The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012111	Acetobacter pasteurianus strain Ab3, complete genome	2806148	1018373	1062546	2806148	holin,transposase,tRNA	Paenibacillus_phage(14.29%)	48	NA	NA
WP_087651418.1|1018373_1019128_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.1	5.5e-25
WP_050819036.1|1019857_1020934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012812390.1|1021370_1022756_+|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.1e-31
WP_050818395.1|1023017_1024040_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.7	4.5e-22
WP_050819037.1|1024256_1024799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155467952.1|1025059_1025359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050819039.1|1025622_1026300_-	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_050819040.1|1026369_1026822_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_050819041.1|1026818_1027256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819042.1|1027237_1028350_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_050819043.1|1028385_1029501_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_003625602.1|1029574_1029877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003629184.1|1029916_1030342_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_050819044.1|1030475_1030970_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019088863.1|1030992_1031187_+	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
WP_003625609.1|1031213_1032125_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_050819045.1|1032134_1033661_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_050820307.1|1033725_1033968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050819046.1|1033964_1034687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819047.1|1034691_1036662_-	squalene--hopene cyclase	NA	NA	NA	NA	NA
WP_050819048.1|1036728_1038027_-	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_050819049.1|1038048_1038927_-	presqualene diphosphate synthase HpnD	NA	NA	NA	NA	NA
WP_050819050.1|1039025_1039886_-	squalene synthase HpnC	NA	NA	NA	NA	NA
WP_050819051.1|1039998_1041195_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_050819052.1|1041205_1042201_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_050819053.1|1042394_1043486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050819054.1|1043478_1044375_+	prephenate/arogenate dehydrogenase family protein	NA	NA	NA	NA	NA
WP_050819055.1|1044390_1045080_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003625637.1|1045084_1045210_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_050819056.1|1045318_1046281_-	hydrogen peroxide-inducible genes activator	NA	NA	NA	NA	NA
WP_012812366.1|1046461_1047004_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_050819057.1|1047206_1047734_+	alkyl hydroperoxide reductase	NA	NA	NA	NA	NA
WP_050819058.1|1048058_1048667_-	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_050819059.1|1048748_1049567_-	dioxygenase	NA	NA	NA	NA	NA
WP_003625653.1|1049725_1050253_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	51.7	2.1e-44
WP_050820308.1|1050563_1052243_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L0W2	Tupanvirus	25.2	3.3e-38
WP_050819060.1|1052366_1052870_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_050819061.1|1052923_1053550_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_080986737.1|1053577_1054426_-	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_050819062.1|1054670_1055498_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_050819063.1|1055577_1055823_-	ribbon-helix-helix domain-containing protein	NA	NA	NA	NA	NA
WP_050819064.1|1055819_1056890_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_050819065.1|1056902_1058063_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	50.3	1.9e-93
WP_050819066.1|1058059_1059142_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003624836.1|1059312_1059525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050819067.1|1059544_1060042_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_035366691.1|1060087_1061083_-|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	26.1	2.0e-06
WP_050819068.1|1061295_1062546_-|transposase	IS701-like element IS1452 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP012111	Acetobacter pasteurianus strain Ab3, complete genome	2806148	1324594	1353190	2806148	portal,terminase,head,protease,capsid,transposase	Paenibacillus_phage(11.11%)	27	NA	NA
WP_087651418.1|1324594_1325349_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.1	5.5e-25
WP_080986748.1|1325433_1325925_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	34.3	2.6e-12
WP_050819248.1|1326068_1326269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819249.1|1326270_1326651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819250.1|1326692_1327004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819251.1|1326996_1327176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050820332.1|1327172_1327730_-	lysozyme	NA	K4I410	Acidithiobacillus_phage	37.5	7.9e-13
WP_019089530.1|1327834_1328146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819252.1|1328173_1328983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155467964.1|1330438_1330765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155467967.1|1330780_1333384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819253.1|1333399_1339288_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_050819254.1|1339280_1340012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819255.1|1340016_1340394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819256.1|1340414_1340849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819257.1|1340941_1342252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819258.1|1342294_1342738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819259.1|1342734_1343175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080986849.1|1343493_1344135_-	hypothetical protein	NA	B0VK37	Azospirillum_phage	26.5	6.3e-06
WP_050819261.1|1344159_1345374_-|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	50.6	4.3e-96
WP_050819262.1|1345443_1346295_-|head,protease	HK97 family phage prohead protease	head,protease	K7PKL4	Enterobacterial_phage	39.3	2.1e-17
WP_050819263.1|1346287_1347622_-|portal	phage portal protein	portal	A0A0U4IJ43	Pseudomonas_phage	46.1	3.6e-88
