The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012099	Bacillus thuringiensis strain HS18-1, complete genome	5292526	256480	264430	5292526		uncultured_virus(33.33%)	6	NA	NA
WP_000917311.1|256480_256765_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	54.8	1.2e-20
WP_001029992.1|256803_258438_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.8	1.3e-156
WP_000743908.1|258844_260383_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.7	8.8e-22
WP_000833096.1|260768_262094_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.4	4.1e-44
WP_000929891.1|262239_262941_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	7.3e-40
WP_050842421.1|262924_264430_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.5	2.1e-31
>prophage 2
NZ_CP012099	Bacillus thuringiensis strain HS18-1, complete genome	5292526	308349	316725	5292526		Synechococcus_phage(50.0%)	8	NA	NA
WP_000625687.1|308349_309657_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	1.1e-20
WP_029441464.1|309745_310465_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.3	6.8e-49
WP_000278823.1|310457_310712_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_029441465.1|310708_311392_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_016083739.1|311375_313595_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	3.3e-163
WP_000879026.1|313579_314995_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	3.3e-55
WP_016083737.1|315100_316141_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.9	2.1e-67
WP_016083736.1|316137_316725_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.9	3.5e-27
>prophage 3
NZ_CP012099	Bacillus thuringiensis strain HS18-1, complete genome	5292526	1374401	1459207	5292526	protease,portal,tail,terminase,integrase,holin,head,capsid	Bacillus_phage(61.7%)	100	1424301:1424322	1461302:1461323
WP_016082326.1|1374401_1375373_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	28.0	5.9e-32
WP_000285418.1|1375402_1376104_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_016082325.1|1376292_1378179_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	34.1	9.6e-87
WP_029437994.1|1378372_1379482_-|integrase	site-specific integrase	integrase	A0A0U3U8Y8	Bacillus_phage	76.2	2.1e-142
WP_155417051.1|1379681_1379837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050842967.1|1379902_1380247_-	helix-turn-helix transcriptional regulator	NA	A0A1B1P888	Bacillus_phage	43.8	3.5e-19
WP_050842969.1|1380771_1381911_+	hypothetical protein	NA	H0UST6	Bacillus_phage	37.1	1.4e-61
WP_155417052.1|1382201_1382354_+	hypothetical protein	NA	A0A0A7AQZ6	Bacillus_phage	74.0	5.2e-12
WP_029437997.1|1382360_1382708_-	helix-turn-helix transcriptional regulator	NA	A0A0A7AR52	Bacillus_phage	91.3	4.2e-49
WP_033694466.1|1382883_1383102_+	helix-turn-helix transcriptional regulator	NA	A0A0A7AQV9	Bacillus_phage	90.3	4.7e-30
WP_029437999.1|1383159_1383834_+	hypothetical protein	NA	A0A288WFT2	Bacillus_phage	52.2	4.0e-59
WP_029438000.1|1383871_1384147_+	helix-turn-helix domain-containing protein	NA	A0A0U3ULL9	Bacillus_phage	86.5	2.1e-35
WP_050842973.1|1384557_1385421_+	chromosomal replication initiator protein DnaA	NA	A0A0U3TZZ4	Bacillus_phage	89.1	1.8e-125
WP_050842975.1|1385362_1386238_+	ATP-binding protein	NA	A0A0U4K4W7	Exiguobacterium_phage	28.2	2.0e-10
WP_050842977.1|1386271_1386466_+	hypothetical protein	NA	A0A1B1P7U7	Bacillus_phage	76.6	2.5e-19
WP_050842979.1|1386482_1386761_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	61.0	1.3e-13
WP_050842981.1|1386753_1387113_+	hypothetical protein	NA	A0A1B1P7A1	Bacillus_phage	52.6	4.1e-31
WP_050842983.1|1387140_1387305_+	DUF3954 domain-containing protein	NA	A0A1B0T6B8	Bacillus_phage	57.7	4.1e-10
WP_050842985.1|1387332_1387581_+	hypothetical protein	NA	A0A0K2CNP4	Brevibacillus_phage	36.1	6.4e-07
WP_050842986.1|1387589_1387856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050842989.1|1387979_1388489_+	dUTPase	NA	A0A1L2JY27	Aeribacillus_phage	45.4	8.8e-27
WP_016081488.1|1388978_1389578_+	hypothetical protein	NA	A0A0S2SXN5	Bacillus_phage	50.8	3.9e-50
WP_000074682.1|1390691_1390883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141558559.1|1391215_1391422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050842994.1|1391460_1391583_+	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_050842995.1|1391896_1392379_+	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	82.5	1.9e-71
WP_050842997.1|1392378_1392921_+|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	91.1	1.5e-88
WP_050843000.1|1393131_1393350_+	hypothetical protein	NA	H0USV5	Bacillus_phage	64.9	3.4e-20
WP_050843002.1|1393788_1393977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050843004.1|1394043_1394919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050844811.1|1395016_1395319_+	hypothetical protein	NA	A0A0S2MVB8	Bacillus_phage	53.0	2.0e-18
WP_050843006.1|1395305_1395518_+	hypothetical protein	NA	H0USV9	Bacillus_phage	95.7	1.3e-29
WP_050843008.1|1395654_1395909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050843010.1|1395901_1396255_+	hypothetical protein	NA	Q2I8B8	Bacillus_phage	69.1	8.8e-18
WP_050843012.1|1396615_1396843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050843014.1|1396845_1397181_+	HNH endonuclease	NA	D2XR61	Bacillus_phage	95.5	1.0e-55
WP_050843017.1|1397333_1397690_+	hypothetical protein	NA	A0A2H4JBV9	uncultured_Caudovirales_phage	99.2	7.9e-59
WP_050843019.1|1397686_1399342_+|terminase	terminase large subunit	terminase	A0A2H4JI41	uncultured_Caudovirales_phage	96.0	0.0e+00
WP_050843021.1|1399346_1400513_+|portal	phage portal protein	portal	A0A2H4JBZ5	uncultured_Caudovirales_phage	92.7	1.4e-200
WP_050843023.1|1400496_1401279_+|protease	Clp protease ClpP	protease	A0A0A7RWX3	Clostridium_phage	58.1	1.5e-57
WP_050843024.1|1401282_1402434_+|capsid	phage major capsid protein	capsid	A0A2H4JHU0	uncultured_Caudovirales_phage	96.6	7.2e-210
WP_050843026.1|1402439_1402733_+	hypothetical protein	NA	D2XR19	Bacillus_phage	91.8	7.0e-45
WP_030028310.1|1402734_1403088_+|head	phage head closure protein	head	A0A2H4JGG7	uncultured_Caudovirales_phage	96.6	4.6e-59
WP_050843028.1|1403089_1403434_+	HK97 gp10 family phage protein	NA	D2XR21	Bacillus_phage	93.8	3.1e-52
WP_050843030.1|1403430_1403760_+	hypothetical protein	NA	D2XR22	Bacillus_phage	95.4	7.1e-54
WP_016124651.1|1403760_1404357_+|tail	phi13 family phage major tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	96.0	6.9e-108
WP_050843032.1|1404361_1404724_+	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	83.3	1.1e-52
WP_050843034.1|1404954_1408575_+	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	91.3	1.5e-197
WP_050843037.1|1408616_1410092_+|tail	phage tail family protein	tail	A0A0S2MV63	Bacillus_phage	80.2	6.1e-238
WP_050843039.1|1410088_1414180_+	hypothetical protein	NA	A0A0A7AQG2	Bacillus_phage	67.5	0.0e+00
WP_050843041.1|1414469_1414778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050843043.1|1414978_1415203_+	hypothetical protein	NA	A0A1B1P780	Bacillus_phage	89.2	1.5e-26
WP_050843045.1|1415279_1415714_+|holin	phage holin family protein	holin	A0A1B1P787	Bacillus_phage	97.8	7.9e-69
WP_050843047.1|1415703_1416636_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MVR5	Bacillus_phage	86.8	2.0e-162
WP_050843049.1|1416809_1417106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015001260.1|1417221_1417557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050843051.1|1417959_1418226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050843053.1|1418241_1418433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043936107.1|1418941_1419391_+	DUF3888 domain-containing protein	NA	NA	NA	NA	NA
