The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT905140	Salmonella enterica subsp. enterica serovar Typhi strain ERL082356 chromosome 1	4793405	875847	969502	4793405	tail,integrase,plate,head,capsid,lysis,terminase,portal	Salmonella_phage(80.85%)	102	877020:877036	974732:974748
WP_000089603.1|875847_876999_+|integrase	site-specific integrase	integrase	B5WZU7	Pseudomonas_phage	44.8	6.3e-49
877020:877036	attL	GTCATTTACGTGATTTA	NA	NA	NA	NA
WP_000455463.1|877095_877563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000994659.1|877774_878650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001149494.1|878837_879200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000214158.1|879156_880071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001768408.1|880089_880830_+	TIGR03759 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_000948246.1|881101_881494_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_000253629.1|881529_882030_+	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_000626967.1|882039_882609_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_000071290.1|882628_884719_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_010989289.1|884715_885474_+	TIGR03747 family integrating conjugative element membrane protein	NA	NA	NA	NA	NA
WP_000252871.1|885710_885965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001251281.1|885964_886204_+	TIGR03758 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_000949576.1|886233_886596_+	TIGR03745 family integrating conjugative element membrane protein	NA	NA	NA	NA	NA
WP_000086082.1|886975_887629_+	TIGR03746 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_001240640.1|887628_888528_+	TIGR03749 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_001165842.1|888517_889996_+	TIGR03752 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_000244536.1|889982_890432_+	TIGR03751 family conjugal transfer lipoprotein	NA	NA	NA	NA	NA
WP_000054770.1|893421_893808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000821941.1|893962_894355_+	TIGR03757 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_000838927.1|894351_895320_+	TIGR03756 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_010989292.1|895334_896765_+	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_000213770.1|897097_898603_+	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000993574.1|898638_899028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000623988.1|899251_899494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001283066.1|899898_901146_+	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.1	6.0e-61
WP_000502502.1|901130_901772_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	53.7	1.1e-55
WP_010989295.1|901982_902525_-	DUF1062 domain-containing protein	NA	NA	NA	NA	NA
WP_000907593.1|903789_904710_+|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_001020123.1|905433_905736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001103837.1|905831_906212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000018145.1|906582_906792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000979718.1|906809_907262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000968700.1|907258_907555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000115421.1|907632_908091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001097965.1|908179_910129_+	DUF1738 domain-containing protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
WP_000881183.1|910200_911109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000022216.1|911182_912082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000911568.1|912156_912483_+	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
WP_001222413.1|912582_912852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000457555.1|912983_914258_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
WP_001039750.1|914477_914855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001775272.1|914941_915160_-	ogr/Delta-like zinc finger family protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
WP_001011750.1|915227_916328_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
WP_000980405.1|916324_916810_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
WP_161976233.1|916809_919356_-|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	42.7	1.2e-113
WP_000763315.1|919582_919702_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	94.9	1.2e-14
WP_001280965.1|919716_920019_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
WP_001207653.1|920073_920589_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
WP_000046101.1|920598_921771_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
WP_000388790.1|921873_922092_-	Hin recombinase	NA	A0A1S6L009	Salmonella_phage	90.3	1.4e-29
WP_000161708.1|922305_923028_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_000006337.1|923225_923633_-|tail	tail fiber assembly protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
WP_000104806.1|923639_925259_-|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
WP_001086816.1|925255_925861_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
WP_000268327.1|925853_926762_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
WP_000177408.1|926748_927108_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
WP_000993749.1|927104_927683_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
WP_000343944.1|927751_928198_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
WP_001039966.1|928190_928622_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	2.5e-75
WP_024131238.1|928717_929146_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	97.9	3.3e-67
WP_000731034.1|929142_929520_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
WP_001097942.1|929524_930034_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.0	1.3e-91
WP_000171566.1|930014_930230_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
WP_000868184.1|930233_930437_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000673540.1|930436_930901_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
WP_000059175.1|930994_931645_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
WP_000730751.1|931648_932713_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