WP_050819264.1|1347618_1349349_-|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	45.3	4.5e-131
WP_050819265.1|1349349_1349649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050820333.1|1349802_1350126_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_050819266.1|1350236_1350668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050818395.1|1352167_1353190_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.7	4.5e-22
>prophage 3
NZ_CP012111	Acetobacter pasteurianus strain Ab3, complete genome	2806148	1359965	1394148	2806148	transposase,integrase	Thermus_phage(22.22%)	39	1359686:1359745	1392510:1392856
1359686:1359745	attL	CGCGGATTTCTTCTGTGGTTACCGTCCGTTATGCAAGAGTTTTCTGACCAATATTGACGT	NA	NA	NA	NA
WP_050818395.1|1359965_1360988_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.7	4.5e-22
WP_050819278.1|1361249_1362635_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.4	2.9e-32
WP_155467973.1|1362824_1362992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050819279.1|1363128_1363806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050819280.1|1363802_1364060_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_050819281.1|1364059_1364392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007400224.1|1364460_1364820_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010510701.1|1364816_1365164_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5WJH4	Leptospira_phage	46.8	1.6e-11
WP_050819282.1|1365227_1366838_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	42.6	1.1e-110
WP_155467976.1|1366929_1367253_+	hypothetical protein	NA	A0A291AUF0	Sinorhizobium_phage	44.1	9.2e-14
WP_007400224.1|1367321_1367681_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010510701.1|1367677_1368025_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5WJH4	Leptospira_phage	46.8	1.6e-11
WP_050819282.1|1368088_1369699_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	42.6	1.1e-110
WP_155468050.1|1369772_1370120_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A291AUF0	Sinorhizobium_phage	48.5	1.3e-18
WP_080986750.1|1370155_1370563_-	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_155467979.1|1370565_1371321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003628894.1|1371772_1372135_+	YggT family protein	NA	NA	NA	NA	NA
WP_050819287.1|1372188_1372587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003626196.1|1372687_1372867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819288.1|1373133_1373322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050819289.1|1373388_1374192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819290.1|1374224_1374911_-	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_050819292.1|1375154_1376096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050819293.1|1376189_1376582_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_050819294.1|1376692_1377127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050819295.1|1377241_1377742_-	CHRD domain-containing protein	NA	NA	NA	NA	NA
WP_050819296.1|1377951_1378776_-	META domain-containing protein	NA	NA	NA	NA	NA
WP_003626226.1|1380769_1381147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050819298.1|1381210_1381900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050819300.1|1382326_1384543_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_050819301.1|1384627_1385158_-	cytochrome c	NA	NA	NA	NA	NA
WP_050819302.1|1385162_1386413_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_050820334.1|1386503_1386821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050820335.1|1386920_1387787_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_050819303.1|1387812_1388247_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_050819304.1|1388290_1388575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819305.1|1388706_1390206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819306.1|1390585_1392055_-	Hint domain-containing protein	NA	NA	NA	NA	NA
WP_050818395.1|1393125_1394148_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.7	4.5e-22
1392510:1392856	attR	CGCGGATTTCTTCTGTGGTTACCGTCCGTTATGCAAGAGTTTTCTGACCAATATTGACGTGTGATCGTGTGCGGTCTTCTGTAAGGCCTGTTGATGTGGCCTTTCAGAAGCCACTGGCCGGTATGGTGATCAGCGGATCAGATCCAAATCTCACAGGCGTGCTTTAAAGCACAGAGAAATCCACTGGTTTTTCCGATCCGGATCAAACGATCATGCGCCCATTCAGGTCATCGCCCTCTCACACCCCTACCGGTTCCATCCGCGGGAGCCGAGCCATCGCTCAGGCTGCCAGGGACAGGGCCGGATCCCGATAATCCTCCTGTTTTGTTGCCATGGCCCAGATGGCT	NA	NA	NA	NA
>prophage 4
NZ_CP012111	Acetobacter pasteurianus strain Ab3, complete genome	2806148	1414223	1457016	2806148	transposase,terminase	Aeromonas_phage(20.0%)	44	NA	NA
WP_050819319.1|1414223_1415678_+|terminase	phage terminase large subunit	terminase	A0A1X9SGU8	Bradyrhizobium_phage	45.2	3.3e-103
WP_050820337.1|1415674_1416727_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_050819320.1|1416885_1418265_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	45.8	6.6e-85
WP_050819321.1|1418261_1419263_+	DUF2213 domain-containing protein	NA	A0A2R3UAL3	Myoviridae_environmental_samples	37.4	4.4e-30
WP_050819322.1|1419301_1419802_+	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	46.3	1.1e-29
WP_050820338.1|1419801_1420839_+	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	46.5	7.7e-78
WP_050819323.1|1421236_1421743_+	DUF4054 domain-containing protein	NA	H9C0W0	Aeromonas_phage	43.9	5.5e-13
WP_050819324.1|1421733_1422114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050819325.1|1422074_1422653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050819326.1|1422671_1423826_+	DUF3383 family protein	NA	H9C0W5	Aeromonas_phage	32.7	9.9e-26
WP_050819327.1|1423828_1424266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050819328.1|1424304_1424760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050820339.1|1425124_1425928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050819329.1|1425963_1426677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050819330.1|1426673_1426994_+	hypothetical protein	NA	A0A191ZDK0	Acinetobacter_phage	35.1	2.0e-05
WP_050819331.1|1426990_1427917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012812542.1|1428615_1428969_+	hypothetical protein	NA	A0A068CCM1	Acinetobacter_phage	42.1	1.1e-12
WP_050819332.1|1428955_1430191_+	hypothetical protein	NA	A0A2R3UAL9	Myoviridae_environmental_samples	38.8	7.0e-62