WP_029441815.1|1419842_1421159_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_000116158.1|1421455_1421599_+	YezD family protein	NA	NA	NA	NA	NA
WP_000959018.1|1421686_1422391_+	phosphoadenylyl-sulfate reductase	NA	NA	NA	NA	NA
WP_029441816.1|1422429_1423566_+	sulfate adenylyltransferase	NA	A0A2K9L0F0	Tupanvirus	29.9	2.1e-44
WP_029441817.1|1423578_1424190_+	adenylyl-sulfate kinase	NA	NA	NA	NA	NA
1424301:1424322	attL	ACTGATTAAAGTTTCACTTTAT	NA	NA	NA	NA
WP_048563675.1|1424338_1425961_+	ferredoxin--nitrite reductase	NA	NA	NA	NA	NA
WP_000366918.1|1425970_1426171_+	DUF3906 family protein	NA	NA	NA	NA	NA
WP_043936111.1|1426255_1427032_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_016082317.1|1427033_1427789_+	sirohydrochlorin chelatase	NA	NA	NA	NA	NA
WP_029441820.1|1427763_1428378_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_043936112.1|1428802_1430158_+	sodium-dependent transporter	NA	NA	NA	NA	NA
WP_029441822.1|1430451_1431726_-	M23 family metallopeptidase	NA	A0A2D0ZM66	Rhodococcus_phage	36.5	2.0e-11
WP_016082313.1|1432220_1433495_+	glutamate/aspartate:proton symporter GltP	NA	NA	NA	NA	NA
WP_050843055.1|1433563_1434082_+	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_016082311.1|1434403_1435720_+	Na+/H+ antiporter NhaC family protein	NA	NA	NA	NA	NA
WP_000808640.1|1435902_1436259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000814127.1|1436306_1436969_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_029441825.1|1437076_1437817_+	cell wall-active antibiotics response protein	NA	NA	NA	NA	NA
WP_016082309.1|1437816_1438872_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_016082308.1|1438868_1439501_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_141542533.1|1439583_1439922_+	DUF3992 domain-containing protein	NA	NA	NA	NA	NA
WP_016082307.1|1439946_1441302_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_000880630.1|1441889_1442099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050843059.1|1442139_1442916_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_050843061.1|1443024_1443876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016082303.1|1444071_1444269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016082302.1|1444419_1445517_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_048563669.1|1445631_1446150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048563668.1|1446309_1447518_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_016082299.1|1447550_1448063_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_000883009.1|1448233_1448461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000455762.1|1448754_1449555_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_000380276.1|1449672_1450671_-	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_000231445.1|1450682_1451303_-	DUF47 domain-containing protein	NA	NA	NA	NA	NA
WP_016082298.1|1451614_1453657_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_016082297.1|1453736_1454165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155417053.1|1454360_1455668_-	Gly-Xaa-Xaa repeat protein	NA	NA	NA	NA	NA
WP_050843065.1|1455894_1457160_-	PAS domain-containing protein	NA	W8CYF6	Bacillus_phage	24.1	2.3e-15
WP_016082293.1|1457299_1458145_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_029441834.1|1458360_1458555_-	DUF3924 domain-containing protein	NA	NA	NA	NA	NA
WP_000806236.1|1458676_1459207_-|integrase	tyrosine-type recombinase/integrase	integrase	A3F636	Streptococcus_phage	39.4	1.1e-24
1461302:1461323	attR	ACTGATTAAAGTTTCACTTTAT	NA	NA	NA	NA
>prophage 4
NZ_CP012099	Bacillus thuringiensis strain HS18-1, complete genome	5292526	1885952	1895665	5292526		Bacillus_phage(71.43%)	10	NA	NA
WP_050843302.1|1885952_1887245_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	30.6	3.8e-10
WP_001194305.1|1887343_1888108_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016082006.1|1888348_1890109_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	98.4	8.2e-274
WP_000612415.1|1890194_1890872_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	99.6	3.0e-123
WP_050843303.1|1890868_1891942_+	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	96.1	5.3e-183
WP_002162839.1|1891965_1892556_-	DUF3139 domain-containing protein	NA	NA	NA	NA	NA
WP_000818985.1|1892746_1893466_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_000579239.1|1893614_1894286_+	O-methyltransferase	NA	W8CYT3	Bacillus_phage	92.0	5.3e-64
WP_016082003.1|1894339_1894705_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_048564711.1|1894792_1895665_+	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	45.5	1.9e-66
>prophage 5
NZ_CP012099	Bacillus thuringiensis strain HS18-1, complete genome	5292526	2467518	2533550	5292526	protease,capsid,bacteriocin,portal,tail,terminase,integrase,head,tRNA	Bacillus_phage(67.44%)	73	2506931:2506946	2513027:2513042
WP_029442384.1|2467518_2469072_+|tRNA	lysine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_016081517.1|2469131_2469560_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_029442385.1|2469710_2470625_+	acetamidase/formamidase family protein	NA	NA	NA	NA	NA
WP_050843688.1|2470752_2471460_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_016081515.1|2471456_2472434_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_029442386.1|2472643_2473543_+	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	33.7	3.4e-05
WP_050843691.1|2473617_2474607_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_050844837.1|2475123_2476752_+	ABC-F type ribosomal protection protein	NA	A0A1B0RXA0	Streptococcus_phage	35.0	9.3e-54
WP_029442389.1|2476772_2477366_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_048564795.1|2477890_2478385_+	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_016081509.1|2478700_2479471_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.9	3.6e-32
WP_050843692.1|2479445_2481377_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_050844838.1|2481445_2482117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001165517.1|2482193_2482535_-	DUF3914 domain-containing protein	NA	NA	NA	NA	NA
WP_043937204.1|2482813_2484055_+	lipase	NA	NA	NA	NA	NA
WP_029442394.1|2484143_2485169_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_016081504.1|2485258_2486707_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_050844847.1|2486711_2487626_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_016081502.1|2487932_2488622_+	thiaminase II	NA	NA	NA	NA	NA
WP_029442397.1|2489076_2489340_+	DUF3937 domain-containing protein	NA	NA	NA	NA	NA
WP_048564718.1|2489890_2490220_+|bacteriocin	heterocycloanthracin/sonorensin family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_050843695.1|2490713_2491199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050843696.1|2491507_2492209_+	DUF3962 domain-containing protein	NA	NA	NA	NA	NA
WP_050843698.1|2492247_2493357_-|integrase	site-specific integrase	integrase	A0A0U3U8Y8	Bacillus_phage	79.1	2.9e-147
WP_050843700.1|2493765_2494098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050843702.1|2494153_2496055_-	DEAD/DEAH box helicase	NA	Q5YA94	Bacillus_phage	23.9	2.6e-15
WP_050843704.1|2496564_2497716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050843706.1|2497753_2497900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000491236.1|2498224_2498578_-	helix-turn-helix transcriptional regulator	NA	A0A0U3SD25	Bacillus_phage	86.2	2.1e-48
WP_000854271.1|2498778_2498970_+	helix-turn-helix transcriptional regulator	NA	A0A0U3SLC2	Bacillus_phage	85.2	8.3e-23