WP_000216272.1|932729_933563_-|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
WP_001098453.1|933705_935472_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
WP_001681813.1|935471_936515_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
WP_000080839.1|936563_937259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000789323.1|937278_938343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000829584.1|938339_939404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835188.1|939413_939632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217561.1|939727_939961_-	DinI family protein	NA	A0A1S6L014	Salmonella_phage	92.2	2.2e-33
WP_001154438.1|939972_940161_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	96.8	7.9e-26
WP_001090717.1|943570_944155_-	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
WP_000785510.1|944151_944379_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
WP_001244240.1|944378_944612_-	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
WP_000963479.1|944679_945021_-	DUF5347 domain-containing protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
WP_000956167.1|944984_945185_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
WP_000460852.1|945192_945702_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
WP_000102106.1|945734_945977_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
WP_000052560.1|946093_946726_+	helix-turn-helix domain-containing protein	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
WP_000027757.1|946729_947755_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
WP_001681810.1|948861_949119_+	YjhX family toxin	NA	NA	NA	NA	NA
WP_001681808.1|949129_950020_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000354257.1|950019_950766_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000052242.1|951067_953038_-	Vi polysaccharide transport protein VexE	NA	NA	NA	NA	NA
WP_000431675.1|953057_954362_-	Vi polysaccharide ABC transporter inner membrane protein VexD	NA	NA	NA	NA	NA
WP_000467404.1|954384_955080_-	Vi polysaccharide ABC transporter ATP-binding protein VexC	NA	NA	NA	NA	NA
WP_001023498.1|955105_955900_-	Vi polysaccharide ABC transporter inner membrane protein VexB	NA	NA	NA	NA	NA
WP_000720235.1|955909_956977_-	Vi polysaccharide ABC transporter protein VexA	NA	NA	NA	NA	NA
WP_000632616.1|957021_958758_-	Vi polysaccharide biosynthesis glycosyltransferase TviE	NA	NA	NA	NA	NA
WP_010989299.1|958757_961253_-	Vi polysaccharide biosynthesis protein TviD	NA	NA	NA	NA	NA
WP_000127915.1|961276_962323_-	Vi polysaccharide biosynthesis UDP-N-acetylglucosaminuronic acid C-4 epimerase TviC	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
WP_000466893.1|962325_963603_-	Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
WP_001210944.1|963847_964387_-	Vi polysaccharide biosynthesis regulator TviA	NA	NA	NA	NA	NA
WP_001120833.1|965240_966752_+	ATP-dependent helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
WP_000488995.1|966735_968325_+	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_000449622.1|968488_969502_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
974732:974748	attR	TAAATCACGTAAATGAC	NA	NA	NA	NA
>prophage 2
NZ_LT905140	Salmonella enterica subsp. enterica serovar Typhi strain ERL082356 chromosome 1	4793405	1121677	1129348	4793405	integrase	Enterobacteria_phage(33.33%)	7	1112212:1112225	1125343:1125356
1112212:1112225	attL	GTTAATGTTAAAAC	NA	NA	NA	NA
WP_000152561.1|1121677_1123168_-	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	36.1	4.0e-11
WP_000772672.1|1123638_1124904_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.0	1.6e-74
WP_000573583.1|1124966_1126043_-	serine/threonine protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
1125343:1125356	attR	GTTTTAACATTAAC	NA	NA	NA	NA
WP_000700163.1|1126039_1127098_-	serine/threonine protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	4.9e-56
WP_000493739.1|1127087_1128251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214423.1|1128526_1129093_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
WP_000468230.1|1129108_1129348_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
>prophage 3
NZ_LT905140	Salmonella enterica subsp. enterica serovar Typhi strain ERL082356 chromosome 1	4793405	1787765	1793796	4793405		Salmonella_virus(50.0%)	6	NA	NA
WP_106417237.1|1787765_1787912_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	73.9	1.1e-14
WP_106417236.1|1787927_1788071_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	87.8	9.0e-14
WP_000400611.1|1789060_1790983_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.2	5.6e-300
WP_000703599.1|1790999_1791254_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
WP_001682026.1|1791222_1791612_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	91.5	6.9e-56
WP_000377769.1|1792854_1793796_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	88.2	2.4e-147
>prophage 4
NZ_LT905140	Salmonella enterica subsp. enterica serovar Typhi strain ERL082356 chromosome 1	4793405	2028305	2037476	4793405	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|2028305_2029253_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824854.1|2029236_2029968_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|2029948_2030056_-	protein YohO	NA	NA	NA	NA	NA
WP_001240415.1|2030115_2030847_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272853.1|2031069_2032755_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
WP_000598632.1|2032751_2033471_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|2033517_2033985_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197951.1|2034041_2034572_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|2034743_2035202_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195338.1|2035442_2037476_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 5
NZ_LT905140	Salmonella enterica subsp. enterica serovar Typhi strain ERL082356 chromosome 1	4793405	2113367	2123874	4793405		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111852.1|2113367_2114771_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
WP_000981469.1|2114948_2115842_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|2116218_2117304_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023656.1|2117303_2118203_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