WP_050819333.1|1430190_1430769_+	DUF2612 domain-containing protein	NA	Q6UIZ7	Burkholderia_virus	39.7	7.4e-30
WP_050819334.1|1430776_1431874_+	hypothetical protein	NA	A0A077KC23	Edwardsiella_phage	36.4	8.5e-11
WP_050819335.1|1431880_1432450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050819336.1|1432572_1433019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050819337.1|1433091_1434354_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	38.3	2.5e-30
WP_050819338.1|1434438_1436862_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_050819339.1|1436864_1438115_+	phosphotransferase	NA	NA	NA	NA	NA
WP_050819340.1|1438114_1438708_+	nicotinamide mononucleotide transporter	NA	NA	NA	NA	NA
WP_050819341.1|1438826_1439897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050818395.1|1440113_1441136_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.7	4.5e-22
WP_050820340.1|1441397_1442783_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.9e-31
WP_050819342.1|1443879_1444200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003627019.1|1444292_1445198_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	34.6	5.4e-11
WP_050819343.1|1445561_1445936_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_080986753.1|1446017_1446527_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_050819344.1|1447756_1448533_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003627014.1|1448543_1448978_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	38.6	2.8e-05
WP_003627013.1|1449106_1449490_-	VOC family protein	NA	NA	NA	NA	NA
WP_050819345.1|1449559_1450384_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_080986754.1|1450340_1450580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019089870.1|1450616_1451057_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_050819346.1|1451055_1451256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050818395.1|1451704_1452727_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.7	4.5e-22
WP_050820342.1|1452988_1454374_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	6.5e-32
WP_012812328.1|1454882_1456133_+|transposase	IS701-like element IS1452 family transposase	transposase	NA	NA	NA	NA
WP_087651418.1|1456261_1457016_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.1	5.5e-25
>prophage 5
NZ_CP012111	Acetobacter pasteurianus strain Ab3, complete genome	2806148	1675393	1724206	2806148	holin,transposase,tRNA,protease	Thermus_phage(20.0%)	45	NA	NA
WP_050819482.1|1675393_1676299_-|holin	phosphatidylcholine/phosphatidylserine synthase	holin	NA	NA	NA	NA
WP_050819483.1|1676311_1677001_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_050819484.1|1677083_1679729_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	36.0	4.7e-71
WP_050819485.1|1679901_1680405_-	GtrA family protein	NA	NA	NA	NA	NA
WP_050819486.1|1680504_1681635_-	OmpA family protein	NA	NA	NA	NA	NA
WP_080986857.1|1681979_1683713_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_004448996.1|1683775_1684114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003628333.1|1684117_1685038_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	30.1	3.4e-29
WP_050819488.1|1685112_1686069_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_050820370.1|1686125_1686881_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_050819489.1|1687039_1688665_+|tRNA	lysine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_050819490.1|1688685_1690773_+	lysylphosphatidylglycerol synthetase family protein	NA	NA	NA	NA	NA
WP_003628324.1|1690830_1691568_+	NAAT family transporter	NA	NA	NA	NA	NA
WP_050819491.1|1691582_1692404_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_050819492.1|1692400_1693507_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	44.0	1.4e-64
WP_050819493.1|1693652_1694726_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_050819494.1|1694735_1695464_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_003628317.1|1695526_1696024_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_080986767.1|1696150_1696783_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_050819496.1|1696829_1697510_+	Tim44 domain-containing protein	NA	NA	NA	NA	NA
WP_050819497.1|1697506_1698364_+	site-specific DNA-methyltransferase	NA	A0A0E3HGT7	Synechococcus_phage	44.2	6.8e-64
WP_050819498.1|1698498_1699926_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_050819499.1|1700061_1700694_+	methionine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_050819500.1|1700673_1701885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819501.1|1701895_1702810_-	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_050819502.1|1702989_1704174_+	ubiquinol-cytochrome c reductase	NA	NA	NA	NA	NA
WP_050819503.1|1704170_1704962_+	ubiquinol-cytochrome c reductase	NA	NA	NA	NA	NA
WP_003628301.1|1704948_1705833_+	S-methyl-5'-thioadenosine phosphorylase	NA	NA	NA	NA	NA
WP_050819504.1|1705936_1706458_+	DUF4232 domain-containing protein	NA	NA	NA	NA	NA
WP_087651418.1|1706757_1707511_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.1	5.5e-25
WP_035366691.1|1707521_1708517_-|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	26.1	2.0e-06
WP_050819505.1|1708580_1708964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819506.1|1709207_1709858_-	oxygen-insensitive NAD(P)H-dependent nitroreductase NfsB	NA	NA	NA	NA	NA
WP_050819507.1|1709974_1710874_-	delta(1)-pyrroline-2-carboxylate reductase family protein	NA	NA	NA	NA	NA
WP_080986768.1|1712161_1713178_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.0	9.6e-17
WP_050819508.1|1713211_1714204_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_080986769.1|1714294_1714996_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_050818395.1|1715468_1716491_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.7	4.5e-22
WP_050819509.1|1717368_1717995_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_050819510.1|1718186_1718726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012812736.1|1719934_1720753_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	M4QNT1	Ostreococcus_lucimarinus_virus	33.5	2.4e-34
WP_050819511.1|1720812_1721904_-	NADH:flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
WP_050819512.1|1722000_1722333_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003627279.1|1722348_1723332_-	zinc-dependent alcohol dehydrogenase family protein	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	29.3	5.8e-19