WP_000522030.1|2499026_2499293_+	helix-turn-helix domain-containing protein	NA	A0A0U3ULL9	Bacillus_phage	94.1	2.9e-37
WP_050843710.1|2499514_2500567_+	DnaD domain protein	NA	W8CYG5	Bacillus_phage	41.2	1.5e-57
WP_050843712.1|2500570_2500849_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	59.3	2.3e-13
WP_001125949.1|2500841_2501201_+	hypothetical protein	NA	A0A1B1P7A1	Bacillus_phage	51.7	2.7e-30
WP_000717826.1|2501219_2501387_+	DUF3954 domain-containing protein	NA	A0A1B0T6B8	Bacillus_phage	62.3	1.4e-13
WP_025709558.1|2501413_2501665_+	hypothetical protein	NA	A0A0K2CNP4	Brevibacillus_phage	45.3	7.6e-08
WP_050843714.1|2501684_2502140_+	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A0U4IBD0	Bacillus_phage	50.9	6.9e-23
WP_050843716.1|2502360_2503086_-	collagen-like protein	NA	A0A288WFW9	Bacillus_phage	39.8	8.7e-20
WP_155417061.1|2503352_2504141_-	glycosyltransferase family 2 protein	NA	A0A1V0SJD8	Klosneuvirus	31.6	2.7e-19
WP_050843721.1|2504356_2505145_-	RNA methyltransferase	NA	A0A288WG17	Bacillus_phage	72.3	1.9e-105
WP_050843723.1|2505301_2505640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050843725.1|2505874_2506234_-	cell division protein DivIVC	NA	NA	NA	NA	NA
2506931:2506946	attL	GGAGGATGAATGATGG	NA	NA	NA	NA
WP_050843728.1|2507147_2507426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050843730.1|2507469_2507991_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_050843733.1|2508212_2508410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050843737.1|2508724_2509207_+	ArpU family transcriptional regulator	NA	W8CYU4	Bacillus_phage	82.5	2.1e-70
WP_050843739.1|2509206_2509749_+|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	91.1	1.2e-87
WP_050843740.1|2510453_2510909_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_050843742.1|2511237_2511915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050843744.1|2512301_2512535_+	hypothetical protein	NA	A0A0K2CZF4	Paenibacillus_phage	40.3	3.3e-05
WP_050843746.1|2512531_2512912_-	DUF2513 domain-containing protein	NA	A0A1Q1PVT8	Staphylococcus_phage	46.1	2.7e-20
WP_050843748.1|2513207_2513423_+	hypothetical protein	NA	H0USV9	Bacillus_phage	88.1	6.9e-26
2513027:2513042	attR	GGAGGATGAATGATGG	NA	NA	NA	NA
WP_050843750.1|2513441_2513696_+	hypothetical protein	NA	A0A0S2GLL6	Bacillus_phage	83.3	3.0e-36
WP_050843752.1|2513685_2514057_+	HNH endonuclease	NA	A0A0S2GLI5	Bacillus_phage	85.4	5.7e-60
WP_080990785.1|2514193_2514697_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4J8E3	uncultured_Caudovirales_phage	99.4	1.1e-87
WP_050843754.1|2514698_2516393_+|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	92.7	6.2e-311
WP_050843756.1|2516581_2517835_+|portal	phage portal protein	portal	A0A2H4J371	uncultured_Caudovirales_phage	95.2	4.2e-232
WP_050843758.1|2517821_2518532_+|protease	Clp protease ClpP	protease	A0A2H4JC29	uncultured_Caudovirales_phage	96.6	1.3e-124
WP_050843760.1|2518569_2519742_+|capsid	phage major capsid protein	capsid	A0A2H4J387	uncultured_Caudovirales_phage	90.3	2.4e-192
WP_050843762.1|2519762_2520050_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	96.8	1.1e-42
WP_050843763.1|2520036_2520360_+|head	phage head closure protein	head	W8CYF9	Bacillus_phage	96.3	2.4e-54
WP_050843765.1|2520352_2520787_+	HK97 gp10 family phage protein	NA	H0USW9	Bacillus_phage	97.9	1.9e-75
WP_050843767.1|2520783_2521143_+	DUF3168 domain-containing protein	NA	H0USX0	Bacillus_phage	95.8	2.7e-59
WP_050843769.1|2521143_2521749_+|tail	phage tail protein	tail	A0A2H4J8F3	uncultured_Caudovirales_phage	85.1	2.7e-91
WP_050843770.1|2521797_2522115_+	hypothetical protein	NA	W8CYN3	Bacillus_phage	89.5	1.6e-47
WP_000344056.1|2522144_2522321_+	hypothetical protein	NA	Q3HL07	Bacillus_phage	67.2	1.4e-13
WP_050843772.1|2522336_2523653_+|tail	phage tail tape measure protein	tail	A0A0S2GLG8	Bacillus_phage	94.6	5.7e-163
WP_050843774.1|2523833_2526452_+|tail	phage tail tape measure protein	tail	A0A288WG88	Bacillus_phage	92.8	2.3e-272
WP_080990786.1|2526466_2527948_+|tail	phage tail protein	tail	A0A0S2GLF9	Bacillus_phage	95.5	3.3e-284
WP_050843776.1|2527944_2531976_+	hypothetical protein	NA	W8CYT7	Bacillus_phage	89.3	0.0e+00
WP_050843778.1|2532013_2532250_+	hypothetical protein	NA	A0A2H4J382	uncultured_Caudovirales_phage	92.3	2.5e-16
WP_000461723.1|2532249_2532489_+	hypothetical protein	NA	A0A0A7AR38	Bacillus_phage	98.7	1.2e-34
WP_050843780.1|2532485_2533550_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7AQV3	Bacillus_phage	93.2	6.6e-194
>prophage 6
NZ_CP012099	Bacillus thuringiensis strain HS18-1, complete genome	5292526	4356460	4364146	5292526		Staphylococcus_phage(16.67%)	9	NA	NA
WP_043938371.1|4356460_4357384_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.5	1.5e-45
WP_043938372.1|4357509_4358445_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.7	9.2e-22
WP_000018029.1|4358446_4359139_-	response regulator transcription factor	NA	B5LWA6	Feldmannia_species_virus	28.8	1.4e-06
WP_001014307.1|4359482_4359677_+	YwbE family protein	NA	NA	NA	NA	NA
WP_043938373.1|4359715_4360915_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.0	8.0e-71
WP_000587818.1|4361209_4361533_+	heme oxygenase	NA	NA	NA	NA	NA
WP_016080128.1|4361605_4362370_-	class B sortase	NA	NA	NA	NA	NA
WP_048563973.1|4362402_4363173_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.3	4.4e-14
WP_016080126.1|4363162_4364146_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.6	3.2e-17
>prophage 1
NZ_CP012100	Bacillus thuringiensis strain HS18-1 plasmid pHS18-1, complete sequence	509170	0	5409	509170		Enterococcus_phage(100.0%)	2	NA	NA
WP_080990931.1|839_2048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050844887.1|2076_5409_+	DUF4145 domain-containing protein	NA	A0A097BY72	Enterococcus_phage	22.6	1.0e-14
>prophage 2
NZ_CP012100	Bacillus thuringiensis strain HS18-1 plasmid pHS18-1, complete sequence	509170	11087	19852	509170		Acidithiobacillus_phage(25.0%)	8	NA	NA
WP_050844895.1|11087_13661_+	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	43.0	2.9e-33
WP_050844897.1|13653_14871_+	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_000516689.1|15291_15612_+	DNA repair protein	NA	NA	NA	NA	NA
WP_000858401.1|15956_16136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050844899.1|16324_18238_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	33.8	1.2e-28
WP_002094269.1|18348_18531_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000468121.1|19180_19504_-	helix-turn-helix transcriptional regulator	NA	A8ATJ9	Listeria_phage	49.3	3.3e-11
WP_050844902.1|19663_19852_+	helix-turn-helix transcriptional regulator	NA	A0A290G4F8	Caldibacillus_phage	50.0	2.0e-08
>prophage 3
NZ_CP012100	Bacillus thuringiensis strain HS18-1 plasmid pHS18-1, complete sequence	509170	25400	32999	509170		Tupanvirus(100.0%)	1	NA	NA
WP_050844908.1|25400_32999_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	27.9	3.0e-163
>prophage 4
NZ_CP012100	Bacillus thuringiensis strain HS18-1 plasmid pHS18-1, complete sequence	509170	37511	80081	509170	transposase	Bacillus_phage(15.38%)	35	NA	NA
WP_050844916.1|37511_38633_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	79.9	4.1e-170
WP_050844918.1|39311_40313_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.5	6.8e-23
WP_050844920.1|40401_41682_-	MFS transporter	NA	NA	NA	NA	NA
WP_050844921.1|42174_43200_+	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_033659598.1|43304_44303_+	5-dehydro-2-deoxygluconokinase	NA	NA	NA	NA	NA