WP_000857536.1|2118250_2119129_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
WP_000973711.1|2119129_2119681_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
WP_000018220.1|2119686_2120661_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|2120676_2121450_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565909.1|2121454_2122534_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
WP_000126347.1|2122560_2123874_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 6
NZ_LT905140	Salmonella enterica subsp. enterica serovar Typhi strain ERL082356 chromosome 1	4793405	2230174	2237408	4793405		Morganella_phage(33.33%)	8	NA	NA
WP_000394197.1|2230174_2230594_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457648.1|2230596_2231865_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
WP_000208507.1|2232310_2232523_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
WP_024131163.1|2232533_2232722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080666.1|2232982_2234167_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
WP_000107435.1|2234817_2235129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000377043.1|2235208_2235904_+	phosphohydrolase	NA	S4W232	Pandoravirus	27.5	2.1e-07
WP_001157299.1|2235977_2237408_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 7
NZ_LT905140	Salmonella enterica subsp. enterica serovar Typhi strain ERL082356 chromosome 1	4793405	2441261	2445673	4793405		Escherichia_phage(50.0%)	6	NA	NA
WP_000281950.1|2441261_2441675_+	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
WP_001766395.1|2441691_2442420_+	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
WP_000158843.1|2442611_2443154_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
WP_001277616.1|2443301_2443679_-	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_001529135.1|2443751_2444561_-	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
WP_000497459.1|2445433_2445673_-	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	87.3	5.5e-32
>prophage 8
NZ_LT905140	Salmonella enterica subsp. enterica serovar Typhi strain ERL082356 chromosome 1	4793405	2626710	2700368	4793405	tail,integrase,capsid,plate,protease,transposase,tRNA	Burkholderia_virus(38.1%)	88	2666262:2666278	2699276:2699292
WP_000168626.1|2626710_2627985_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
WP_000765713.1|2628733_2629339_-	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_000100913.1|2629443_2630949_-	dipeptide/tripeptide permease DtpA	NA	NA	NA	NA	NA
WP_001030324.1|2631549_2632185_-	endonuclease III	NA	NA	NA	NA	NA
WP_001289628.1|2632184_2632877_-	electron transport complex subunit E	NA	NA	NA	NA	NA
WP_000920820.1|2632879_2633500_-	electron transport complex subunit RsxG	NA	NA	NA	NA	NA
WP_000231887.1|2633503_2634562_-	electron transport complex subunit RsxD	NA	NA	NA	NA	NA
WP_000915581.1|2634562_2636584_-	electron transport complex subunit RsxC	NA	NA	NA	NA	NA
WP_001092600.1|2636576_2637155_-	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_000133179.1|2637154_2637736_-	electron transport complex subunit RsxA	NA	NA	NA	NA	NA
WP_000214061.1|2637812_2638253_-	DUF2569 domain-containing protein	NA	NA	NA	NA	NA
WP_000217946.1|2638341_2638557_-	transcription modulator YdgT	NA	NA	NA	NA	NA
WP_031608772.1|2638855_2638981_-	division septum protein Blr	NA	NA	NA	NA	NA
WP_000998242.1|2639188_2640229_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000565566.1|2640302_2641304_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_000753325.1|2642009_2643518_-	YdgA family protein	NA	NA	NA	NA	NA
WP_001170615.1|2643620_2644796_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000066606.1|2644995_2646642_+	class I fumarate hydratase	NA	NA	NA	NA	NA
WP_000259129.1|2646809_2648213_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_000092483.1|2648209_2649139_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_001681605.1|2649214_2650516_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
WP_000928668.1|2650626_2652333_-	amidohydrolase	NA	NA	NA	NA	NA
WP_000824321.1|2652485_2653637_-	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
WP_001080045.1|2654117_2654849_-	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_000524877.1|2654975_2655311_+	GlpM family protein	NA	NA	NA	NA	NA
WP_000412353.1|2655372_2656755_-	amino acid permease	NA	NA	NA	NA	NA
WP_001165548.1|2657035_2657608_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
WP_024131175.1|2657679_2658213_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	58.8	2.8e-44
WP_024131174.1|2658223_2658700_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	56.4	1.9e-44
WP_001057643.1|2658706_2659324_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
WP_001802272.1|2659323_2659827_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	54.0	2.3e-43
WP_065311601.1|2659837_2660371_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	58.5	8.3e-44
WP_001775322.1|2660381_2661335_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	51.8	1.2e-58
WP_000852584.1|2661337_2661916_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
WP_001219103.1|2661908_2663012_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
WP_000859114.1|2663002_2663350_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
WP_000148263.1|2663406_2663934_-|plate	phage baseplate assembly protein V	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
WP_000808000.1|2663930_2665085_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
WP_000478221.1|2665072_2665285_-|tail	tail protein X	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
WP_000458383.1|2665284_2666169_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.0	7.5e-50
WP_000135574.1|2666168_2668634_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	42.6	2.2e-168
2666262:2666278	attL	GGCAGGCGCTGCGGTTT	NA	NA	NA	NA
WP_001148841.1|2668727_2668865_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000084228.1|2668809_2669145_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000110118.1|2669242_2669524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162828734.1|2669526_2670051_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.2	4.7e-68
WP_000729859.1|2670047_2671475_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