WP_050819513.1|1723444_1724206_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
>prophage 6
NZ_CP012111	Acetobacter pasteurianus strain Ab3, complete genome	2806148	2181113	2236865	2806148	transposase,tRNA	Paenibacillus_phage(18.18%)	41	NA	NA
WP_087651418.1|2181113_2181867_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.1	5.5e-25
WP_050819802.1|2181844_2184223_-	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	51.5	1.4e-212
WP_050819803.1|2184236_2185697_-	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	43.8	2.1e-97
WP_050819804.1|2185733_2187194_-	purine permease	NA	Q9KX94	Enterobacteria_phage	30.6	9.6e-26
WP_050819805.1|2187197_2187530_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_050819806.1|2187526_2188036_-	2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase	NA	NA	NA	NA	NA
WP_050819807.1|2188032_2188926_-	allantoinase PuuE	NA	NA	NA	NA	NA
WP_050819808.1|2188953_2190372_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_006115357.1|2190528_2191431_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_050820406.1|2192754_2194347_-	gamma-glutamyltransferase family protein	NA	NA	NA	NA	NA
WP_012812288.1|2194434_2194875_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_050819809.1|2195543_2195819_-	SelT/SelW/SelH family protein	NA	NA	NA	NA	NA
WP_050819810.1|2196211_2197195_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_050819811.1|2197194_2199930_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	28.5	1.3e-20
WP_050819812.1|2199929_2201057_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_050819813.1|2201057_2202509_+	TolC family protein	NA	NA	NA	NA	NA
WP_050819814.1|2202534_2203395_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_050820407.1|2203412_2204408_-|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	26.1	2.0e-06
WP_012812328.1|2204584_2205835_+|transposase	IS701-like element IS1452 family transposase	transposase	NA	NA	NA	NA
WP_087651418.1|2206051_2206805_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.1	5.5e-25
WP_050819815.1|2206891_2207989_+	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
WP_050819816.1|2208061_2208715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050819817.1|2208790_2210953_-	squalene--hopene cyclase	NA	NA	NA	NA	NA
WP_003624473.1|2211008_2211563_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_050819818.1|2211733_2212315_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_050819819.1|2212451_2213636_+	signal peptide-containing protein	NA	NA	NA	NA	NA
WP_050819820.1|2213736_2214969_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	44.1	6.5e-68
WP_050819821.1|2215039_2216410_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_050819822.1|2216406_2217543_-	alkene reductase	NA	NA	NA	NA	NA
WP_050819823.1|2217656_2218025_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_050819824.1|2218076_2220194_-	catalase	NA	A0A2K9L572	Tupanvirus	49.9	1.3e-137
WP_050820408.1|2220373_2220796_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_050819825.1|2221037_2221253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050819826.1|2221305_2229864_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_050819827.1|2229929_2231270_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_050819828.1|2231525_2232326_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_050819829.1|2232377_2232680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155467994.1|2232726_2232873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050820409.1|2232994_2233435_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_012813229.1|2234195_2235581_+|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.1e-31
WP_050818395.1|2235842_2236865_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.7	4.5e-22
>prophage 7
NZ_CP012111	Acetobacter pasteurianus strain Ab3, complete genome	2806148	2246809	2328711	2806148	transposase,integrase	Thermus_phage(30.77%)	55	2245039:2245098	2279552:2280163
2245039:2245098	attL	ATTAGGGCCTGTTAGATCTTGAATTTCTTCCCATATTGTAGGGATGGAAGAAGGAGACAG	NA	NA	NA	NA
WP_050818493.1|2246809_2248195_+|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.4	3.8e-32
WP_080986861.1|2248337_2248817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080986795.1|2249058_2250276_-	hypothetical protein	NA	A7KV33	Bacillus_phage	31.6	6.5e-44
WP_050819839.1|2250299_2252519_-	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	29.5	4.6e-64
WP_050819840.1|2252515_2254741_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_050819841.1|2254745_2255777_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_050820410.1|2255833_2256172_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_050818395.1|2256289_2257312_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.7	4.5e-22
WP_050819842.1|2257606_2258512_+	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	28.7	1.5e-24
WP_050819843.1|2258631_2264664_+	DUF3320 domain-containing protein	NA	NA	NA	NA	NA
WP_050819844.1|2264875_2266027_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_050819845.1|2266164_2266863_+	DUF1349 domain-containing protein	NA	NA	NA	NA	NA
WP_080986796.1|2266859_2267405_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_050819847.1|2267834_2270474_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	35.1	1.7e-12
WP_080986797.1|2270565_2272167_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_050819849.1|2272166_2272583_+	cytochrome c	NA	NA	NA	NA	NA
WP_087652072.1|2272647_2273109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050818395.1|2273433_2274456_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.7	4.5e-22
WP_012813229.1|2274717_2276103_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.1e-31
WP_050819851.1|2276627_2276951_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_050819852.1|2276955_2277507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819853.1|2277571_2278405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819854.1|2281070_2281580_-	molecular chaperone Tir	NA	NA	NA	NA	NA
2279552:2280163	attR	CTGTCTCCTTCTTCCATCCCTACAATATGGGAAGAAATTCAAGATCTAACAGGCCCTAATGCACCGAGAATGTCCGGATCAGACGAAAGCTGCCATTTAGATGGACAAGGTGCTCAGAGAGTTGTCGACTGAAACTGGTGGAACGGTCGCATCGTCGGACGTGGCTGGCAGTCAACTCGTGGGGAGCGCTGACACGGACACCCGCCGCTCACCGCGCAATCGGCTGTTCAAGGTGCTTTGGAAAGTAGTCTTTCCGCGATTTTGCCCGTTTCCTCTACCGAAATTTCTTCTACCTGACCAAATTCGGTCCCGCCGCCATCAAGTGTACCTGCTACATGAAAATGAACATGACTAATCGCTTGTCCGGCAGGGATGCCATTGTTTTGCCAGACTGCAATTCCTGGCTTGGCATAAGCACGGTCGATAATATCGCAGCTTCTCGTACCGCTATGGCAACAGAACCAGCCTCTGCGTCCGTGAGTTCGATTATAGTGGGCACATGCCTGATTGGCAGAACGAGTAGGTGAGGCTTGCCCCTCTACTCGCGAGTTATGAAAGTTGCCGTGTCCTCAGTCCGCGACAAGATCGTATATGATCTTTCATGCCGCAAAT	NA	NA	NA	NA
