The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010106	Bacillus thuringiensis serovar indiana strain HD521 chromosome, complete genome	5429688	246772	254720	5429688		uncultured_virus(33.33%)	6	NA	NA
WP_000917311.1|246772_247057_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	54.8	1.2e-20
WP_001029993.1|247095_248730_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	58.0	1.5e-157
WP_000743906.1|249136_250675_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.7	8.8e-22
WP_050821493.1|251060_252386_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.2	1.2e-43
WP_000929887.1|252529_253231_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.4	7.3e-40
WP_000719212.1|253214_254720_+	aminopeptidase AmpS	NA	W8CYF6	Bacillus_phage	30.7	1.1e-32
>prophage 2
NZ_CP010106	Bacillus thuringiensis serovar indiana strain HD521 chromosome, complete genome	5429688	298677	307053	5429688		Synechococcus_phage(50.0%)	8	NA	NA
WP_000625682.1|298677_299985_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	4.9e-21
WP_001170544.1|300073_300793_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.3	4.0e-49
WP_000278823.1|300785_301040_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000666787.1|301036_301720_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000055565.1|301703_303923_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	2.0e-163
WP_000879025.1|303907_305323_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	3.3e-55
WP_001262439.1|305428_306469_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.9	1.2e-67
WP_000088596.1|306465_307053_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.4	4.5e-27
>prophage 3
NZ_CP010106	Bacillus thuringiensis serovar indiana strain HD521 chromosome, complete genome	5429688	1811793	1819947	5429688		Bacillus_phage(66.67%)	7	NA	NA
WP_000755513.1|1811793_1813080_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	31.5	3.4e-11
WP_001194306.1|1813179_1813944_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000453867.1|1814184_1815945_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	98.2	1.4e-273
WP_000612414.1|1816030_1816708_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	99.1	1.1e-122
WP_001231622.1|1816704_1817778_+	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	97.8	1.0e-186
WP_000818985.1|1818067_1818787_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_001258503.1|1819074_1819947_+	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	45.5	5.6e-66
>prophage 4
NZ_CP010106	Bacillus thuringiensis serovar indiana strain HD521 chromosome, complete genome	5429688	1992522	2029721	5429688	integrase,tail,portal,terminase,capsid	Bacillus_phage(44.44%)	46	1990569:1990584	2035630:2035645
1990569:1990584	attL	ATTAAATACAACTTCA	NA	NA	NA	NA
WP_000427801.1|1992522_1992798_+	stage V sporulation protein S	NA	J9PTX7	Bacillus_phage	41.2	2.9e-08
WP_000478848.1|1992995_1993259_+	hypothetical protein	NA	A0A218KBU4	Bacillus_phage	38.9	3.4e-06
WP_000456233.1|1993906_1994254_-	YolD-like family protein	NA	A0A2H4JEH6	uncultured_Caudovirales_phage	27.5	3.0e-10
WP_000109862.1|1994440_1995514_+	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	42.0	6.9e-74
WP_000709202.1|1995510_1995636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050821774.1|1996060_1997197_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0T6A8	Bacillus_phage	40.5	8.1e-65
WP_050821775.1|1997217_1997736_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	39.9	4.0e-27
WP_050821776.1|1998120_1998786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050821777.1|1998830_1999823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050821778.1|1999965_2000319_-	helix-turn-helix transcriptional regulator	NA	A0A0P0IZG9	Lactobacillus_phage	37.4	2.5e-12
WP_050821779.1|2000469_2000694_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_050821780.1|2000716_2001016_+	DNA-binding protein	NA	A0A2H4JDL0	uncultured_Caudovirales_phage	34.9	4.1e-08
WP_050821781.1|2001083_2001599_+	helix-turn-helix transcriptional regulator	NA	A0A290FZK9	Caldibacillus_phage	24.7	6.8e-11
WP_000151148.1|2001629_2001851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050821782.1|2002029_2002314_+	hypothetical protein	NA	D2XR42	Bacillus_phage	57.4	7.0e-26
WP_050821783.1|2002431_2003415_+	DnaD domain protein	NA	A6M985	Geobacillus_virus	46.9	5.2e-52
WP_001125988.1|2003425_2003788_+	hypothetical protein	NA	D2XR47	Bacillus_phage	75.8	1.4e-47
WP_050821784.1|2003859_2004051_+	DUF3954 domain-containing protein	NA	D2XR48	Bacillus_phage	65.1	2.4e-14
WP_080989184.1|2004119_2005703_-	exosporium leader peptide-containing protein	NA	A0A288WFW9	Bacillus_phage	89.7	1.8e-06