WP_050844923.1|44380_45844_+	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_050844925.1|45998_47933_+	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	NA	NA	NA	NA
WP_050844926.1|48053_48950_+	myo-inosose-2 dehydratase	NA	NA	NA	NA	NA
WP_050844928.1|49078_49966_+	class II aldolase	NA	NA	NA	NA	NA
WP_050844930.1|50029_50821_+	5-deoxy-glucuronate isomerase	NA	NA	NA	NA	NA
WP_014990686.1|50956_51097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050844931.1|52171_52573_+|transposase	IS200/IS605 family transposase	transposase	Q332K6	Clostridium_botulinum_C_phage	71.2	1.5e-50
WP_050844933.1|52578_53658_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1P8DJG9	Virus_Rctr71	39.7	1.7e-19
WP_050844934.1|53839_54229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080990913.1|54531_55020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050844936.1|55391_55766_-	hypothetical protein	NA	D2XQ01	Bacillus_virus	49.6	2.9e-27
WP_050844938.1|55808_56150_-	YolD-like family protein	NA	NA	NA	NA	NA
WP_050844940.1|56146_57412_-	Y-family DNA polymerase	NA	O64031	Bacillus_phage	47.2	6.9e-105
WP_050844942.1|57900_59214_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_050844943.1|59242_60115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050844945.1|60416_61529_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQB7	Streptococcus_phage	45.2	8.8e-80
WP_050844947.1|61540_61939_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	68.2	4.4e-50
WP_050844949.1|62065_62422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050844950.1|62481_62718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050844954.1|66836_67172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050844956.1|67431_67806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050845376.1|68341_68632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050844957.1|69440_71423_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.7	7.9e-15
WP_155417078.1|71547_71703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050844960.1|71699_72815_-	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	55.5	1.3e-110
WP_050844963.1|74031_75120_-	CDP-glucose 4,6-dehydratase	NA	J7Q7J8	Aeropyrum_coil-shaped_virus	25.8	6.7e-16
WP_050844965.1|75148_76108_-	NAD(P)-dependent oxidoreductase	NA	A0A2K9L4U8	Tupanvirus	29.6	2.0e-24
WP_050844967.1|76190_78260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050844969.1|78280_79030_-	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_050844971.1|79679_80081_+|transposase	IS200/IS605 family transposase	transposase	Q332K6	Clostridium_botulinum_C_phage	71.2	3.4e-50
>prophage 5
NZ_CP012100	Bacillus thuringiensis strain HS18-1 plasmid pHS18-1, complete sequence	509170	83894	93216	509170	coat	Catovirus(20.0%)	9	NA	NA
WP_050844975.1|83894_84662_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	32.8	1.1e-07
WP_050844977.1|84666_86070_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_050844979.1|86286_87312_+	polysaccharide biosynthesis protein	NA	A0A2P1ELS8	Moumouvirus	34.2	1.7e-37
WP_050844981.1|87308_88271_+	NAD-dependent epimerase/dehydratase family protein	NA	M1IGU2	Acanthocystis_turfacea_Chlorella_virus	31.8	3.5e-32
WP_050844983.1|88270_89476_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2K9L470	Tupanvirus	34.1	1.3e-47
WP_050844985.1|89497_90472_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_050844987.1|90511_91612_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_050844989.1|91613_92174_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine N-acetyltransferase	NA	NA	NA	NA	NA
WP_050844991.1|92166_93216_+	pseudaminic acid synthase	NA	A0A1B1IVE2	uncultured_Mediterranean_phage	32.0	9.0e-26
>prophage 6
NZ_CP012100	Bacillus thuringiensis strain HS18-1 plasmid pHS18-1, complete sequence	509170	99001	102648	509170		Ostreococcus_tauri_virus(50.0%)	3	NA	NA
WP_050844996.1|99001_100423_+	MBL fold metallo-hydrolase	NA	H8ZJP5	Ostreococcus_tauri_virus	35.6	6.9e-05
WP_050844998.1|100592_101078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048564021.1|101880_102648_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	1.5e-33
>prophage 7
NZ_CP012100	Bacillus thuringiensis strain HS18-1 plasmid pHS18-1, complete sequence	509170	107231	111397	509170		Bacillus_phage(50.0%)	4	NA	NA
WP_050845005.1|107231_108464_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.8	1.2e-18
WP_050845006.1|108468_109161_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_050845008.1|109861_110662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050845010.1|110683_111397_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.5	7.9e-34
>prophage 8
NZ_CP012100	Bacillus thuringiensis strain HS18-1 plasmid pHS18-1, complete sequence	509170	117715	119209	509170		Acinetobacter_phage(100.0%)	1	NA	NA
WP_050845020.1|117715_119209_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	41.0	6.7e-83
>prophage 9
NZ_CP012100	Bacillus thuringiensis strain HS18-1 plasmid pHS18-1, complete sequence	509170	125878	126403	509170		Streptococcus_phage(100.0%)	1	NA	NA
WP_050845035.1|125878_126403_+	GNAT family N-acetyltransferase	NA	D0R097	Streptococcus_phage	56.9	9.3e-56
>prophage 10
NZ_CP012100	Bacillus thuringiensis strain HS18-1 plasmid pHS18-1, complete sequence	509170	134959	149672	509170		Bacillus_phage(50.0%)	15	NA	NA
WP_048564049.1|134959_136075_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.3	1.4e-32
WP_048564050.1|136195_136558_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_050845379.1|136804_137944_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_050845046.1|137924_138647_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.4	9.2e-38
WP_050845048.1|138651_139893_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_050845050.1|139909_140128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050845052.1|140383_140785_-	GtrA family protein	NA	NA	NA	NA	NA
WP_155417081.1|140777_141758_-	glycosyltransferase	NA	M1FQW5	Enterobacteria_phage	41.0	1.2e-59
WP_050845054.1|141771_144036_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_048564056.1|144274_144961_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.6	1.0e-38
WP_050845381.1|144960_146478_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.4	1.8e-27
WP_048564057.1|146753_147248_-	DUF3902 family protein	NA	NA	NA	NA	NA
WP_048564058.1|147928_148126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050845056.1|148161_148617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048564060.1|148877_149672_-	RNA methyltransferase	NA	A0A288WG17	Bacillus_phage	61.1	7.6e-86
>prophage 11
NZ_CP012100	Bacillus thuringiensis strain HS18-1 plasmid pHS18-1, complete sequence	509170	161139	161901	509170		Planktothrix_phage(100.0%)	1	NA	NA
WP_050845382.1|161139_161901_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.0	1.1e-33
>prophage 12
NZ_CP012100	Bacillus thuringiensis strain HS18-1 plasmid pHS18-1, complete sequence	509170	177295	178381	509170		Staphylococcus_phage(100.0%)	1	NA	NA
WP_050845078.1|177295_178381_-	phosphodiester glycosidase family protein	NA	A0A1X9I9K5	Staphylococcus_phage	27.6	3.9e-08
>prophage 13
NZ_CP012100	Bacillus thuringiensis strain HS18-1 plasmid pHS18-1, complete sequence	509170	182751	189780	509170		Bacillus_phage(50.0%)	4	NA	NA
WP_050845083.1|182751_183732_-	alpha/beta hydrolase	NA	A0A1M7XTX4	Cedratvirus	33.3	2.7e-08
WP_050845085.1|183918_185286_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	43.5	1.7e-61
WP_048565621.1|185282_185957_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	57.3	2.1e-68
WP_050845087.1|187359_189780_-	PAS domain S-box protein	NA	A0A2K9L5I4	Tupanvirus	24.5	5.7e-07