WP_000666498.1|2671464_2671716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101804.1|2671715_2672180_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_000271668.1|2672179_2672626_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_000537457.1|2672627_2672966_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_001286905.1|2672975_2673929_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
WP_001273072.1|2673943_2675059_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
WP_000135517.1|2675273_2675732_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
WP_000117561.1|2675734_2676556_-|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
WP_000090679.1|2676536_2678033_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
WP_170825686.1|2678032_2679574_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.0e-184
WP_000124060.1|2679624_2680170_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
WP_000227700.1|2680169_2680481_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000175097.1|2680480_2680807_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
WP_000264664.1|2680803_2681454_-	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
WP_001104436.1|2681437_2682166_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	57.4	2.7e-61
WP_000793143.1|2682168_2682519_-	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
WP_100208317.1|2682762_2683359_-	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001765083.1|2683354_2683786_+	hypothetical protein	NA	A4JWN3	Burkholderia_virus	57.3	4.5e-32
WP_000567456.1|2683795_2683960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000990529.1|2683963_2685733_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
WP_000960673.1|2685743_2686910_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
WP_000843446.1|2686912_2687182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140134.1|2687209_2687740_+	host-nuclease inhibitor Gam family protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
WP_000632575.1|2688028_2688301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000197790.1|2688310_2688613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001315283.1|2688609_2688993_+	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	58.9	2.3e-27
WP_153781233.1|2689000_2689201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000131941.1|2689197_2689881_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
WP_000631816.1|2689877_2690108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989166.1|2690097_2690313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001315282.1|2690305_2690755_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	46.6	9.4e-25
WP_001281695.1|2690726_2691116_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
WP_000769298.1|2691297_2692242_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001219360.1|2692768_2694298_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_000014056.1|2694308_2695697_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_001118268.1|2695871_2696906_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_000500278.1|2697322_2697685_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_001183821.1|2697671_2698001_+	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_000549642.1|2698035_2698857_-|protease	serine protease	protease	NA	NA	NA	NA
WP_001766314.1|2699125_2699377_-	acid shock protein	NA	NA	NA	NA	NA
2699276:2699292	attR	GGCAGGCGCTGCGGTTT	NA	NA	NA	NA
WP_000431187.1|2699770_2699953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000502118.1|2699909_2700368_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_LT905140	Salmonella enterica subsp. enterica serovar Typhi strain ERL082356 chromosome 1	4793405	3142311	3220511	4793405	tail,protease,head,plate,transposase,terminase,holin	Salmonella_phage(71.19%)	91	NA	NA
WP_000938184.1|3142311_3142992_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.1	4.1e-80
WP_000502118.1|3143199_3143658_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_000374046.1|3144321_3144981_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000904446.1|3145067_3145397_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|3145393_3145675_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000502118.1|3146411_3146870_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_000140485.1|3148001_3149213_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|3149270_3149588_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001537782.1|3149632_3150046_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|3150219_3150882_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|3150976_3151435_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420526.1|3151470_3153525_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
WP_001261222.1|3153648_3154095_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950867.1|3154113_3156267_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202371.1|3156253_3156859_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|3157075_3157585_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_010989142.1|3157939_3158992_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877174.1|3159063_3159516_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156455.1|3159701_3161462_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|3161530_3162049_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001764860.1|3162148_3162316_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|3162569_3163133_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433416.1|3163129_3164770_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|3164774_3166028_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053045.1|3166042_3167950_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086472.1|3167962_3170071_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
WP_000224084.1|3170169_3171279_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|3171275_3171818_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291724.1|3171983_3172994_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193884.1|3173201_3175814_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
WP_000480169.1|3176830_3177532_+	DUF1076 domain-containing protein	NA	NA	NA	NA	NA
