The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012076	Bordetella hinzii strain F582 chromosome, complete genome	4912977	1864578	1916024	4912977	terminase,integrase,capsid	Pseudomonas_phage(32.56%)	69	1853221:1853238	1897420:1897437
1853221:1853238	attL	CGGCGCGGTGGCGCTGTC	NA	NA	NA	NA
WP_029580404.1|1864578_1865820_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	38.9	5.2e-65
WP_029580405.1|1865828_1866086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029580406.1|1866086_1866296_-	hypothetical protein	NA	H2BDE9	Pseudomonas_virus	41.7	4.9e-08
WP_029580407.1|1866288_1866555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029580408.1|1866726_1867521_-	hypothetical protein	NA	A0A291L9X3	Bordetella_phage	61.1	1.0e-05
WP_029580409.1|1867524_1867806_-	hypothetical protein	NA	K4JS57	Caulobacter_phage	33.3	6.3e-11
WP_144417574.1|1867808_1868057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029580411.1|1868053_1869100_-	hypothetical protein	NA	A0A2D2W2F4	Stenotrophomonas_phage	52.6	7.1e-07
WP_029580412.1|1869096_1869450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029580413.1|1869468_1871250_-	AAA family ATPase	NA	J7HXJ7	Pseudomonas_phage	36.3	6.5e-77
WP_048940607.1|1871259_1872420_-	recombination-associated protein RdgC	NA	A0A218M310	Acidovorax_phage	38.1	1.1e-53
WP_029580415.1|1872432_1873641_-	hypothetical protein	NA	J7HXB6	Pseudomonas_phage	53.8	1.4e-70
WP_029580416.1|1873644_1874445_-	PD-(D/E)XK nuclease family protein	NA	J7HXJ4	Pseudomonas_phage	48.9	3.7e-56
WP_029580417.1|1874461_1874662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029580418.1|1874658_1874949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029580419.1|1874945_1875146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048940608.1|1875142_1875643_-	hypothetical protein	NA	A0A0S3UG68	Pseudomonas_phage	47.0	1.0e-35
WP_080666597.1|1875737_1875992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029580422.1|1876249_1876564_-	TM2 domain-containing protein	NA	NA	NA	NA	NA
WP_029580423.1|1876688_1877132_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_142098760.1|1877626_1877821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029580424.1|1877879_1878479_+	hypothetical protein	NA	A0A0S2SYA8	Pseudomonas_phage	50.0	5.1e-42
WP_029580425.1|1878475_1880404_+	DNA cytosine methyltransferase	NA	Q9ZXI4	Pseudomonas_virus	50.6	1.4e-154
WP_029580426.1|1880433_1880685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029580427.1|1880765_1881374_+	hypothetical protein	NA	A0A218M303	Acidovorax_phage	39.2	8.0e-35
WP_142098757.1|1881383_1881569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029580428.1|1881641_1882787_+	DUF1376 domain-containing protein	NA	H2BD69	Pseudomonas_phage	58.2	7.7e-39
WP_029580429.1|1882783_1883008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029580430.1|1883004_1883499_+	RusA family crossover junction endodeoxyribonuclease	NA	A9YWY9	Burkholderia_phage	52.7	8.2e-30
WP_029580431.1|1883491_1884118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144417575.1|1884167_1884755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029580433.1|1884913_1885705_+	DNA adenine methylase	NA	Q5ZQW7	Pseudomonas_phage	79.0	2.0e-126
WP_029580434.1|1885714_1886323_+	hypothetical protein	NA	A0A1B0VRJ1	Pseudomonas_phage	66.5	1.0e-66
WP_029580435.1|1886319_1886916_-	DUF4145 domain-containing protein	NA	M1PSB6	Streptococcus_phage	38.4	5.8e-30
WP_029580436.1|1887032_1887509_+	DUF2280 domain-containing protein	NA	A0A125RNL6	Pseudomonas_phage	59.9	2.2e-35
WP_080666586.1|1887540_1889043_+|terminase	phage terminase large subunit	terminase	B5AX37	Iodobacteriophage	45.7	1.5e-111
WP_032959803.1|1889042_1890323_+	DUF1073 domain-containing protein	NA	A0A2H4N7B7	Pectobacterium_phage	24.5	1.2e-16
WP_032959802.1|1890264_1891104_+|capsid	minor capsid protein	capsid	I3PGT9	Xanthomonas_phage	38.2	7.7e-36
WP_029580440.1|1891113_1892196_+	DUF2213 domain-containing protein	NA	E5AGA6	Erwinia_phage	41.0	5.6e-55
WP_029580441.1|1892195_1892651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029580442.1|1892712_1893672_+	DUF2184 domain-containing protein	NA	A0A0N9SG07	Pseudomonas_phage	39.2	4.3e-59
WP_029580443.1|1893671_1894052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029580444.1|1894054_1894429_+	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_029580445.1|1894418_1894871_+	hypothetical protein	NA	A0A2K9V3I1	Faecalibacterium_phage	34.4	7.1e-12