WP_050819855.1|2283007_2283541_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_050819856.1|2284032_2285346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050819858.1|2286489_2287482_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_050819859.1|2287576_2288206_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_050819860.1|2288527_2289493_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_050819861.1|2289512_2291024_-	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
WP_050819863.1|2297023_2299537_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	35.3	2.6e-156
WP_050819864.1|2299660_2300917_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_050819865.1|2301089_2301731_-	thiopurine S-methyltransferase	NA	NA	NA	NA	NA
WP_050819866.1|2301855_2302500_+	glutaredoxin 2	NA	NA	NA	NA	NA
WP_050819867.1|2303192_2304548_+	MFS transporter	NA	NA	NA	NA	NA
WP_050819868.1|2304649_2305723_+	cobalt-precorrin-5B (C(1))-methyltransferase	NA	NA	NA	NA	NA
WP_050819869.1|2305727_2306486_-	precorrin-4 C(11)-methyltransferase	NA	NA	NA	NA	NA
WP_050819870.1|2306486_2306861_-	cobalamin biosynthesis protein	NA	NA	NA	NA	NA
WP_050819871.1|2306857_2308102_-	bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase	NA	NA	NA	NA	NA
WP_050819872.1|2308191_2308995_+	cobalt-precorrin-6A reductase	NA	NA	NA	NA	NA
WP_050819873.1|2308964_2309723_-	precorrin-3B C(17)-methyltransferase	NA	NA	NA	NA	NA
WP_050819874.1|2309719_2310445_-	precorrin-2 C(20)-methyltransferase	NA	NA	NA	NA	NA
WP_003630816.1|2310445_2311075_-	precorrin-8X methylmutase	NA	NA	NA	NA	NA
WP_050820411.1|2311061_2312294_-	precorrin-3B synthase	NA	NA	NA	NA	NA
WP_050819875.1|2312464_2313001_+	Dabb family protein	NA	NA	NA	NA	NA
WP_050819876.1|2313044_2314493_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_050819877.1|2314825_2316760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050819878.1|2316766_2317702_-	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_050819879.1|2317860_2318688_-	transporter	NA	NA	NA	NA	NA
WP_050819278.1|2318784_2320170_+|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.4	2.9e-32
WP_050818395.1|2320431_2321454_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.7	4.5e-22
WP_012813095.1|2321997_2323038_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.6	1.2e-11
WP_050819880.1|2323286_2325743_-	membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family	NA	NA	NA	NA	NA
WP_087652064.1|2325800_2326073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050819881.1|2326082_2327579_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_087651418.1|2327956_2328711_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.1	5.5e-25
>prophage 8
NZ_CP012111	Acetobacter pasteurianus strain Ab3, complete genome	2806148	2349519	2402140	2806148	tail,transposase,tRNA,plate	Paenibacillus_phage(22.22%)	56	NA	NA
WP_087651418.1|2349519_2350274_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.1	5.5e-25
WP_050819895.1|2350966_2352226_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_050819896.1|2352233_2353154_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_050819897.1|2353153_2353807_-	formate dehydrogenase subunit gamma	NA	NA	NA	NA	NA
WP_050819898.1|2353806_2354742_-	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_080986801.1|2354751_2357805_-	formate dehydrogenase-N subunit alpha	NA	NA	NA	NA	NA
WP_050820417.1|2358495_2359578_+	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_050819899.1|2359574_2360366_+	RlmE family RNA methyltransferase	NA	NA	NA	NA	NA
WP_050819900.1|2360390_2361284_-	ROK family protein	NA	NA	NA	NA	NA
WP_003625422.1|2361400_2361652_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_003630879.1|2361723_2361978_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_020943963.1|2361979_2362918_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_050819901.1|2362922_2364911_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_050819902.1|2364917_2365655_+	TlyA family RNA methyltransferase	NA	NA	NA	NA	NA
WP_050819903.1|2365792_2366374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050819904.1|2366495_2367722_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_003623870.1|2367832_2369074_+	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_050819905.1|2369118_2369616_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_050819906.1|2369676_2370141_+	cytochrome c	NA	NA	NA	NA	NA
WP_050819907.1|2370174_2371170_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_035366691.1|2371683_2372679_+|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	26.1	2.0e-06
WP_050819908.1|2373610_2374882_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	A0A0P0IVM8	Acinetobacter_phage	31.1	5.4e-41
WP_080986802.1|2374878_2377176_-	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_080986803.1|2377162_2377744_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012812328.1|2378210_2379461_+|transposase	IS701-like element IS1452 family transposase	transposase	NA	NA	NA	NA
WP_003631209.1|2380674_2380938_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_080986862.1|2380945_2381230_+	BrnA antitoxin family protein	NA	A0A2H4J5Y5	uncultured_Caudovirales_phage	40.5	3.1e-05
WP_050819912.1|2381356_2381557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819913.1|2381558_2381939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819914.1|2381935_2382304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819915.1|2382530_2383019_-	hypothetical protein	NA	A0A1B2ANT4	Pseudoalteromonas_phage	35.5	2.9e-11
WP_050819916.1|2383015_2383585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050820419.1|2383634_2384852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819917.1|2385015_2385426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819918.1|2385425_2386508_-|tail	tail fiber domain-containing protein	tail	NA	NA	NA	NA
WP_155467996.1|2387160_2387481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819920.1|2387705_2388986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819921.1|2388985_2389597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819922.1|2389596_2390742_-	hypothetical protein	NA	M9MUU8	Rhodococcus_phage	31.6	2.6e-10