WP_000421106.1|3178453_3178972_-|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
WP_001681975.1|3178986_3180498_-	hypothetical protein	NA	S4TP62	Salmonella_phage	59.4	1.5e-111
WP_000049938.1|3180497_3181178_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
WP_001197092.1|3181174_3182374_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
WP_001270647.1|3182374_3182728_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
WP_001685627.1|3182968_3183724_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
WP_001144794.1|3183782_3184211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050472.1|3184210_3184942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000826019.1|3185136_3185472_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
WP_000042301.1|3185468_3186500_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
WP_000388505.1|3186502_3186805_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
WP_000346974.1|3186808_3187459_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
WP_000990867.1|3187458_3189411_-	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
WP_000389047.1|3189588_3190041_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
WP_000257259.1|3190044_3190485_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
WP_001135544.1|3190496_3191642_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
WP_000389379.1|3191645_3192209_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
WP_001142488.1|3192183_3192573_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
WP_000008737.1|3192559_3193114_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
WP_001125675.1|3193110_3193518_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
WP_001040702.1|3193483_3193852_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
WP_000627464.1|3193893_3194835_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
WP_000128060.1|3194846_3195344_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
WP_000873182.1|3195348_3196581_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
WP_138010671.1|3196595_3197333_-|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	88.1	7.8e-101
WP_000113511.1|3197217_3198687_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
WP_000204794.1|3198686_3200090_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
WP_001118118.1|3200055_3200808_-	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
WP_001070544.1|3200897_3201125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000495544.1|3201221_3201599_-	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
WP_001075998.1|3202176_3202791_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
WP_000226307.1|3202790_3203072_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
WP_001294876.1|3203058_3203448_-|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
WP_000798706.1|3203664_3204114_+	lipoprotein	NA	NA	NA	NA	NA
WP_001534733.1|3204249_3204375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047634.1|3204773_3205571_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
WP_001617856.1|3205560_3205707_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001096560.1|3205703_3206315_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
WP_000929790.1|3206523_3207126_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_001217670.1|3207460_3207700_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
WP_000963896.1|3207884_3208382_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_000509711.1|3208392_3208572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208074.1|3209417_3209990_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
WP_000445792.1|3209993_3210467_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
WP_000065105.1|3210466_3210991_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
WP_000113623.1|3210987_3211335_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
WP_000800010.1|3211345_3212095_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_001681803.1|3212097_3213081_-	replication protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
WP_001574095.1|3213165_3213540_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000869365.1|3213505_3213742_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	98.7	1.1e-37
WP_001009036.1|3213871_3214276_+	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
WP_000186242.1|3214564_3214765_+	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
WP_000995349.1|3214855_3215152_+	host-nuclease inhibitor protein Gam	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
WP_001764962.1|3215157_3215943_+	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
WP_000187053.1|3215939_3216620_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
WP_000034527.1|3216697_3217762_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
WP_010989138.1|3217758_3218640_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
WP_001754984.1|3218645_3218885_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	96.2	9.7e-37
WP_000065276.1|3218925_3219174_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262313.1|3219218_3220511_+	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.8	5.0e-252
>prophage 10
NZ_LT905140	Salmonella enterica subsp. enterica serovar Typhi strain ERL082356 chromosome 1	4793405	3291649	3298961	4793405	protease,integrase	Ralstonia_phage(16.67%)	7	3286518:3286532	3297697:3297711
3286518:3286532	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_001539594.1|3291649_3292027_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
WP_001117984.1|3292188_3292386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934058.1|3292597_3294874_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
WP_000520789.1|3294904_3295225_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|3295548_3295770_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125880.1|3295899_3297846_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
3297697:3297711	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
WP_001201759.1|3297842_3298961_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
>prophage 11
NZ_LT905140	Salmonella enterica subsp. enterica serovar Typhi strain ERL082356 chromosome 1	4793405	3911600	3998762	4793405	plate,tail,tRNA	Salmonella_phage(40.0%)	67	NA	NA
