The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012077	Bordetella hinzii strain H568 chromosome, complete genome	4859884	1873155	1931454	4859884	portal,integrase,capsid,tRNA,tail,head,terminase	Pseudomonas_phage(30.56%)	68	1889655:1889675	1934906:1934926
WP_048939992.1|1873155_1876017_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.3	4.3e-70
WP_029580500.1|1876006_1876972_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_032955663.1|1877020_1877689_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.7	2.2e-25
WP_080989751.1|1877729_1879226_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_048939993.1|1879235_1879511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029580504.1|1879883_1881092_+	aminotransferase	NA	NA	NA	NA	NA
WP_029580505.1|1881088_1883362_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	37.2	3.1e-108
WP_032955665.1|1883551_1885459_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	32.3	7.3e-66
WP_029580507.1|1885473_1886364_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_029580508.1|1886370_1887504_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_029580509.1|1887503_1888325_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_029580510.1|1888349_1889540_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
1889655:1889675	attL	GTCCCGCCCTTCGCACCACTA	NA	NA	NA	NA
WP_048939994.1|1889811_1890795_+|integrase	site-specific integrase	integrase	A0A0A0YR56	Pseudomonas_phage	42.0	2.0e-51
WP_048939995.1|1890768_1891008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048939996.1|1891009_1891375_-	hypothetical protein	NA	W6MWX0	Pseudomonas_phage	44.5	1.8e-10
WP_048939997.1|1891364_1892270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048939998.1|1892266_1892476_-	hypothetical protein	NA	A0A0K1YAT0	Cronobacter_phage	49.2	2.8e-08
WP_043223546.1|1892475_1892667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048939999.1|1892666_1892978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048940000.1|1892974_1893718_-	hypothetical protein	NA	F8TVI9	EBPR_siphovirus	45.3	1.3e-07
WP_048940001.1|1893841_1894156_-	ead/Ea22-like family protein	NA	NA	NA	NA	NA
WP_053107843.1|1894148_1894391_-	hypothetical protein	NA	Q3HQW9	Burkholderia_phage	40.2	2.0e-05
WP_048940002.1|1894387_1894981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127814818.1|1894977_1895379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048940004.1|1895583_1896588_-	recombination protein RecT	NA	Q858E1	Salmonella_phage	51.3	2.7e-56
WP_048940005.1|1896590_1897067_-	HNH endonuclease	NA	C4ML56	Xanthomonas_virus	44.5	1.1e-26
WP_048940006.1|1897063_1897921_-	exonuclease VIII	NA	A0A193GYP4	Enterobacter_phage	46.7	3.9e-35
WP_048940007.1|1897917_1898265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048940008.1|1898267_1898471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048940009.1|1898467_1898782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048940010.1|1898873_1899197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048940011.1|1899846_1900269_-	hypothetical protein	NA	K4JV58	Caulobacter_phage	40.7	1.1e-06
WP_048940013.1|1901159_1902428_-	hypothetical protein	NA	A0A0U3TGV3	Pseudomonas_phage	54.5	2.5e-06
WP_048940014.1|1902498_1902765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048940015.1|1904289_1905150_-	hypothetical protein	NA	M9NYX6	Enterobacteria_phage	33.1	9.9e-31
WP_048940016.1|1905240_1906302_-	LexA family transcriptional regulator	NA	M9NZE3	Enterobacteria_phage	32.9	4.1e-10
WP_048940017.1|1906695_1907211_+	hypothetical protein	NA	B7SYH6	Stenotrophomonas_phage	43.9	2.1e-36
WP_080989753.1|1907210_1907621_+	hypothetical protein	NA	A0A0H5AUD0	Pseudomonas_phage	51.0	1.7e-20
WP_048940018.1|1907617_1907809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127814817.1|1908410_1909151_+	hypothetical protein	NA	A0A0E3T8B1	Gordonia_phage	34.9	3.5e-08
WP_048940019.1|1909147_1910536_+	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	46.1	3.2e-95
WP_043223580.1|1910537_1910867_+	DUF1064 domain-containing protein	NA	A4JX56	Burkholderia_virus	51.4	3.3e-19
WP_127814816.1|1910907_1911225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051623349.1|1911221_1911749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127814815.1|1911859_1912108_+	hypothetical protein	NA	A0A0H5AWC3	Pseudomonas_phage	46.8	9.2e-14
WP_048940022.1|1912104_1912425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127814814.1|1912790_1913600_+	HNH endonuclease	NA	G1DU88	Mycobacterium_phage	28.0	5.7e-12
WP_048940024.1|1913708_1914152_+	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	55.2	4.9e-34
WP_048940025.1|1914130_1915645_+|terminase	terminase	terminase	B5WZR8	Pseudomonas_phage	76.9	3.1e-221
WP_048940026.1|1915765_1916371_+	hypothetical protein	NA	A0A0R6PHN0	Moraxella_phage	45.1	3.5e-30
WP_048940027.1|1916471_1917854_+|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	40.4	1.4e-71
WP_048940028.1|1917916_1918201_+	hypothetical protein	NA	A0A0S2SY74	Pseudomonas_phage	64.1	3.1e-05
WP_053107846.1|1918197_1919577_+|portal	phage portal protein	portal	B5WZS2	Pseudomonas_phage	59.0	1.7e-136
WP_048940029.1|1919566_1920337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043223588.1|1920333_1920708_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_080989755.1|1920704_1921040_+|head	phage head closure protein	head	K7PH08	Enterobacteria_phage	51.8	1.1e-25
WP_127814813.1|1921074_1921533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043223590.1|1921544_1922375_+	hypothetical protein	NA	B5WZS7	Pseudomonas_phage	62.5	6.1e-94
WP_043223592.1|1922406_1922937_+	methyltransferase domain-containing protein	NA	A0A0U4IIB3	Pseudomonas_phage	58.0	8.5e-57
WP_043223595.1|1922933_1923422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048940032.1|1923421_1923784_+	DUF3168 domain-containing protein	NA	Q9MCA6	Pseudomonas_phage	35.5	6.5e-16
WP_048940033.1|1923843_1924323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043223600.1|1924325_1924649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048940035.1|1924952_1927253_+|tail	phage tail tape measure protein	tail	B7SYE7	Stenotrophomonas_phage	41.4	1.2e-33
WP_127814812.1|1927249_1927744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032954951.1|1927736_1928252_+	DUF1833 family protein	NA	J7HXQ5	Acinetobacter_phage	32.0	7.3e-21
WP_048940036.1|1928248_1928584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048940037.1|1928580_1931454_+	hypothetical protein	NA	A0A0P0HSH9	Acinetobacter_phage	33.8	4.1e-121
1934906:1934926	attR	GTCCCGCCCTTCGCACCACTA	NA	NA	NA	NA
>prophage 2
NZ_CP012077	Bordetella hinzii strain H568 chromosome, complete genome	4859884	1941823	1949572	4859884	protease	Lake_Baikal_phage(16.67%)	7	NA	NA
WP_029580519.1|1941823_1942030_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.1	7.4e-17
WP_029580520.1|1942083_1942623_-	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	33.7	1.1e-22
WP_029580521.1|1942828_1944139_+	trigger factor	NA	NA	NA	NA	NA
WP_029580522.1|1944141_1944795_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.4	1.5e-55
WP_032955669.1|1944899_1946198_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	1.4e-129
WP_029580524.1|1946363_1948793_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	2.0e-222
WP_029580525.1|1948918_1949572_-	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