WP_001163834.1|2006509_2007082_-	cupin domain-containing protein	NA	Q2Q459	Bacillus_phage	85.8	4.3e-91
WP_050821785.1|2008203_2009520_-	collagen-like protein	NA	A0A285PWR0	Cedratvirus	62.6	4.4e-38
WP_050821787.1|2011091_2011574_+	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	83.1	8.5e-72
WP_050821788.1|2011573_2012116_+|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	87.2	3.4e-85
WP_016117709.1|2012329_2013280_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_050821789.1|2014091_2015261_+	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	28.9	1.6e-23
WP_000930969.1|2015602_2015821_+	hypothetical protein	NA	H0USV5	Bacillus_phage	66.2	5.2e-21
WP_001068927.1|2016255_2016462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000418198.1|2016730_2017135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000244508.1|2017134_2017350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000576169.1|2017509_2018082_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	48.3	5.4e-41
WP_000390790.1|2018133_2018313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050821790.1|2018334_2019195_+|terminase	terminase	terminase	A0A0A8WJN3	Clostridium_phage	45.6	3.8e-30
WP_000072122.1|2019187_2020594_+	DEAD/DEAH box helicase family protein	NA	A0A0A8WEW2	Clostridium_phage	63.7	2.0e-169
WP_050821791.1|2020661_2022137_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_000496054.1|2022250_2022769_+|capsid	minor capsid protein	capsid	Q1WDG7	Streptomyces_phage	34.4	8.4e-09
WP_050821792.1|2022871_2024077_+	hypothetical protein	NA	A0A1B1IMM2	Lactococcus_phage	33.8	3.1e-38
WP_050821793.1|2024092_2025079_+	XkdG	NA	H7BVA6	unidentified_phage	44.2	4.3e-70
WP_000869887.1|2025249_2025414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050821794.1|2025413_2025950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050821795.1|2025946_2026318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000024034.1|2026324_2026735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050821796.1|2026738_2027161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000118571.1|2027173_2027776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050821797.1|2027833_2028364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050821798.1|2028315_2028750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050821799.1|2028782_2029721_+|tail	phage tail tape measure protein	tail	A0A1C8E982	Bacillus_phage	65.8	5.3e-70
2035630:2035645	attR	ATTAAATACAACTTCA	NA	NA	NA	NA
>prophage 5
NZ_CP010106	Bacillus thuringiensis serovar indiana strain HD521 chromosome, complete genome	5429688	2317809	2355583	5429688	portal,tail,terminase,holin	Bacillus_phage(69.23%)	47	NA	NA
WP_000843025.1|2317809_2318091_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	59.0	3.0e-13
WP_050821837.1|2318092_2318290_+	hypothetical protein	NA	A0A1L2JY50	Aeribacillus_phage	48.3	3.9e-07
WP_145974768.1|2318286_2318484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050821838.1|2318491_2319217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050821839.1|2319340_2319523_+	hypothetical protein	NA	A0A1B1P7M4	Bacillus_phage	64.0	3.7e-12
WP_050821840.1|2319512_2319863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050821841.1|2320097_2320478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050821842.1|2320884_2321445_+	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	51.6	3.3e-43
WP_050821843.1|2321657_2322095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086032.1|2322226_2322655_+	hypothetical protein	NA	A0A2H4J6Z8	uncultured_Caudovirales_phage	51.1	1.2e-32
WP_050821844.1|2322671_2324387_+|terminase	phage terminase large subunit	terminase	A0A142F1L6	Bacillus_phage	52.5	2.1e-149
WP_050821845.1|2324403_2325921_+|portal	phage portal protein	portal	A0A142F1L7	Bacillus_phage	30.0	8.9e-67
WP_050821846.1|2325979_2326759_+	scaffolding protein	NA	Q4ZC70	Staphylococcus_virus	40.0	1.6e-08
WP_001145078.1|2326819_2327944_+	DUF5309 family protein	NA	NA	NA	NA	NA
WP_000027967.1|2327993_2328218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000868477.1|2328247_2328589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050821847.1|2328593_2329400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000954644.1|2329403_2329778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050821848.1|2329777_2330137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000930922.1|2330139_2330547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050821849.1|2330560_2331067_+|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_050821850.1|2331090_2331450_+	hypothetical protein	NA	A0A0A7AQ61	Bacillus_phage	85.7	2.2e-40
WP_000762691.1|2331436_2331652_+	hypothetical protein	NA	H0USV9	Bacillus_phage	97.1	2.3e-29