WP_050819923.1|2390752_2391112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819924.1|2391108_2391759_-|plate	baseplate assembly protein	plate	NA	NA	NA	NA
WP_050819925.1|2391751_2393002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819926.1|2392998_2393208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819927.1|2393208_2394132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080986804.1|2394229_2394496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155467998.1|2394984_2395140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155468000.1|2395454_2395889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050819931.1|2395931_2396174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080986805.1|2396218_2397103_-	phage antirepressor KilAC domain-containing protein	NA	A0A067ZIN2	Vibrio_phage	41.3	6.4e-25
WP_155468052.1|2397369_2397672_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_050819933.1|2397618_2398260_-	KilA-N domain-containing protein	NA	A0A141GEX9	Brucella_phage	50.0	4.5e-28
WP_050819934.1|2398256_2398601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080986807.1|2398887_2399541_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_080986808.1|2399769_2400099_+	DUF3761 domain-containing protein	NA	NA	NA	NA	NA
WP_050819936.1|2400115_2401255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087651418.1|2401386_2402140_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.1	5.5e-25
>prophage 9
NZ_CP012111	Acetobacter pasteurianus strain Ab3, complete genome	2806148	2407366	2525322	2806148	portal,integrase,holin,tail,transposase	Thermus_phage(20.83%)	101	2436577:2436592	2439852:2439867
WP_050819943.1|2407366_2408851_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_050819944.1|2408850_2409057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819945.1|2409071_2410118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819946.1|2410117_2410804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819947.1|2410803_2410992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019089333.1|2410991_2411201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819948.1|2411160_2411550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819949.1|2411556_2411946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819950.1|2411945_2412167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819951.1|2412166_2413561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819952.1|2413641_2414286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819953.1|2414332_2415850_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_050819954.1|2415849_2417349_-	hypothetical protein	NA	A0A1Y0T3N1	Sinorhizobium_phage	39.6	2.7e-76
WP_080986809.1|2417329_2417794_-	hypothetical protein	NA	F8TUR4	EBPR_podovirus	41.4	1.4e-18
WP_155468004.1|2417930_2418299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155468006.1|2418334_2418778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155468008.1|2418969_2419143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155468010.1|2419139_2419301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819958.1|2419644_2419824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155468012.1|2420272_2421010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819961.1|2421013_2422141_-	HNH endonuclease	NA	A0A2I7RGI7	Vibrio_phage	45.2	1.3e-14
WP_155468014.1|2422140_2422680_-	hypothetical protein	NA	Q58N10	Prochlorococcus_phage	34.6	1.1e-06
WP_012812328.1|2422722_2423973_+|transposase	IS701-like element IS1452 family transposase	transposase	NA	NA	NA	NA
WP_035366691.1|2424184_2425180_+|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	26.1	2.0e-06
WP_042788106.1|2425414_2425837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819964.1|2426128_2426518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019089565.1|2426616_2426856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050819965.1|2426858_2427323_-	single-stranded DNA-binding protein	NA	R9TP78	Rhizobium_phage	48.5	6.5e-37
WP_050819966.1|2427322_2427826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155468016.1|2428268_2428475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819969.1|2428567_2428912_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_050819970.1|2429562_2430036_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_050819971.1|2430032_2430491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050819972.1|2430877_2431609_+	hypothetical protein	NA	A5LH75	Enterobacteria_phage	46.4	4.8e-18
WP_050819973.1|2431620_2431932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155468018.1|2431928_2432219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050819975.1|2432218_2432455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050819976.1|2432533_2432854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050819977.1|2432850_2433045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050819978.1|2433044_2433503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050819155.1|2435152_2435743_+	3'-5' exonuclease	NA	A0A1W6DWR2	Sphingobium_phage	40.4	1.3e-29
WP_050819154.1|2435739_2436069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050819981.1|2436065_2436554_+	hypothetical protein	NA	NA	NA	NA	NA
2436577:2436592	attL	CTGAAGGATGTGTTGC	NA	NA	NA	NA
WP_050819982.1|2436740_2437904_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1ITF8	uncultured_Mediterranean_phage	23.8	5.5e-08
WP_003623877.1|2438555_2439278_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080986863.1|2439460_2439940_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
2439852:2439867	attR	CTGAAGGATGTGTTGC	NA	NA	NA	NA
WP_050819983.1|2439936_2441754_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_050819984.1|2441849_2443163_-	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_050819985.1|2443172_2444651_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.6	1.6e-97
WP_050819986.1|2444864_2446526_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_050819987.1|2446522_2447542_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_050819988.1|2447554_2448529_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_087652163.1|2448530_2449562_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.0	4.3e-12