WP_048666053.1|3911600_3912944_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001007105.1|3912947_3913484_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000312802.1|3913550_3914036_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_001171575.1|3914272_3914698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001147174.1|3914669_3915071_-	BPSL0067 family protein	NA	NA	NA	NA	NA
WP_000996818.1|3916655_3917198_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000175184.1|3917261_3917552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449770.1|3917637_3920301_-	type VI secretion system ATPase TssH	NA	A0A2I7SAX5	Vibrio_phage	34.8	9.8e-77
WP_000806676.1|3920668_3921571_+	type VI secretion system-associated protein TagK	NA	NA	NA	NA	NA
WP_000750542.1|3921557_3922382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000108006.1|3922378_3922873_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000371495.1|3922888_3924772_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000145233.1|3924768_3925764_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001670675.1|3927358_3928090_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.9	6.4e-39
WP_000917872.1|3928153_3928621_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.9	4.7e-51
WP_000801233.1|3928617_3929340_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052766.1|3929374_3930130_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644706.1|3930201_3931569_+	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	33.0	1.4e-10
WP_000207227.1|3931624_3932395_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230964.1|3932472_3933273_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_001127546.1|3933404_3934580_-	MFS transporter	NA	NA	NA	NA	NA
WP_000648539.1|3934684_3935599_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000154870.1|3935619_3936423_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.4	2.7e-38
WP_001235094.1|3942455_3945029_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.6	9.0e-128
WP_000992642.1|3945158_3945890_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079130.1|3945886_3946867_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197667.1|3946998_3947736_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178449.1|3948007_3948346_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_010989056.1|3948449_3948497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200079.1|3948596_3949757_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000210976.1|3949717_3950626_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000225191.1|3950683_3951805_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168062.1|3951814_3952885_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_001212373.1|3953324_3953843_+	YfiR family protein	NA	NA	NA	NA	NA
WP_001030993.1|3953835_3955056_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	37.0	1.7e-07
WP_000065257.1|3955212_3955560_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000469802.1|3955600_3956368_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|3956412_3956961_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|3956979_3957228_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460052.1|3957571_3958933_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001537507.1|3959098_3959890_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_127172650.1|3959909_3961196_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001682111.1|3961316_3961874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518875.1|3961955_3962546_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059155.1|3962669_3963548_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880973.1|3963633_3965295_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203445.1|3965443_3965782_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112990.1|3965947_3966238_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242603.1|3966227_3966704_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|3966853_3967336_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_001237649.1|3967955_3978830_+	Ig-like domain repeat protein	NA	NA	NA	NA	NA
WP_000533850.1|3978893_3980303_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_000196137.1|3980299_3982456_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_010989217.1|3982487_3983651_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000151542.1|3984193_3984967_-	reverse transcriptase	NA	NA	NA	NA	NA
WP_000380485.1|3984935_3985109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000972389.1|3985370_3985589_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
WP_001011760.1|3985679_3986780_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
WP_000980381.1|3986776_3987262_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
WP_001282793.1|3987258_3990336_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
WP_000763311.1|3990328_3990448_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001280897.1|3990462_3990765_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
WP_001207656.1|3990819_3991335_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
WP_000046142.1|3991344_3992517_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
WP_000905046.1|3992659_3993226_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	1.1e-86
WP_001221113.1|3993909_3995025_+	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_001111827.1|3995105_3998762_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 12
NZ_LT905140	Salmonella enterica subsp. enterica serovar Typhi strain ERL082356 chromosome 1	4793405	4316089	4359271	4793405	bacteriocin,integrase,protease,transposase,tRNA	Bacillus_virus(25.0%)	47	4306205:4306218	4365202:4365215
4306205:4306218	attL	TTCACAACGCCAGC	NA	NA	NA	NA
WP_001204111.1|4316089_4316548_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_000034386.1|4316737_4317817_-	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000111274.1|4317918_4319082_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_000218338.1|4319103_4320150_-	erythrose-4-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000218564.1|4320523_4320949_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000124001.1|4320974_4321553_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_000553254.1|4321553_4322261_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_001775599.1|4322248_4322926_+	energy-coupling factor ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_000956919.1|4322919_4323576_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