>prophage 14
NZ_CP012100	Bacillus thuringiensis strain HS18-1 plasmid pHS18-1, complete sequence	509170	197168	198341	509170	integrase	Bacillus_phage(100.0%)	1	190245:190259	200556:200570
190245:190259	attL	AAAAGTAAGAATCAT	NA	NA	NA	NA
WP_050845091.1|197168_198341_-|integrase	site-specific integrase	integrase	A0A142F1N9	Bacillus_phage	23.7	2.0e-05
WP_050845091.1|197168_198341_-|integrase	site-specific integrase	integrase	A0A142F1N9	Bacillus_phage	23.7	2.0e-05
200556:200570	attR	AAAAGTAAGAATCAT	NA	NA	NA	NA
>prophage 15
NZ_CP012100	Bacillus thuringiensis strain HS18-1 plasmid pHS18-1, complete sequence	509170	212867	213548	509170		Planktothrix_phage(100.0%)	1	NA	NA
WP_048564970.1|212867_213548_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.4	7.4e-21
>prophage 16
NZ_CP012100	Bacillus thuringiensis strain HS18-1 plasmid pHS18-1, complete sequence	509170	219748	220405	509170		Bacillus_phage(100.0%)	1	NA	NA
WP_050845111.1|219748_220405_-	hypothetical protein	NA	A0A223LKM8	Bacillus_phage	32.7	6.4e-14
>prophage 17
NZ_CP012100	Bacillus thuringiensis strain HS18-1 plasmid pHS18-1, complete sequence	509170	225088	225622	509170		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000438330.1|225088_225622_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0F6TH34	Sinorhizobium_phage	25.7	2.0e-05
>prophage 18
NZ_CP012100	Bacillus thuringiensis strain HS18-1 plasmid pHS18-1, complete sequence	509170	229395	230166	509170		Planktothrix_phage(100.0%)	1	NA	NA
WP_050845116.1|229395_230166_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.4	8.0e-32
>prophage 19
NZ_CP012100	Bacillus thuringiensis strain HS18-1 plasmid pHS18-1, complete sequence	509170	238386	239157	509170		Planktothrix_phage(100.0%)	1	NA	NA
WP_050845124.1|238386_239157_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.1	1.5e-33
>prophage 20
NZ_CP012100	Bacillus thuringiensis strain HS18-1 plasmid pHS18-1, complete sequence	509170	246453	249810	509170		Bacillus_phage(50.0%)	2	NA	NA
WP_050845383.1|246453_248055_-	SH3 domain-containing protein	NA	A0A1J0MS59	Bacillus_phage	54.9	3.8e-44
WP_050845130.1|248679_249810_-	serine hydrolase	NA	G1DB24	Mycobacterium_phage	27.9	5.3e-24
>prophage 21
NZ_CP012100	Bacillus thuringiensis strain HS18-1 plasmid pHS18-1, complete sequence	509170	257869	258067	509170		Bacillus_phage(100.0%)	1	NA	NA
WP_043320300.1|257869_258067_-	hypothetical protein	NA	A0A0A0RMG9	Bacillus_phage	45.5	5.6e-06
>prophage 22
NZ_CP012100	Bacillus thuringiensis strain HS18-1 plasmid pHS18-1, complete sequence	509170	262499	265302	509170		Bacillus_phage(66.67%)	3	NA	NA
WP_050845140.1|262499_263261_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.5	2.6e-35
WP_050845141.1|263542_264619_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	28.8	6.4e-19
WP_050845142.1|264615_265302_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.9	6.5e-41
>prophage 23
NZ_CP012100	Bacillus thuringiensis strain HS18-1 plasmid pHS18-1, complete sequence	509170	269662	272139	509170		Bacillus_phage(100.0%)	2	NA	NA
WP_050845146.1|269662_270349_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.7	6.7e-38
WP_050845147.1|270345_272139_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.6	3.3e-28
>prophage 24
NZ_CP012100	Bacillus thuringiensis strain HS18-1 plasmid pHS18-1, complete sequence	509170	275296	284506	509170		Bacillus_phage(50.0%)	7	NA	NA
WP_050845151.1|275296_276703_+	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	31.1	2.3e-56
WP_050845152.1|276755_277895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050845153.1|278017_278515_+	DUF4358 domain-containing protein	NA	NA	NA	NA	NA
WP_050845154.1|279082_280912_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.0	8.5e-48
WP_050845155.1|280904_282668_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	3.1e-39
WP_050845156.1|282793_283417_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_050845384.1|283822_284506_-	GTP pyrophosphokinase family protein	NA	F8K9M7	Nitrososphaera_phage	27.6	4.2e-08
>prophage 25
NZ_CP012100	Bacillus thuringiensis strain HS18-1 plasmid pHS18-1, complete sequence	509170	289257	289647	509170		Bacillus_phage(100.0%)	1	NA	NA
WP_050845386.1|289257_289647_-	hypothetical protein	NA	J9PV28	Bacillus_phage	32.5	7.0e-08
>prophage 26
NZ_CP012100	Bacillus thuringiensis strain HS18-1 plasmid pHS18-1, complete sequence	509170	294421	298307	509170		Bacillus_phage(100.0%)	6	NA	NA
WP_001145517.1|294421_294610_+	hypothetical protein	NA	A0A288WGN0	Bacillus_phage	64.8	1.1e-08
WP_080990921.1|297017_297146_-	Fur-regulated basic protein FbpA	NA	NA	NA	NA	NA
WP_050845163.1|297154_297568_-	hypothetical protein	NA	A0A1C8E9A7	Bacillus_phage	42.3	8.2e-07
WP_000811969.1|297581_297845_-	hypothetical protein	NA	A0A1B1P8A9	Bacillus_phage	57.3	5.9e-19
WP_050845164.1|297841_298087_-	hypothetical protein	NA	A0A1B1P7W1	Bacillus_phage	80.8	2.9e-28
WP_050845165.1|298043_298307_-	hypothetical protein	NA	A0A1B1P8D7	Bacillus_phage	65.5	1.2e-16
>prophage 27
NZ_CP012100	Bacillus thuringiensis strain HS18-1 plasmid pHS18-1, complete sequence	509170	304520	305132	509170		Lactococcus_phage(100.0%)	1	NA	NA
WP_050845167.1|304520_305132_-	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	34.8	2.6e-09
>prophage 28
NZ_CP012100	Bacillus thuringiensis strain HS18-1 plasmid pHS18-1, complete sequence	509170	315342	316314	509170		Cyanophage(100.0%)	1	NA	NA
WP_050845173.1|315342_316314_-	sigma-70 family RNA polymerase sigma factor	NA	M4SMP8	Cyanophage	27.7	1.5e-14
>prophage 29
NZ_CP012100	Bacillus thuringiensis strain HS18-1 plasmid pHS18-1, complete sequence	509170	337202	338612	509170		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000413550.1|337202_338612_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	29.2	4.4e-44
>prophage 30
NZ_CP012100	Bacillus thuringiensis strain HS18-1 plasmid pHS18-1, complete sequence	509170	345673	348214	509170		Streptococcus_phage(100.0%)	1	NA	NA
WP_050845186.1|345673_348214_+	DUF87 domain-containing protein	NA	A0A1S5SF64	Streptococcus_phage	36.7	2.4e-141
>prophage 31
NZ_CP012100	Bacillus thuringiensis strain HS18-1 plasmid pHS18-1, complete sequence	509170	352895	357547	509170		Pseudomonas_phage(33.33%)	5	NA	NA
WP_050845189.1|352895_354692_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.1	3.1e-34
WP_050845391.1|354757_355402_+	C40 family peptidase	NA	A0A1S5SEZ8	Streptococcus_phage	48.1	4.8e-46
WP_050845190.1|355453_356050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001014800.1|356590_356797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000742851.1|356938_357547_+	DUF4352 domain-containing protein	NA	A0A1B1P898	Bacillus_phage	91.6	4.5e-62
>prophage 32
NZ_CP012100	Bacillus thuringiensis strain HS18-1 plasmid pHS18-1, complete sequence	509170	364629	366616	509170		Streptococcus_phage(50.0%)	3	NA	NA
WP_050845198.1|364629_365100_+	DUF4429 domain-containing protein	NA	A0A1S5S992	Streptococcus_phage	41.6	2.1e-06
WP_050845199.1|365220_365772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050845200.1|365911_366616_+	DUF4352 domain-containing protein	NA	A0A1B1P898	Bacillus_phage	89.6	6.0e-58
>prophage 33
NZ_CP012100	Bacillus thuringiensis strain HS18-1 plasmid pHS18-1, complete sequence	509170	373245	437797	509170	transposase,portal,terminase	Bacillus_phage(41.67%)	65	NA	NA
WP_033681089.1|373245_373647_+|transposase	IS200/IS605 family transposase	transposase	Q332K6	Clostridium_botulinum_C_phage	72.0	3.1e-51
WP_050845212.1|373652_374732_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1P8DJG9	Virus_Rctr71	40.2	1.5e-20