WP_000818630.1|2331719_2332097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000931848.1|2332186_2332441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050822201.1|2332477_2336374_+|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	48.8	5.5e-12
WP_050821851.1|2336388_2337873_+|tail	phage tail protein	tail	A0A0A7AQV1	Bacillus_phage	54.4	2.2e-139
WP_050821852.1|2337869_2342186_+	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	56.7	0.0e+00
WP_016123141.1|2342197_2342566_+	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	73.5	2.0e-41
WP_050821853.1|2342603_2342888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050821854.1|2342902_2343133_+|holin	phage holin	holin	A0A0S2MVE8	Bacillus_phage	92.1	6.9e-32
WP_050821855.1|2343149_2343860_+	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A0S2MVR5	Bacillus_phage	95.1	1.9e-88
WP_050821856.1|2343946_2345608_-	hypothetical protein	NA	A0A1S5SA14	Streptococcus_phage	29.7	1.5e-30
WP_050821857.1|2345680_2346007_-	hypothetical protein	NA	A0A0S2GLG3	Bacillus_phage	47.2	8.7e-20
WP_050821858.1|2346083_2346350_-	helix-turn-helix transcriptional regulator	NA	A0A288WFZ7	Bacillus_phage	60.5	1.2e-19
WP_118043470.1|2346504_2346627_+	DUF3961 domain-containing protein	NA	Q3HKZ4	Bacillus_phage	67.6	2.0e-09
WP_044797551.1|2347269_2347461_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_050821859.1|2347625_2347892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050821860.1|2347891_2348194_+	hypothetical protein	NA	A0A288WG08	Bacillus_phage	57.1	4.0e-27
WP_050821861.1|2348190_2348373_+	hypothetical protein	NA	Q2I8E2	Bacillus_phage	88.3	1.5e-21
WP_044797546.1|2348488_2349673_+	cell division protein FtsK	NA	A0A288WFS1	Bacillus_phage	62.4	1.8e-139
WP_050821862.1|2349614_2350235_+	hypothetical protein	NA	H0USY2	Bacillus_phage	79.8	8.6e-93
WP_050821863.1|2350340_2350808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044797544.1|2351150_2352614_+	recombinase family protein	NA	A0A288WFZ3	Bacillus_phage	50.5	1.5e-135
WP_050821864.1|2352619_2352913_-	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_000691162.1|2353159_2353846_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_002098415.1|2354218_2355583_+	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	36.6	5.2e-58
>prophage 6
NZ_CP010106	Bacillus thuringiensis serovar indiana strain HD521 chromosome, complete genome	5429688	3461472	3476368	5429688		Bacillus_phage(80.0%)	8	NA	NA
WP_050822035.1|3461472_3463056_-	hypothetical protein	NA	A7KUT6	Bacillus_phage	25.6	4.2e-27
WP_001232162.1|3463071_3463872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000861690.1|3463871_3464360_-	hypothetical protein	NA	A7KUS4	Bacillus_phage	41.2	7.9e-09
WP_001001211.1|3464363_3464933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001010565.1|3464947_3465313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000224635.1|3465543_3466872_-	M23 family metallopeptidase	NA	A0A1D8EVX2	Mycobacterium_phage	43.1	8.5e-13
WP_000057446.1|3466846_3468907_-	transglycosylase SLT domain-containing protein	NA	A7KUS1	Bacillus_phage	37.6	2.1e-18
WP_050822036.1|3469006_3476368_-	hypothetical protein	NA	A7KUS1	Bacillus_phage	35.6	2.3e-27
>prophage 7
NZ_CP010106	Bacillus thuringiensis serovar indiana strain HD521 chromosome, complete genome	5429688	3764494	3884104	5429688	integrase,tail,protease,coat,portal,terminase,head,tRNA,holin,capsid	Bacillus_phage(52.0%)	109	3787814:3787831	3883351:3883368
WP_000878485.1|3764494_3764851_-|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_000454968.1|3764884_3766318_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000006451.1|3766504_3766696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001274917.1|3766915_3767623_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001212117.1|3767653_3769063_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	29.8	7.3e-55
WP_000066293.1|3769254_3770244_-	phosphatidylinositol diacylglycerol-lyase	NA	NA	NA	NA	NA
WP_000689190.1|3770423_3772265_-	peptidase	NA	NA	NA	NA	NA
WP_000771177.1|3772556_3773354_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A172JHR8	Bacillus_phage	39.0	1.6e-35
WP_000272402.1|3773619_3774957_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_000791024.1|3775460_3777380_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	37.5	2.1e-97
WP_001235304.1|3777426_3780210_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_000461138.1|3780714_3780900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000516465.1|3781163_3783107_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	29.6	1.3e-62
WP_000196029.1|3783115_3785788_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	24.5	7.9e-34