WP_000502119.1|4323680_4324139_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_000098658.1|4324327_4326319_-	transketolase	NA	NA	NA	NA	NA
WP_000701830.1|4326594_4327353_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000105550.1|4327453_4328374_-	agmatinase	NA	NA	NA	NA	NA
WP_001278580.1|4328601_4330578_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_000729109.1|4330586_4330718_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_077905074.1|4330851_4331016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001803086.1|4331012_4331312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001062140.1|4331367_4332522_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
WP_001113171.1|4333014_4334409_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_000856775.1|4334487_4334985_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286121.1|4335080_4335788_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001800534.1|4335864_4336596_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593242.1|4336615_4337563_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053167.1|4337778_4338342_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_001285491.1|4338341_4338758_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_000098333.1|4338804_4339491_-	global regulatory protein	NA	NA	NA	NA	NA
WP_001055657.1|4339620_4340601_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997790.1|4340618_4341323_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_001094848.1|4341341_4341908_+	YggT family protein	NA	NA	NA	NA	NA
WP_001277205.1|4341904_4342195_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174773.1|4342202_4342796_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_001096530.1|4342788_4343925_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000252198.1|4344015_4345023_-	DUF1202 domain-containing protein	NA	NA	NA	NA	NA
WP_000394189.1|4345155_4346202_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000502119.1|4346520_4346979_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_000984827.1|4347101_4347821_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107559.1|4347870_4348197_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786887.1|4348196_4348916_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001148958.1|4349070_4350123_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091706.1|4350150_4350426_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_000976287.1|4350538_4351624_+	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
WP_001049802.1|4351840_4353097_+	nucleoside permease	NA	NA	NA	NA	NA
WP_000234466.1|4355707_4356415_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001681938.1|4356756_4357041_+	DUF4102 domain-containing protein	NA	A0A0P0IRB7	Acinetobacter_phage	35.2	3.2e-10
WP_014341481.1|4357225_4357570_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_001141622.1|4358690_4359008_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_000768134.1|4359004_4359271_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
4365202:4365215	attR	TTCACAACGCCAGC	NA	NA	NA	NA
>prophage 13
NZ_LT905140	Salmonella enterica subsp. enterica serovar Typhi strain ERL082356 chromosome 1	4793405	4454304	4510330	4793405	tail,integrase,plate,head,capsid,tRNA,terminase,holin,portal	Cronobacter_phage(65.0%)	59	4451975:4451998	4501111:4501134
4451975:4451998	attL	TTGCCTGATGGCGCTGCGCTTATC	NA	NA	NA	NA
WP_001264383.1|4454304_4455318_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	6.3e-109
WP_001144069.1|4455545_4455761_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918867.1|4455996_4457742_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.6e-72
WP_001519776.1|4457891_4459739_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000237776.1|4459862_4460369_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001215694.1|4460681_4461305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000977538.1|4461955_4463659_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	9.9e-224
WP_000200790.1|4463658_4464204_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	73.1	1.5e-64
WP_000267952.1|4464175_4464901_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.8	2.3e-68
WP_000421117.1|4464890_4465418_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	3.1e-51
WP_048666041.1|4465435_4467463_-|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	47.7	3.4e-154
WP_001534884.1|4467472_4468060_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.6	2.2e-90
WP_000136925.1|4468052_4469237_-|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	78.4	1.8e-179
WP_001002797.1|4469233_4469563_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000811092.1|4469559_4471530_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	71.1	6.4e-275
WP_000411337.1|4471717_4471975_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_000376370.1|4472121_4472454_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.9	6.7e-36
WP_000175560.1|4472453_4472795_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_001154425.1|4472791_4473085_-|holin	phage holin family protein	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000166743.1|4473094_4473550_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_000220203.1|4473546_4474674_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	83.7	1.9e-175
WP_000560078.1|4474670_4475378_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	77.4	1.0e-102
WP_000084222.1|4475374_4475881_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.1	3.4e-63
WP_001680743.1|4475877_4476330_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.7	1.6e-64
WP_001218537.1|4476426_4477128_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	9.4e-88
WP_000550496.1|4477131_4478154_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
WP_000018796.1|4478215_4479019_-|capsid	GPO family capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	56.0	1.6e-78