WP_050845214.1|374874_375144_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_050845215.1|376048_376234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050845217.1|376449_376923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050845219.1|377232_378030_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A141HRV8	Bacillus_phage	39.7	1.7e-29
WP_000467343.1|378427_378649_-	helix-turn-helix transcriptional regulator	NA	A0A0S2GLH4	Bacillus_phage	45.2	1.1e-10
WP_001214903.1|378938_379259_+	hypothetical protein	NA	A0A0S2GLK1	Bacillus_phage	62.1	1.5e-29
WP_050845220.1|379269_380436_+	DNA translocase FtsK	NA	W8CYG2	Bacillus_phage	78.9	3.3e-178
WP_050845392.1|380458_381034_+	hypothetical protein	NA	W8CZ47	Bacillus_phage	75.1	9.7e-83
WP_050845222.1|381338_381695_+	YxeA family protein	NA	NA	NA	NA	NA
WP_050845224.1|382111_382759_+	hypothetical protein	NA	A0A223LKM8	Bacillus_phage	32.6	2.0e-15
WP_050845393.1|383059_384523_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	28.2	1.3e-22
WP_050845226.1|384536_385202_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.2	8.8e-35
WP_050845229.1|386142_387336_+	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	31.9	4.3e-24
WP_050845230.1|387819_389247_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000447838.1|389258_389945_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	1.3e-25
WP_000762752.1|390304_390703_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	68.9	3.1e-51
WP_050844945.1|390714_391827_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQB7	Streptococcus_phage	45.2	8.8e-80
WP_050845234.1|392928_393831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016513574.1|394044_394521_+	GNAT family N-acetyltransferase	NA	E9LUK4	Lactobacillus_phage	44.7	1.6e-30
WP_050845236.1|395232_396561_+	nucleotide sugar dehydrogenase	NA	A7IWZ0	Paramecium_bursaria_Chlorella_virus	30.4	8.1e-40
WP_050845238.1|396569_397727_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2P1ELT3	Moumouvirus	33.1	5.8e-42
WP_050845240.1|397733_398657_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A0E3FNQ3	Synechococcus_phage	31.6	3.5e-26
WP_050845243.1|398631_399873_+	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A2P1ELT3	Moumouvirus	39.9	4.5e-16
WP_050845244.1|399884_400766_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_050845245.1|400769_401459_+	WbqC family protein	NA	NA	NA	NA	NA
WP_025118686.1|401465_402143_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_050845394.1|402154_403090_+	endonuclease	NA	NA	NA	NA	NA
WP_050845246.1|403222_404596_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_050845248.1|404704_405979_+	MFS transporter	NA	NA	NA	NA	NA
WP_050845251.1|406151_406619_-	RsfA family transcriptional regulator	NA	NA	NA	NA	NA
WP_050845253.1|406847_407255_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000787553.1|407244_407658_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_050845255.1|408062_409805_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	23.8	1.0e-05
WP_048564930.1|409963_410179_+	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	70.1	3.7e-19
WP_048564931.1|410326_410719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050845259.1|411958_412540_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_050845261.1|412812_414072_+	MFS transporter	NA	NA	NA	NA	NA
WP_050845263.1|414171_415245_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_050845265.1|415296_416235_+	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	33.1	5.9e-29
WP_050845267.1|417760_420124_+	S8 family serine peptidase	NA	G1FGA4	Mycobacterium_phage	48.9	7.5e-12
WP_050845268.1|420979_421384_-	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_000631352.1|422236_422530_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_050845270.1|423592_424237_-	helix-turn-helix domain-containing protein	NA	A0A2H4J245	uncultured_Caudovirales_phage	34.3	1.8e-29
WP_000549412.1|424374_424581_+	transcriptional regulator	NA	W8CYN7	Bacillus_phage	51.7	1.8e-10
WP_050845271.1|425099_425384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050845273.1|425463_426228_+	replication protein	NA	A0A1W6JNI1	Staphylococcus_phage	49.6	2.7e-56
WP_098868660.1|426211_426994_+	AAA family ATPase	NA	U5PWH5	Bacillus_phage	35.6	5.7e-33
WP_050845277.1|427230_427845_+	hypothetical protein	NA	X2JKZ4	Bacillus_phage	29.6	6.9e-10
WP_080990927.1|427849_428026_+	Fur-regulated basic protein FbpA	NA	NA	NA	NA	NA
WP_000931950.1|428103_428475_+	hypothetical protein	NA	A0A0M4R397	Bacillus_phage	42.1	7.8e-17
WP_001205173.1|428755_429256_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0A7AQW8	Bacillus_phage	60.4	9.8e-47
WP_000892959.1|429488_429674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113634.1|429691_430183_+	hypothetical protein	NA	A0A1B0XTP0	Freshwater_phage	22.8	1.8e-05
WP_050845279.1|430363_431620_+|terminase	phage terminase large subunit	terminase	A0A2H4J7G6	uncultured_Caudovirales_phage	51.1	1.3e-111
WP_050845280.1|431713_433054_+|portal	phage portal protein	portal	A0A222YY66	Streptomyces_phage	29.3	4.5e-46
WP_050845282.1|433082_434273_+	hypothetical protein	NA	A0A1B1P7E4	Bacillus_phage	31.1	5.4e-35
WP_001060157.1|434293_435274_+	hypothetical protein	NA	H7BVA6	unidentified_phage	41.6	1.6e-69
WP_000691127.1|435290_435455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000406978.1|435468_436002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000392019.1|436030_436357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002153798.1|436358_436775_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_000208342.1|436771_437188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000118565.1|437200_437797_+	hypothetical protein	NA	A0A1S5S9Y8	Streptococcus_phage	30.3	1.0e-13
>prophage 34
NZ_CP012100	Bacillus thuringiensis strain HS18-1 plasmid pHS18-1, complete sequence	509170	443794	447667	509170		Brevibacillus_phage(100.0%)	4	NA	NA
WP_050845295.1|443794_444169_+	hypothetical protein	NA	A0A0K2CPR2	Brevibacillus_phage	38.5	8.7e-16
WP_050845297.1|444181_444559_+	hypothetical protein	NA	A0A0K2CPN7	Brevibacillus_phage	37.5	2.8e-22
WP_050845299.1|444572_445916_+	hypothetical protein	NA	A0A0K2CP42	Brevibacillus_phage	35.0	2.3e-74
WP_050845301.1|445930_447667_+	hypothetical protein	NA	A0A0K2CNY7	Brevibacillus_phage	43.9	8.8e-127
>prophage 35
NZ_CP012100	Bacillus thuringiensis strain HS18-1 plasmid pHS18-1, complete sequence	509170	451948	453904	509170		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_050845395.1|451948_453904_+	hypothetical protein	NA	A0A2H4J270	uncultured_Caudovirales_phage	39.9	1.6e-15
>prophage 36
NZ_CP012100	Bacillus thuringiensis strain HS18-1 plasmid pHS18-1, complete sequence	509170	457094	465119	509170	holin	uncultured_Caudovirales_phage(40.0%)	8	NA	NA
WP_050845305.1|457094_459029_+	hypothetical protein	NA	A0A0K2CPP1	Brevibacillus_phage	29.7	1.8e-43
WP_050845308.1|459041_459422_+	hypothetical protein	NA	G3MAB0	Bacillus_virus	33.0	7.8e-12
WP_050845310.1|459437_460376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050845397.1|460454_460772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050845313.1|460844_461333_+|holin	holin	holin	A0A0M4R5G6	Bacillus_phage	39.0	1.8e-21
WP_050845316.1|461616_462456_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4J966	uncultured_Caudovirales_phage	71.0	4.1e-114
WP_050845318.1|462833_463595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080990935.1|464018_465119_+	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	48.5	7.6e-92
>prophage 37