WP_050819990.1|2449558_2450539_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.5	9.6e-14
WP_050819991.1|2450533_2451628_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_050819992.1|2451776_2452547_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_050819993.1|2452583_2453414_+	ribonuclease I	NA	NA	NA	NA	NA
WP_080986811.1|2453416_2454532_+	purine nucleoside permease	NA	NA	NA	NA	NA
WP_050819994.1|2454561_2457051_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_050818395.1|2459571_2460594_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.7	4.5e-22
WP_050819997.1|2462070_2462589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819998.1|2462612_2463809_-	DUF3500 domain-containing protein	NA	NA	NA	NA	NA
WP_050818493.1|2465308_2466694_+|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.4	3.8e-32
WP_050818395.1|2466955_2467978_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.7	4.5e-22
WP_080986864.1|2470316_2470940_-	DUF1442 domain-containing protein	NA	NA	NA	NA	NA
WP_050820001.1|2470971_2471562_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_050820002.1|2471862_2474223_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_080986812.1|2474561_2474840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050820003.1|2474839_2475889_+	multidrug transporter subunit MdtN	NA	NA	NA	NA	NA
WP_050820004.1|2475869_2477696_+	fusaric acid resistance protein	NA	NA	NA	NA	NA
WP_050820005.1|2477692_2479318_+	TolC family protein	NA	NA	NA	NA	NA
WP_050820006.1|2479339_2480923_-	B12-binding domain-containing radical SAM protein	NA	NA	NA	NA	NA
WP_050820007.1|2481297_2481819_-	DUF4142 domain-containing protein	NA	NA	NA	NA	NA
WP_050820008.1|2482088_2484365_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_080986813.1|2484566_2485385_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_050820009.1|2485708_2487049_-	sorbosone dehydrogenase family protein	NA	NA	NA	NA	NA
WP_019087756.1|2487392_2487587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050820010.1|2487600_2488740_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_050820011.1|2488754_2490368_-	cytochrome d terminal oxidase subunit 1	NA	NA	NA	NA	NA
WP_050820012.1|2490432_2492124_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	24.4	5.2e-15
WP_080986814.1|2492120_2493809_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	34.5	3.4e-27
WP_155468020.1|2494044_2494798_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.9	3.8e-26
WP_050820423.1|2495109_2495799_-	Fe2+-dependent dioxygenase	NA	Q5GQB0	Synechococcus_phage	30.8	2.6e-21
WP_050820015.1|2495892_2498331_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_155468022.1|2498761_2499947_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080986815.1|2499968_2500547_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_050820017.1|2500770_2501760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050820018.1|2501791_2502892_-	asparaginase	NA	NA	NA	NA	NA
WP_050820019.1|2503008_2504598_-	bifunctional aspartate transaminase/aspartate 4-decarboxylase	NA	NA	NA	NA	NA
WP_050820020.1|2504623_2506315_-	aspartate-alanine antiporter	NA	NA	NA	NA	NA
WP_080986816.1|2508660_2509293_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_080986817.1|2509289_2510021_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_050820424.1|2510017_2511151_-	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_080986818.1|2511337_2511721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050820022.1|2512103_2513726_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.9	1.3e-60
WP_050820023.1|2513895_2514840_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012812390.1|2516964_2518350_+|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.1e-31
WP_050818395.1|2518611_2519634_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.7	4.5e-22
WP_050820024.1|2520825_2521146_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_012813095.1|2522715_2523756_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.6	1.2e-11
WP_050818395.1|2524299_2525322_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.7	4.5e-22
>prophage 10
NZ_CP012111	Acetobacter pasteurianus strain Ab3, complete genome	2806148	2689687	2772822	2806148	portal,tRNA,plate,integrase,terminase,head,capsid,tail,transposase	Bacillus_phage(13.04%)	82	2759258:2759272	2773454:2773468
WP_035366691.1|2689687_2690683_-|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	26.1	2.0e-06
WP_012812328.1|2690895_2692146_-|transposase	IS701-like element IS1452 family transposase	transposase	NA	NA	NA	NA
WP_050820138.1|2692260_2692881_-	sulfoxide reductase heme-binding subunit YedZ	NA	NA	NA	NA	NA
WP_050820139.1|2693105_2693981_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003629595.1|2694979_2695588_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	43.6	4.2e-36
WP_050820141.1|2695844_2698460_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	36.7	2.9e-118
WP_050820142.1|2698549_2699182_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_050820143.1|2699243_2700563_-	GTPase HflX	NA	NA	NA	NA	NA
WP_003624011.1|2700543_2700828_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_050820144.1|2700904_2702296_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_050820145.1|2702285_2704550_-	PAS domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	24.3	1.2e-06
WP_050820146.1|2704559_2706002_-	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
WP_050820147.1|2706057_2707167_-	PAS domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.2	3.9e-11
WP_050820148.1|2707163_2708234_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_050820433.1|2708318_2709473_-	bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_050820434.1|2709534_2710509_-	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	49.8	1.3e-74
WP_155468026.1|2710631_2710778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020944179.1|2710787_2712614_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_020944180.1|2712687_2714862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050820149.1|2715016_2716168_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	41.8	1.3e-78
WP_050820150.1|2716305_2718135_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_012812390.1|2718925_2720311_+|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.1e-31
WP_012812328.1|2721090_2722341_-|transposase	IS701-like element IS1452 family transposase	transposase	NA	NA	NA	NA