WP_029580446.1|1894874_1895243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029580447.1|1895416_1895941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029580448.1|1896004_1897363_+	DUF3383 family protein	NA	A0A0N9SJA3	Pseudomonas_phage	40.9	3.0e-82
WP_029580449.1|1897375_1897804_+	DUF3277 family protein	NA	A0A2K9V3K6	Faecalibacterium_phage	40.9	4.2e-22
1897420:1897437	attR	CGGCGCGGTGGCGCTGTC	NA	NA	NA	NA
WP_029580450.1|1897803_1898289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029580451.1|1898437_1900879_+	tape measure protein	NA	A0A0R6PD92	Moraxella_phage	21.1	8.0e-17
WP_029580452.1|1900888_1901458_+	hypothetical protein	NA	I3PGV3	Xanthomonas_phage	26.6	3.3e-06
WP_029580453.1|1901454_1901787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029580454.1|1901773_1902694_+	hypothetical protein	NA	E5AGC0	Erwinia_phage	33.9	3.3e-40
WP_029580455.1|1902690_1903389_+	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	33.2	1.1e-14
WP_029580456.1|1903388_1903757_+	hypothetical protein	NA	E5AGC2	Erwinia_phage	40.9	3.0e-13
WP_029580457.1|1903781_1905233_+	hypothetical protein	NA	A0A0N9SH53	Pseudomonas_phage	36.2	4.1e-77
WP_029580458.1|1905232_1905898_+	DUF2612 domain-containing protein	NA	A0A0N9SSD8	Pseudomonas_phage	34.6	6.5e-30
WP_029580459.1|1905897_1907883_+	hypothetical protein	NA	G9BWE7	Planktothrix_phage	47.8	2.4e-11
WP_029580460.1|1907910_1908510_+	hypothetical protein	NA	A0A291LAV4	Bordetella_phage	35.1	1.2e-06
WP_029580461.1|1908609_1909050_+	hypothetical protein	NA	A0A0U5LBV3	unidentified_phage	34.8	9.6e-14
WP_029580462.1|1909055_1909547_+	hypothetical protein	NA	I6NSS1	Burkholderia_phage	59.9	2.0e-44
WP_080666598.1|1909573_1910080_+	DUF2514 family protein	NA	Q3HQV1	Burkholderia_phage	42.2	2.5e-10
WP_144417576.1|1910055_1910553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029580464.1|1910552_1910969_-	antitoxin	NA	A0A0R6PH90	Moraxella_phage	57.5	4.6e-34
WP_080666588.1|1911027_1911204_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0R6PGU2	Moraxella_phage	60.0	1.3e-09
WP_029580465.1|1911592_1912285_-	SOS response-associated peptidase family protein	NA	A4JX27	Burkholderia_virus	34.7	1.8e-14
WP_144417577.1|1912598_1913555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029580467.1|1913741_1914230_-	membrane protein	NA	NA	NA	NA	NA
WP_029580468.1|1914368_1916024_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	48.9	5.7e-35
>prophage 2
NZ_CP012076	Bordetella hinzii strain F582 chromosome, complete genome	4912977	1967226	1974976	4912977	protease	Lake_Baikal_phage(16.67%)	7	NA	NA
WP_029580519.1|1967226_1967433_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.1	7.4e-17
WP_029580520.1|1967486_1968026_-	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	33.7	1.1e-22
WP_029580521.1|1968231_1969542_+	trigger factor	NA	NA	NA	NA	NA
WP_029580522.1|1969544_1970198_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.4	1.5e-55
WP_029580523.1|1970302_1971601_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	8.3e-130
WP_029580524.1|1971766_1974196_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	2.0e-222
WP_029580525.1|1974322_1974976_-	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
>prophage 3
NZ_CP012076	Bordetella hinzii strain F582 chromosome, complete genome	4912977	3221092	3253367	4912977	integrase,protease,portal,tail,head,capsid,terminase	Acidithiobacillus_phage(30.77%)	40	3221041:3221062	3232195:3232216
3221041:3221062	attL	GTGCGGGTAGTTTTACGGGTAG	NA	NA	NA	NA
WP_029577241.1|3221092_3222304_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	56.2	1.1e-120
WP_144417582.1|3222385_3222760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029577239.1|3222857_3223880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029577238.1|3223986_3224193_+	AlpA family transcriptional regulator	NA	B7SYF9	Stenotrophomonas_phage	50.0	3.9e-10
WP_032959784.1|3224206_3224632_+	DNA primase	NA	A0A2H5BLM3	Streptomyces_phage	50.0	6.4e-07
WP_029577236.1|3224621_3225773_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_029577235.1|3226031_3227240_+|capsid	phage major capsid protein	capsid	G8EXZ9	Synechococcus_phage	32.6	5.0e-36
WP_029577234.1|3227255_3227801_+|head,protease	HK97 family phage prohead protease	head,protease	B4UTP2	Rhizobium_phage	49.0	5.0e-28
WP_029577233.1|3227794_3229009_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	39.8	4.0e-70
WP_144417589.1|3229041_3229443_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_029577231.1|3229493_3229952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029577230.1|3229948_3231445_+|terminase	terminase	terminase	K7PLY2	Enterobacterial_phage	62.7	1.6e-177