WP_001151942.1|4479179_4480955_+	hypothetical protein	NA	F1BUM5	Cronobacter_phage	83.6	5.2e-292
WP_000038208.1|4480951_4482013_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.1	2.3e-162
WP_001552031.1|4482009_4482333_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_000353141.1|4482306_4482513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000170875.1|4482632_4484654_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	75.1	1.7e-299
WP_000279408.1|4484650_4485511_-	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	82.7	2.2e-131
WP_000551169.1|4485501_4485735_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000022786.1|4485802_4486204_-	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
WP_000996837.1|4486203_4486629_-	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.2e-23
WP_000643375.1|4486618_4486846_-	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_000460878.1|4486855_4487359_-	phage regulatory CII family protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_001247711.1|4487389_4487611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514631.1|4487754_4488336_+	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	37.2	1.2e-27
WP_000568372.1|4488352_4488919_+	PH domain-containing protein	NA	Q4ZA70	Staphylococcus_virus	32.8	1.3e-18
WP_001145220.1|4488922_4489960_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	63.9	1.5e-121
WP_000627044.1|4489949_4491731_+	ATP-binding protein	NA	X2KLG0	Campylobacter_phage	23.2	6.4e-08
WP_000213683.1|4491988_4492756_-	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_086011941.1|4492987_4493635_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000478457.1|4493631_4495200_-	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.5	3.8e-12
WP_000094656.1|4495587_4497108_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	47.0	1.9e-32
WP_001536702.1|4497537_4498917_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	29.0	3.8e-32
WP_000019992.1|4501185_4502322_-	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
4501111:4501134	attR	TTGCCTGATGGCGCTGCGCTTATC	NA	NA	NA	NA
WP_000202966.1|4502407_4502905_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000951045.1|4503056_4503749_+	vancomycin high temperature exclusion protein	NA	NA	NA	NA	NA
WP_024131215.1|4503836_4504835_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_001098834.1|4505102_4506071_+	TerC family protein	NA	I7HPH5	Enterobacteria_phage	34.9	6.5e-39
WP_000235369.1|4506325_4507570_+	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_000422141.1|4508019_4508682_+	DedA family protein	NA	NA	NA	NA	NA
WP_000917516.1|4508685_4509069_+	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_000877297.1|4509213_4509582_+	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_000031219.1|4509623_4509929_+	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000785626.1|4509931_4510330_+|holin	phage holin family protein	holin	NA	NA	NA	NA
>prophage 14
NZ_LT905140	Salmonella enterica subsp. enterica serovar Typhi strain ERL082356 chromosome 1	4793405	4769226	4793405	4793405	tail,integrase,capsid,head,plate,lysis,terminase,portal	Salmonella_phage(86.21%)	34	4764190:4764204	4776356:4776370
4764190:4764204	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
WP_001012560.1|4769226_4770873_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
WP_001311244.1|4771012_4771111_-	ilv operon leader peptide	NA	NA	NA	NA	NA
WP_000290950.1|4771736_4772789_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
WP_000900883.1|4772977_4773169_-	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_001047327.1|4773184_4773754_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
WP_001247706.1|4773879_4774101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|4774133_4774643_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956176.1|4774650_4774947_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.4	4.9e-22
WP_000996717.1|4775064_4775406_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_001244218.1|4775473_4775707_+	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
WP_000752613.1|4775706_4775934_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_000104152.1|4775930_4776788_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
4776356:4776370	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
WP_000017503.1|4776784_4779199_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_001580533.1|4779352_4779541_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
WP_000822803.1|4779608_4779908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001251692.1|4780016_4780895_-	hypothetical protein	NA	A0A2H4J8D6	uncultured_Caudovirales_phage	49.4	6.1e-52
WP_001146827.1|4781508_4782423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000185757.1|4782419_4783160_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_000518064.1|4783194_4784232_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
WP_001098422.1|4784231_4785998_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_000216244.1|4786140_4786974_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
WP_000742518.1|4786990_4788049_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
WP_000059191.1|4788052_4788703_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_000673504.1|4788798_4789263_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.4e-76
WP_000868175.1|4789262_4789466_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|4789469_4789685_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001069905.1|4789665_4790178_+	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	3.1e-88
WP_000727853.1|4790179_4790557_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
WP_001080928.1|4790553_4790982_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	77.3	2.2e-47
WP_001039939.1|4791077_4791509_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
WP_000829146.1|4791501_4791948_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
WP_000993754.1|4792016_4792595_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
WP_000177595.1|4792591_4792951_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
WP_001784853.1|4792937_4793405_+|plate	baseplate J/gp47 family protein	plate	A0A1S6KZY6	Salmonella_phage	86.5	1.8e-66