WP_155468028.1|2722391_2722928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050820435.1|2723076_2723382_-	ETC complex I subunit	NA	NA	NA	NA	NA
WP_050820151.1|2723540_2724026_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_050820152.1|2724085_2725471_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_080986824.1|2725555_2726224_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_050820153.1|2726263_2726515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050820154.1|2726618_2726864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080986825.1|2727000_2728341_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	36.0	1.8e-71
WP_011251455.1|2728522_2729347_-|transposase	IS5-like element IS12528 family transposase	transposase	NA	NA	NA	NA
WP_050820156.1|2729530_2729869_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_003625733.1|2729952_2730822_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_050820157.1|2730824_2732075_-	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_050820158.1|2732430_2733006_+	DedA family protein	NA	NA	NA	NA	NA
WP_050820159.1|2733125_2733638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050820160.1|2733831_2734389_+	tyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_035366691.1|2734602_2735598_-|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	26.1	2.0e-06
WP_012812328.1|2737050_2738301_+|transposase	IS701-like element IS1452 family transposase	transposase	NA	NA	NA	NA
WP_080986826.1|2738485_2738854_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155468030.1|2740083_2740287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050820163.1|2740534_2740732_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_155468032.1|2741454_2742183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050820166.1|2742895_2743681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050820167.1|2743677_2744070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050820168.1|2744069_2744660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050820169.1|2744713_2745079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050820170.1|2745305_2745794_-	hypothetical protein	NA	S5M805	Pseudoalteromonas_phage	39.2	4.9e-11
WP_050820171.1|2745790_2746360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155468034.1|2748403_2748547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050820173.1|2748543_2749170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155468036.1|2749182_2749710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050820437.1|2749706_2750126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050820175.1|2750134_2751208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050820176.1|2751211_2751760_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_050820177.1|2751763_2752879_-|plate	baseplate J/gp47 family protein	plate	B5TAA9	Burkholderia_phage	29.2	6.6e-19
WP_050820178.1|2752882_2753383_-	hypothetical protein	NA	A0A2P9JZK5	Alteromonadaceae_phage	33.3	5.1e-11
WP_050820179.1|2753384_2753915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155468038.1|2753914_2754931_-|tail	phage tail protein	tail	M4M9L5	Vibrio_phage	30.1	2.2e-21
WP_050820180.1|2755062_2756361_-	hypothetical protein	NA	A0A2P9JZK2	Alteromonadaceae_phage	25.0	1.6e-16
WP_050820181.1|2756365_2758306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050820182.1|2758438_2759083_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_050820183.1|2759085_2759496_-|tail	phage tail protein	tail	NA	NA	NA	NA
2759258:2759272	attL	AAACCGCTGCCGCCC	NA	NA	NA	NA
WP_050820184.1|2759507_2760983_-|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	36.7	1.1e-58
WP_050820185.1|2760983_2761187_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_050820186.1|2761196_2761607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050820187.1|2761656_2762058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050820188.1|2762059_2762341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155468056.1|2762344_2763412_-|capsid	major capsid protein	capsid	V5Q8X6	Xylella_phage	35.1	1.4e-50
WP_050820190.1|2763488_2763878_-|head	head decoration protein	head	A0A291AUM0	Sinorhizobium_phage	33.3	8.8e-11
WP_050820191.1|2763874_2764474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050820192.1|2764500_2765331_-	S49 family peptidase	NA	A0A1B2LRQ7	Wolbachia_phage	38.5	6.8e-37
WP_050820193.1|2765327_2766977_-|portal	phage portal protein	portal	V5Q9Y6	Xylella_phage	36.9	4.0e-81
WP_003630354.1|2766976_2767279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050820194.1|2767290_2769309_-|terminase	phage terminase large subunit family protein	terminase	G8EXZ6	Synechococcus_phage	45.6	6.1e-140
WP_050820195.1|2769271_2769796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050820196.1|2769923_2770673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050820198.1|2770945_2771152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155468040.1|2771148_2771313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050820438.1|2771309_2771921_-	DUF3164 family protein	NA	J9SHK0	Pseudomonas_phage	45.5	5.6e-44
WP_035366065.1|2771946_2772822_-|integrase	tyrosine-type recombinase/integrase	integrase	D4P765	Rhodococcus_phage	35.0	1.7e-06
2773454:2773468	attR	AAACCGCTGCCGCCC	NA	NA	NA	NA
>prophage 11
NZ_CP012111	Acetobacter pasteurianus strain Ab3, complete genome	2806148	2789127	2799849	2806148		uncultured_virus(50.0%)	10	NA	NA
WP_050820440.1|2789127_2792085_+	ATP-dependent DNA helicase	NA	A0A2P1N0K5	Streptomyces_phage	32.6	3.3e-09
WP_003625755.1|2792103_2792307_-	cold-shock protein	NA	A0A218MMZ6	uncultured_virus	51.5	1.3e-13
WP_050820224.1|2792450_2793119_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_050820441.1|2793329_2793623_+	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	57.0	1.9e-21
WP_050820225.1|2793676_2795317_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	59.1	7.7e-165
WP_050820226.1|2795535_2796834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155468044.1|2796788_2797697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155468046.1|2797681_2797837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050820228.1|2797875_2798250_+	capsular biosynthesis protein	NA	M4QRS4	Synechococcus_phage	42.4	1.4e-18
WP_050820229.1|2798265_2799849_+	phosphotransferase	NA	B2ZYD9	Ralstonia_phage	28.5	4.8e-39