NZ_CP012100	Bacillus thuringiensis strain HS18-1 plasmid pHS18-1, complete sequence	509170	472914	474333	509170		Bacillus_virus(100.0%)	1	NA	NA
WP_050845330.1|472914_474333_+	glucosaminidase	NA	G3MAW8	Bacillus_virus	41.6	3.5e-25
>prophage 38
NZ_CP012100	Bacillus thuringiensis strain HS18-1 plasmid pHS18-1, complete sequence	509170	478193	480020	509170		Hokovirus(100.0%)	1	NA	NA
WP_050845343.1|478193_480020_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1V0SGM7	Hokovirus	27.5	2.4e-34
>prophage 39
NZ_CP012100	Bacillus thuringiensis strain HS18-1 plasmid pHS18-1, complete sequence	509170	483078	483390	509170		uncultured_virus(100.0%)	1	NA	NA
WP_050845349.1|483078_483390_+	winged helix-turn-helix transcriptional regulator	NA	A0A218MNF3	uncultured_virus	43.1	1.6e-07
>prophage 40
NZ_CP012100	Bacillus thuringiensis strain HS18-1 plasmid pHS18-1, complete sequence	509170	492036	494122	509170		Bacillus_phage(50.0%)	3	NA	NA
WP_050845355.1|492036_492309_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	68.9	2.6e-25
WP_050845356.1|492443_492809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050845357.1|493699_494122_+	HD domain-containing protein	NA	A0A060QNR4	Streptococcus_phage	63.4	9.1e-38
>prophage 1
NZ_CP012101	Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence	337579	46758	118660	337579	bacteriocin,transposase	Bacillus_phage(46.67%)	51	NA	NA
WP_050845422.1|46758_47445_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	59.1	7.8e-71
WP_050845423.1|48021_49350_+	magnesium transporter	NA	NA	NA	NA	NA
WP_050845424.1|49748_52439_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	23.9	7.4e-40
WP_050845425.1|52638_52989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000204906.1|53812_54106_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_050845426.1|54342_54621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050845427.1|55549_55942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050845428.1|55941_57027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050845597.1|57026_57692_-	hypothetical protein	NA	S5VKI3	Leptospira_phage	44.2	5.9e-39
WP_050845429.1|58397_59105_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.0	1.4e-43
WP_050845430.1|59278_61687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050845432.1|64576_64828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050845433.1|66108_67608_+	phosphatidylinositol-specific phospholipase C domain-containing protein	NA	NA	NA	NA	NA
WP_050845422.1|67706_68393_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	59.1	7.8e-71
WP_050845435.1|69357_70302_-	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_050845436.1|70319_72275_-	PTS mannose transporter subunit IIABC	NA	NA	NA	NA	NA
WP_050845437.1|72424_74371_-	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_050845438.1|74698_75148_-	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080990938.1|76080_76641_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_050845440.1|77004_78006_-	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_155417091.1|79288_79450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050845441.1|79534_80146_-	hypothetical protein	NA	W8CZ47	Bacillus_phage	74.3	8.5e-85
WP_050845442.1|80135_81302_-	DNA translocase FtsK	NA	W8CYG2	Bacillus_phage	83.0	3.2e-189
WP_000958230.1|81314_81509_-	hypothetical protein	NA	W8CYN5	Bacillus_phage	56.2	2.7e-13
WP_000264559.1|81728_81959_+	XRE family transcriptional regulator	NA	A0A1B1P883	Bacillus_phage	41.5	5.9e-07
WP_000424048.1|82081_82318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050845443.1|83025_85002_-	DUF3472 domain-containing protein	NA	G1FGA4	Mycobacterium_phage	40.7	1.2e-07
WP_050845444.1|85335_86142_-	acetyltransferase	NA	NA	NA	NA	NA
WP_000864835.1|86465_86867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050845445.1|89540_90584_+	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_050845447.1|92630_93791_+	HBL/NHE enterotoxin family protein	NA	NA	NA	NA	NA
WP_050845448.1|93845_95048_+	HBL/NHE enterotoxin family protein	NA	NA	NA	NA	NA
WP_050845449.1|95153_96965_+	HBL/NHE enterotoxin family protein	NA	Q38196	Clostridium_botulinum_phage	36.5	1.4e-05
WP_050845450.1|97478_99341_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_050845451.1|99357_100119_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.5	2.6e-35
WP_050845452.1|100398_101475_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.3	6.8e-21
WP_050845453.1|101471_102158_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.2	1.4e-40
WP_050845454.1|103541_104381_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_050845455.1|104911_106342_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_050845598.1|106795_107200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050845456.1|107760_108057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080990940.1|108448_108559_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_050845457.1|111198_111933_+	ribonuclease	NA	NA	NA	NA	NA
WP_048565606.1|112136_112346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000571721.1|112416_112605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050845458.1|112690_112891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050845459.1|113697_115011_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_050845460.1|115003_117220_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	30.7	5.3e-52
WP_050845461.1|117272_117842_-	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_080990941.1|118259_118427_-|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_050845462.1|118468_118660_-|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
>prophage 2
NZ_CP012101	Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence	337579	243577	297186	337579	transposase,integrase	Bacillus_phage(41.67%)	27	243522:243581	299257:299470
243522:243581	attL	GTGAACTGCACCCCAATTGTTAGACACAGTCTAACAATTGGAGGTGCAGTTTTTCTATGG	NA	NA	NA	NA
WP_098630116.1|243577_244931_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	85.5	7.3e-129
WP_050845545.1|246682_249289_+	S-layer protein	NA	NA	NA	NA	NA
WP_050845546.1|249393_252144_+	S8 family serine peptidase	NA	Q2A0D0	Sodalis_phage	30.2	2.4e-17
WP_050845547.1|253206_253416_-	preprotein translocase	NA	NA	NA	NA	NA
WP_050845548.1|253599_254523_+	collagen-like protein	NA	NA	NA	NA	NA
WP_050845549.1|255068_256280_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.7	1.3e-65
WP_050845550.1|257767_258673_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_155417072.1|258739_260094_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	84.8	1.8e-127
WP_050845551.1|261163_261394_-	XRE family transcriptional regulator	NA	S5MBY6	Brevibacillus_phage	43.2	2.1e-12
WP_050845552.1|262071_262605_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_050845553.1|262594_263425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050845554.1|263436_265188_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_050845555.1|270140_272387_+	chitin-binding protein	NA	NA	NA	NA	NA
WP_050845556.1|273253_273823_-	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	37.9	4.9e-26
WP_080990950.1|274138_275575_+	exosporium leader peptide-containing protein	NA	NA	NA	NA	NA
WP_050845558.1|278896_279952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050845559.1|280039_280462_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_050845560.1|280767_281073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000651002.1|281076_281283_+	helix-turn-helix transcriptional regulator	NA	A0A1V0E021	Clostridioides_phage	80.9	2.0e-22
