The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012126	Escherichia coli strain DH1Ec104 chromosome, complete genome	4612363	247636	297519	4612363	integrase,transposase	Streptococcus_phage(20.0%)	47	262122:262181	297629:297688
WP_000006255.1|247636_248134_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001334802.1|248357_250097_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_000207552.1|250041_250827_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|250897_251953_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|252004_252298_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263489.1|252300_252699_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059892.1|252708_253161_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001292994.1|254258_255716_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|255976_256435_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189532.1|256526_257771_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174689.1|257828_258230_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749863.1|258268_259324_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|259611_260715_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|260726_261980_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
262122:262181	attL	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
WP_000854672.1|262551_262893_-	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_000070395.1|262913_263231_-	type IV toxin-antitoxin system antitoxin YafW	NA	NA	NA	NA	NA
WP_000691994.1|263249_263471_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_000811693.1|263479_263956_-	RadC family protein	NA	NA	NA	NA	NA
WP_000211838.1|263971_264430_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
WP_000194654.1|264527_264767_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001547765.1|264843_265311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824223.1|265333_265777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001548158.1|265776_266004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000197389.1|266407_267229_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.4	7.2e-47
WP_001065553.1|267320_268184_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000770246.1|268512_269406_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001254938.1|269826_270978_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
WP_010723085.1|273324_274341_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001393629.1|274548_275952_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081351.1|275938_276871_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_000192349.1|276979_278026_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_001030800.1|279608_279959_-	type IV toxin-antitoxin system antitoxin YagB	NA	NA	NA	NA	NA
WP_010723086.1|280052_281207_-|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
WP_001136613.1|281501_282410_+	2-keto-3-deoxygluconate aldolase	NA	NA	NA	NA	NA
WP_000151259.1|282424_284392_+	xylonate dehydratase YagF	NA	NA	NA	NA	NA
WP_000192862.1|284618_286001_+	MFS transporter	NA	NA	NA	NA	NA
WP_000406871.1|286012_287623_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_001121657.1|287627_288386_-	DNA-binding transcriptional repressor XynR	NA	NA	NA	NA	NA
WP_001281824.1|288524_289529_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000388269.1|290723_291455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000860996.1|291545_292172_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001214248.1|292443_293142_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000072039.1|293168_294023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071819598.1|294141_294300_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_010723085.1|294455_295472_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000224818.1|295561_296002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|296118_297519_-|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
297629:297688	attR	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
>prophage 2
NZ_CP012126	Escherichia coli strain DH1Ec104 chromosome, complete genome	4612363	566397	571638	4612363	transposase,lysis	Enterobacteria_phage(66.67%)	9	NA	NA
WP_010723085.1|566397_567414_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000839596.1|567656_567872_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135281.1|567871_568369_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|568585_568768_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|568858_569152_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_000079503.1|569442_569853_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|570138_570345_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|570509_570704_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453566.1|571092_571638_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
>prophage 3
NZ_CP012126	Escherichia coli strain DH1Ec104 chromosome, complete genome	4612363	1170059	1192713	4612363	plate,portal,tRNA,integrase,transposase,tail	Shigella_phage(23.81%)	34	1162054:1162068	1199416:1199430
1162054:1162068	attL	CTTCAGCGTGGTTGT	NA	NA	NA	NA
WP_001297484.1|1170059_1171166_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1171219_1171681_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248691.1|1171690_1172344_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444484.1|1172515_1173766_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	1.9e-22
WP_000241967.1|1174259_1174925_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_010723094.1|1174925_1175630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001257372.1|1176087_1176981_+	cell death peptidase Lit	NA	NA	NA	NA	NA
WP_077626120.1|1177071_1177245_-|integrase	integrase	integrase	O21927	Phage_21	76.0	6.8e-16
WP_085947771.1|1177329_1178491_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000939945.1|1179440_1179686_-	excisionase-like protein from lambdoid prophage 14	NA	NA	NA	NA	NA
WP_011443584.1|1179722_1180034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010723095.1|1180150_1180492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001005353.1|1180429_1180738_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	3.8e-09
WP_000848748.1|1180912_1181587_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649480.1|1181677_1181878_+	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	98.5	1.9e-30
WP_000515837.1|1181921_1182479_+	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	7.4e-96
WP_001250269.1|1182654_1182834_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104929.1|1182823_1184191_+	helix-turn-helix domain-containing protein	NA	A0A1C9IIA1	Salmonella_phage	99.2	5.1e-223
WP_000605606.1|1184202_1184385_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_001350502.1|1184384_1184858_+|portal	phage portal protein	portal	A0A1B5FP95	Escherichia_phage	100.0	3.6e-75
WP_001350503.1|1184784_1185576_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	97.3	4.7e-144
WP_000383574.1|1185566_1186151_+	YmfQ family protein	NA	O22003	Shigella_phage	98.5	2.0e-112
WP_000554703.1|1186154_1186784_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	95.4	1.1e-52
WP_010723096.1|1186785_1187199_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	53.6	7.1e-27
WP_000548498.1|1187170_1187773_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	83.5	9.2e-92
WP_024184299.1|1187772_1188267_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	57.0	3.7e-46
WP_000905001.1|1188338_1188893_+	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.3	2.8e-87
WP_000557907.1|1188999_1189833_+	5-methylcytosine-specific endonuclease McrA	NA	NA	NA	NA	NA
WP_000943927.1|1190066_1190231_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	4.2e-23
WP_001295666.1|1190333_1190657_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_120795380.1|1190913_1190958_-	protein YmgK	NA	NA	NA	NA	NA
WP_032082692.1|1191193_1191304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|1191356_1191761_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332303.1|1191981_1192713_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
1199416:1199430	attR	ACAACCACGCTGAAG	NA	NA	NA	NA
>prophage 4
NZ_CP012126	Escherichia coli strain DH1Ec104 chromosome, complete genome	4612363	1377060	1419077	4612363	lysis,tRNA,integrase,transposase,tail	Escherichia_phage(46.88%)	43	1381757:1381775	1409781:1409799
