PKD domain-containing protein	NA	NA	NA	NA	NA
WP_048643054.1|4250148_4251180_+	serine hydrolase	NA	NA	NA	NA	NA
WP_157470528.1|4251503_4251947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169786497.1|4251984_4253592_-	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
WP_048643057.1|4253611_4257139_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_048643058.1|4257277_4257985_-	DUF4974 domain-containing protein	NA	NA	NA	NA	NA
WP_048643059.1|4258635_4259415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048643060.1|4259448_4262664_-	CHAT domain-containing protein	NA	NA	NA	NA	NA
WP_048643061.1|4262660_4263383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048643062.1|4263375_4263945_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_048643063.1|4264035_4266228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048643064.1|4266448_4267660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048643066.1|4269198_4270008_+|integrase	site-specific integrase	integrase	S5W9T9	Leptospira_phage	35.3	3.3e-36
WP_048643067.1|4270007_4271183_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_048643068.1|4271514_4273569_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_048643069.1|4273573_4274575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048642126.1|4274894_4275167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157470529.1|4275252_4276029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048643071.1|4276170_4276851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048643042.1|4277504_4278755_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.0	1.7e-26
WP_048643072.1|4278875_4279400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048643073.1|4279475_4280372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084011859.1|4280673_4281072_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048643075.1|4281111_4281384_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_084011861.1|4281339_4281642_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048643076.1|4281701_4281962_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_048643077.1|4283536_4284943_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_048643078.1|4285044_4285422_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_053086702.1|4285710_4287657_+	pyrroloquinoline quinone-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_157470531.1|4287866_4288133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048643079.1|4288154_4288448_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_048643080.1|4288507_4288738_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_048643081.1|4288982_4289582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157470532.1|4290557_4291217_+	hypothetical protein	NA	NA	NA	NA	NA
4289679:4289711	attR	TCCCTTCGGCAGGCTCAGGGACCGTGCTCAGGG	NA	NA	NA	NA
WP_048643083.1|4291538_4291997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053086703.1|4292650_4293259_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_157470533.1|4293374_4294379_+	FecR domain-containing protein	NA	NA	NA	NA	NA
WP_048643085.1|4294525_4297915_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_048643086.1|4297927_4299409_+	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
WP_048643087.1|4299608_4302020_+	sodium/solute symporter	NA	NA	NA	NA	NA
WP_048643088.1|4302025_4302808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048643089.1|4302832_4304137_+	sialidase	NA	NA	NA	NA	NA
WP_084011865.1|4304269_4305085_+	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_048643091.1|4305188_4307408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048643092.1|4307670_4308804_+	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_048643093.1|4309649_4311554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157470534.1|4312636_4313665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048643097.1|4313796_4314231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048640497.1|4314437_4315610_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