WP_050845561.1|283020_284232_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	38.0	7.1e-67
WP_080990956.1|286546_286795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050845565.1|286902_287616_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_050845566.1|288481_289180_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.7	3.9e-41
WP_050845567.1|289172_290279_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	26.8	3.0e-19
WP_050845568.1|290361_291222_+	VanY-A/VanY-F/VanY-M family D-Ala-D-Ala carboxypeptidase	NA	NA	NA	NA	NA
WP_050845571.1|295608_295890_+	hypothetical protein	NA	A0A0S2GLD3	Bacillus_phage	91.4	1.3e-40
WP_050845601.1|296724_297186_+|integrase	tyrosine-type recombinase/integrase	integrase	W8CYP1	Bacillus_phage	71.1	4.2e-52
299257:299470	attR	CCATAGAAAAACTGCACCTCCAATTGTTAGACTGTGTCTAACAATTGGGGTGCAGTTCACAATAAAGTCCTATACATACATATATCATTGTATGAGATAAATCTTAACGAATTATTTCGTAAAAAAACCAGTTACGGGATCTCAATGATTATTAGGTTTATTATTATCGCGATGGAAGGTTATATTTTTTTTGCAGATACATTTTTTTGTCCAG	NA	NA	NA	NA
>prophage 1
NZ_CP012102	Bacillus thuringiensis strain HS18-1 plasmid pHS18-3, complete sequence	92085	31535	43778	92085	transposase	Bacillus_phage(55.56%)	12	NA	NA
WP_013450092.1|31535_32357_+	ParA family protein	NA	F0PIG8	Enterococcus_phage	44.6	9.7e-52
WP_013450093.1|32358_32733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050845625.1|33105_33405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050845627.1|35207_35816_-	hypothetical protein	NA	W8CZ47	Bacillus_phage	76.1	6.2e-88
WP_050845628.1|35805_36972_-	DNA translocase FtsK	NA	W8CYG2	Bacillus_phage	80.9	8.6e-187
WP_050845629.1|36983_37178_-	hypothetical protein	NA	A0A1B1P7T1	Bacillus_phage	57.8	7.9e-13
WP_050845630.1|37405_37627_+	helix-turn-helix domain-containing protein	NA	A0A0S2GLH4	Bacillus_phage	74.0	9.3e-26
WP_050845631.1|38072_38762_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.1	4.2e-40
WP_013450103.1|39124_39352_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_050845632.1|39354_41502_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	28.2	3.2e-38
WP_050845633.1|41482_42913_+	S8 family serine peptidase	NA	A0A2H4PQH1	Staphylococcus_phage	30.2	1.1e-39
WP_050845634.1|43094_43778_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	37.7	1.2e-39
>prophage 1
NZ_CP012104	Bacillus thuringiensis strain HS18-1 plasmid pHS18-5, complete sequence	42726	3655	41689	42726	tail,terminase,bacteriocin,portal,head	Bacillus_phage(52.63%)	55	NA	NA
WP_050845737.1|3655_4489_-	N-acetylmuramoyl-L-alanine amidase	NA	A7KV11	Bacillus_phage	77.6	1.3e-88
WP_050845738.1|4488_4716_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A1B1P7Q9	Bacillus_phage	81.6	9.6e-26
WP_050845739.1|4755_5205_-	hypothetical protein	NA	A0A2H4J980	uncultured_Caudovirales_phage	81.1	8.5e-50
WP_050845740.1|5191_5374_-	hypothetical protein	NA	A0A2H4JAY5	uncultured_Caudovirales_phage	83.3	1.5e-21
WP_050845741.1|5373_7437_-	hypothetical protein	NA	A0A2H4JG80	uncultured_Caudovirales_phage	63.1	2.8e-180
WP_050845742.1|7480_9412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050845743.1|9425_10232_-|tail	phage tail family protein	tail	A0A290FZP5	Caldibacillus_phage	39.0	1.3e-48
WP_050845744.1|10228_12967_-|tail	phage tail tape measure protein	tail	A0A0S2SXL7	Bacillus_phage	39.7	1.8e-86
WP_050845745.1|12966_13242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050845746.1|13265_13676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050845747.1|13678_14206_-|tail	phage tail protein	tail	A0A0C5AMZ4	Paenibacillus_phage	36.1	5.9e-10
WP_050845748.1|14207_14615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050845749.1|14607_15036_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_050845750.1|15019_15337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050845751.1|15333_15675_-|head,tail	phage head-tail connector protein	head,tail	A0A097PAS2	Streptococcus_pyogenes_phage	38.7	2.2e-10
WP_050845752.1|15677_15866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050845753.1|15882_16815_-	hypothetical protein	NA	W0XA97	Pseudomonas_phage	28.0	2.1e-18
WP_050845754.1|16829_17471_-	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_050845787.1|17576_18392_-|head	head morphogenesis protein	head	A0A1S5SBA9	Streptococcus_phage	37.3	6.7e-29
WP_050845755.1|18510_20004_-|portal	phage portal protein	portal	A0A0S2MVB2	Bacillus_phage	32.5	1.3e-46
WP_155417103.1|20015_21275_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0M4R5F3	Bacillus_phage	89.0	9.5e-224
WP_050845757.1|21267_22053_-	hypothetical protein	NA	A0A2P1JTW4	Anoxybacillus_phage	44.7	2.5e-49
WP_050845758.1|22153_22840_-	nucleotide excision repair endonuclease	NA	D2XPX7	Bacillus_virus	37.9	1.3e-44
WP_016136484.1|22852_23437_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	48.6	1.0e-26
WP_050845759.1|23618_23801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080990970.1|24159_24408_-	hypothetical protein	NA	A0A1B1P7Q2	Bacillus_phage	43.1	2.2e-07
WP_050845760.1|24708_25491_-	hypothetical protein	NA	A0A0S2SXZ1	Bacillus_phage	72.8	9.1e-100
WP_050845761.1|26474_26846_-	ArpU family transcriptional regulator	NA	A0A1B1P853	Bacillus_phage	43.2	1.9e-18
WP_050845762.1|27514_27637_-	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_050845763.1|27674_27911_-	hypothetical protein	NA	G9J2B7	Bacillus_phage	58.8	1.4e-19
WP_050845764.1|28165_28474_-	hypothetical protein	NA	A0A0S2MVE9	Bacillus_phage	98.0	8.1e-52
WP_050845765.1|28503_28812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080990968.1|29018_29228_-	hypothetical protein	NA	A0A1B1P8C8	Bacillus_phage	55.2	2.7e-14
WP_050845767.1|29261_29864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050845768.1|29900_30503_-	hypothetical protein	NA	A0A067XQX9	Caulobacter_phage	28.9	8.5e-21
WP_050845769.1|30541_30739_-	hypothetical protein	NA	H0USU7	Bacillus_phage	93.7	2.8e-29
WP_050845770.1|30764_30956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050845771.1|30997_31453_-	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A0U4IBD0	Bacillus_phage	48.6	1.1e-20
WP_050845772.1|31497_31905_-	hypothetical protein	NA	B5LPM7	Bacillus_virus	72.2	5.0e-25
WP_050845773.1|31888_32200_-	hypothetical protein	NA	A0A1B1P8B9	Bacillus_phage	37.9	3.8e-09
WP_050845774.1|32210_32480_-	hypothetical protein	NA	A0A0U3SU43	Bacillus_phage	70.8	2.4e-28
WP_050845775.1|32476_32764_-	hypothetical protein	NA	A0A1B1P7W1	Bacillus_phage	80.0	2.9e-35
WP_050845776.1|32678_32942_-	hypothetical protein	NA	A0A1B1P8D7	Bacillus_phage	77.6	1.1e-20
WP_050845788.1|32954_33836_-	ATP-binding protein	NA	Q2I8C8	Bacillus_phage	55.5	6.5e-86
WP_050845777.1|33786_34569_-	phage replication protein	NA	A0A0M4S6Y4	Bacillus_phage	60.2	2.4e-47
WP_050845778.1|34569_34791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050845779.1|34977_35769_-	hypothetical protein	NA	A0A0A7RVR3	Clostridium_phage	49.2	2.1e-67
WP_050845780.1|35746_36601_-	hypothetical protein	NA	A0A0A7RUE9	Clostridium_phage	58.5	1.8e-80
WP_050845781.1|36797_36998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050845782.1|37223_37418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050845783.1|38417_38684_-	helix-turn-helix transcriptional regulator	NA	B5LPU7	Bacillus_virus	93.7	9.5e-33
WP_001052323.1|38911_39256_+	helix-turn-helix transcriptional regulator	NA	D2XQ11	Bacillus_virus	96.5	2.3e-55
WP_155417102.1|39522_39675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050845784.1|39707_40850_-	hypothetical protein	NA	D2XQ10	Bacillus_virus	57.1	1.2e-116
WP_050845785.1|41344_41689_+	helix-turn-helix transcriptional regulator	NA	A0A1B1P888	Bacillus_phage	62.2	1.1e-33