WP_010723085.1|1377060_1378077_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000605090.1|1378349_1378607_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_001262123.1|1378656_1379607_-	universal stress protein UspE	NA	NA	NA	NA	NA
WP_000611911.1|1379758_1380511_-	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_010723085.1|1380610_1381627_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
1381757:1381775	attL	GCTTATTCGCACCTTCCCT	NA	NA	NA	NA
WP_000945011.1|1381904_1382420_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
WP_000062973.1|1382430_1383957_-	p-aminobenzoyl-glutamate transporter	NA	NA	NA	NA	NA
WP_000444929.1|1385438_1386749_-	p-aminobenzoyl-glutamate hydrolase subunit AbgA	NA	NA	NA	NA	NA
WP_000885458.1|1386924_1387833_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001046829.1|1388162_1388726_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_000628058.1|1388746_1389979_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1390233_1391217_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|1391694_1393068_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157406.1|1393196_1394132_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|1394183_1395419_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|1395420_1395636_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|1395714_1395924_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|1395916_1396111_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|1396167_1396977_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105143.1|1396969_1399570_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000632297.1|1399671_1399947_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|1400021_1400192_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560225.1|1400191_1400413_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001312793.1|1400854_1401343_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|1401339_1401495_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000948459.1|1401948_1402425_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|1402548_1402845_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693797.1|1402867_1403290_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000899748.1|1403302_1404160_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788970.1|1404166_1404913_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000450663.1|1404935_1405496_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_001228696.1|1405583_1405769_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|1405965_1407423_+	Trk system potassium transporter TrkG	NA	NA	NA	NA	NA
WP_001350510.1|1407560_1407824_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_000091628.1|1407804_1408164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019448.1|1409929_1410910_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
1409781:1409799	attR	AGGGAAGGTGCGAATAAGC	NA	NA	NA	NA
WP_000279097.1|1411232_1414595_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_001698950.1|1414594_1415170_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000086527.1|1415267_1415858_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836770.1|1416174_1416408_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_120795384.1|1416476_1416590_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001300461.1|1417368_1417803_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837921.1|1417943_1419077_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
>prophage 5
NZ_CP012126	Escherichia coli strain DH1Ec104 chromosome, complete genome	4612363	1611636	1630847	4612363	tail,lysis	Enterobacteria_phage(40.91%)	34	NA	NA
WP_000527743.1|1611636_1613097_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
WP_120795384.1|1615073_1615187_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1615255_1615489_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078177.1|1615805_1616396_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|1616493_1617069_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_001027733.1|1617068_1618031_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000453612.1|1617981_1618551_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001368374.1|1618939_1619173_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|1619230_1619641_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|1619792_1619966_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|1620137_1620293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|1620371_1620437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071524604.1|1620439_1620628_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1620638_1620851_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|1621213_1621711_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|1621707_1622241_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|1622237_1622549_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|1622553_1622769_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|1623522_1623738_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|1624038_1624251_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|1624305_1624395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001047135.1|1624672_1625425_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265198.1|1625438_1626488_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|1626489_1626768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|1626834_1627086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1627302_1627458_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|1627529_1627817_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|1627816_1628056_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|1628080_1628386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|1628588_1628921_+	protein FlxA	NA	NA	NA	NA	NA
WP_011443592.1|1629357_1629507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|1629803_1630034_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|1630117_1630525_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|1630691_1630847_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
>prophage 6
NZ_CP012126	Escherichia coli strain DH1Ec104 chromosome, complete genome	4612363	2450184	2461394	4612363	tail,integrase	Enterobacteria_phage(53.33%)	16	2448159:2448175	2465069:2465085
2448159:2448175	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000368140.1|2450184_2451117_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_000958671.1|2451428_2452586_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000915541.1|2452738_2453101_+	bactoprenol glucosyl transferase	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000703651.1|2453097_2454018_+	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	89.9	4.2e-160
WP_001030215.1|2454014_2455346_+	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_047792215.1|2455380_2455662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001106835.1|2455960_2456401_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_011443597.1|2456427_2456946_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_000066913.1|2456995_2457271_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_001393497.1|2457270_2457765_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000135673.1|2458487_2458850_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000081278.1|2458915_2459740_+	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000008183.1|2459867_2460404_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242717.1|2460394_2460757_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000206809.1|2460756_2461062_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001163428.1|2461193_2461394_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
2465069:2465085	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 7
NZ_CP012126	Escherichia coli strain DH1Ec104 chromosome, complete genome	4612363	2835003	2842142	4612363		Escherichia_phage(83.33%)	6	NA	NA
WP_001272928.1|2835003_2837565_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141337.1|2837670_2838327_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001300386.1|2838377_2839145_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000848004.1|2839340_2840249_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001393459.1|2840245_2841412_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_001278994.1|2841503_2842142_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