WP_029577229.1|3231583_3231919_+|head	phage head closure protein	head	A0A1J0GUY4	Halomonas_phage	39.1	1.4e-12
WP_029577228.1|3231915_3232194_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B5WZS4	Pseudomonas_phage	33.3	8.8e-05
WP_029577227.1|3232642_3232921_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
3232195:3232216	attR	GTGCGGGTAGTTTTACGGGTAG	NA	NA	NA	NA
WP_029577226.1|3232917_3233421_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_029577225.1|3233436_3233868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029577224.1|3233864_3235220_-	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	57.9	1.0e-143
WP_029577223.1|3235392_3236199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029577222.1|3236207_3237164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029577221.1|3237229_3237454_+	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	56.8	2.4e-13
WP_029577220.1|3237642_3237855_+	helix-turn-helix domain-containing protein	NA	A0A0K0N7A4	Gordonia_phage	52.4	3.0e-05
WP_029577219.1|3237851_3238322_+	hypothetical protein	NA	K4HZ96	Acidithiobacillus_phage	44.3	2.7e-30
WP_029577218.1|3238327_3238609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029577217.1|3238605_3239463_+	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	68.4	2.3e-104
WP_029577216.1|3239474_3240071_+	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	60.8	2.3e-63
WP_029577215.1|3240085_3241762_+	DEAD/DEAH box helicase	NA	A0A1B1IW48	uncultured_Mediterranean_phage	29.2	9.9e-35
WP_029577214.1|3241758_3242115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029577213.1|3242125_3242881_+	hypothetical protein	NA	K4HZA0	Acidithiobacillus_phage	62.3	5.2e-84
WP_029577212.1|3242880_3245067_+	AAA family ATPase	NA	A0A1B2LRQ1	Wolbachia_phage	33.2	3.5e-104
WP_032959795.1|3245384_3245837_+	phage related protein	NA	K4ICN3	Acidithiobacillus_phage	73.3	7.7e-59
WP_029577210.1|3246195_3246600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032959783.1|3247732_3248998_+	site-specific DNA-methyltransferase	NA	K4HZA5	Acidithiobacillus_phage	83.5	1.8e-209
WP_029577208.1|3248961_3249330_-	hypothetical protein	NA	K4ICP1	Acidithiobacillus_phage	72.5	5.5e-47
WP_029577207.1|3249397_3249616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029577206.1|3249711_3250209_-	DUF3489 domain-containing protein	NA	A0A2H4JE21	uncultured_Caudovirales_phage	71.7	8.0e-33
WP_029577205.1|3250286_3250475_-	hypothetical protein	NA	A0A1X9I6B9	Streptococcus_phage	50.0	1.3e-07
WP_029577204.1|3250652_3251183_+	hypothetical protein	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	80.7	1.5e-69
WP_029577203.1|3251182_3253150_+|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	87.1	0.0e+00
WP_029577202.1|3253160_3253367_+	hypothetical protein	NA	A0A2H4JCJ9	uncultured_Caudovirales_phage	77.9	3.8e-21
>prophage 4
NZ_CP012076	Bordetella hinzii strain F582 chromosome, complete genome	4912977	3274985	3288051	4912977	transposase	Acidithiobacillus_phage(33.33%)	15	NA	NA
WP_029577153.1|3274985_3276020_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.0	3.3e-41
WP_029578560.1|3276714_3276945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029578561.1|3276948_3277329_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	54.7	1.0e-08
WP_155272811.1|3277333_3277480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029578562.1|3277647_3278100_-	hypothetical protein	NA	K4HZX2	Acidithiobacillus_phage	53.2	1.4e-31
WP_029578563.1|3278096_3279437_-	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	55.8	1.8e-132
WP_029578564.1|3279433_3279895_-	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	56.8	9.0e-39
WP_144417583.1|3280084_3280459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048940635.1|3281112_3281337_+	hypothetical protein	NA	A0A221SAQ3	Ralstonia_phage	39.3	7.0e-05
WP_029578567.1|3281333_3281579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029578568.1|3281575_3283723_+	AAA family ATPase	NA	Q9JMN6	Wolbachia_phage	41.8	4.4e-104
WP_144417584.1|3284352_3284841_-	DUF3489 domain-containing protein	NA	NA	NA	NA	NA
WP_029578570.1|3284849_3285053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029578571.1|3285233_3285437_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	51.7	4.0e-15
WP_029578572.1|3285516_3288051_+	site-specific DNA-methyltransferase	NA	Q1MVP0	Enterobacteria_phage	26.7	2.4e-24