WP_001288799.1|3785967_3786510_-|coat	outer spore coat protein CotE	coat	NA	NA	NA	NA
WP_000870461.1|3786635_3787067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001005375.1|3787070_3788600_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
3787814:3787831	attL	GTAACGTAATTTCTTTAT	NA	NA	NA	NA
WP_050822059.1|3788975_3789851_-	2-oxoacid:ferredoxin oxidoreductase subunit beta	NA	NA	NA	NA	NA
WP_000625417.1|3789837_3791595_-	2-oxoacid:acceptor oxidoreductase subunit alpha	NA	NA	NA	NA	NA
WP_000688036.1|3791819_3792743_-	membrane dipeptidase	NA	NA	NA	NA	NA
WP_000404341.1|3792801_3793062_-	stage V sporulation protein SpoVS	NA	J9PTX7	Bacillus_phage	43.8	8.4e-10
WP_001221095.1|3793211_3794006_-	TIGR00282 family metallophosphoesterase	NA	NA	NA	NA	NA
WP_000099770.1|3794168_3795734_-	ribonuclease Y	NA	NA	NA	NA	NA
WP_001115373.1|3796214_3796640_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	68.9	2.7e-45
WP_000990696.1|3797715_3798954_-	competence/damage-inducible protein CinA	NA	NA	NA	NA	NA
WP_001052967.1|3798974_3799553_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000137459.1|3799617_3800544_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000574107.1|3800565_3801351_-	DUF3388 domain-containing protein	NA	NA	NA	NA	NA
WP_000114450.1|3801489_3801738_-	DUF3243 domain-containing protein	NA	NA	NA	NA	NA
WP_000761056.1|3801813_3802527_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000411984.1|3802627_3803914_-	insulinase family protein	NA	A0A2H4UVM3	Bodo_saltans_virus	28.9	1.7e-10
WP_050822060.1|3803914_3805189_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	30.1	9.2e-57
WP_000008857.1|3805398_3806358_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001085254.1|3806358_3807417_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000456907.1|3807409_3808942_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.6	2.8e-12
WP_000725762.1|3809059_3810136_-	BMP family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000114182.1|3810228_3810954_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001118776.1|3811491_3813873_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	51.4	2.0e-89
WP_000605020.1|3814085_3814289_-	ribonuclease	NA	NA	NA	NA	NA
WP_000139806.1|3814285_3815035_-	translocation-enhancing protein TepA	NA	NA	NA	NA	NA
WP_000823096.1|3815136_3816807_-	ribonuclease J	NA	NA	NA	NA	NA
WP_000564763.1|3817543_3818422_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_000692451.1|3818433_3819666_-	aspartate kinase	NA	NA	NA	NA	NA
WP_000414846.1|3819689_3820736_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_086424262.1|3820886_3821123_-	dipicolinate synthase	NA	NA	NA	NA	NA
WP_050822061.1|3821312_3823031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000050864.1|3823045_3823534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050822062.1|3824037_3824748_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A0S2MVR5	Bacillus_phage	95.7	5.0e-89
WP_000373869.1|3824747_3825173_-|holin	phage holin family protein	holin	A0A1B1P787	Bacillus_phage	99.3	9.7e-72
WP_050822063.1|3825188_3826148_-|integrase	tyrosine-type recombinase/integrase	integrase	I7IDI7	Bacillus_phage	95.3	1.4e-174
WP_050822064.1|3826249_3826621_-	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	58.3	1.6e-33
WP_050822065.1|3826636_3830998_-	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	50.6	0.0e+00
WP_050822066.1|3830994_3832458_-|tail	phage tail family protein	tail	A0A0S2MV63	Bacillus_phage	58.3	2.0e-164
WP_050822067.1|3832499_3834914_-|tail	phage tail tape measure protein	tail	A0A2H4JC82	uncultured_Caudovirales_phage	87.9	2.5e-164
WP_050822068.1|3835168_3836380_-	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	91.6	6.0e-199
WP_050822069.1|3836610_3836973_-	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	85.8	4.6e-54
WP_001004914.1|3836977_3837565_-|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	81.0	3.3e-86
WP_050822070.1|3837565_3837895_-	hypothetical protein	NA	D2XR22	Bacillus_phage	94.5	2.7e-53
WP_000997567.1|3837894_3838236_-	HK97 gp10 family phage protein	NA	D2XR21	Bacillus_phage	95.6	4.3e-54
WP_001247277.1|3838237_3838591_-|head	phage head closure protein	head	A0A2H4JGG7	uncultured_Caudovirales_phage	94.8	8.7e-58
WP_050822071.1|3838592_3838886_-	hypothetical protein	NA	D2XR19	Bacillus_phage	90.7	1.0e-43
WP_050822072.1|3838898_3840062_-|capsid	phage major capsid protein	capsid	A0A2H4JH29	uncultured_Caudovirales_phage	84.8	7.3e-186
WP_050822073.1|3840082_3840859_-|protease	Clp protease ClpP	protease	A0A0A7RWX3	Clostridium_phage	57.7	5.6e-57
WP_050822216.1|3840842_3841949_-|portal	phage portal protein	portal	A0A2H4JAJ1	uncultured_Caudovirales_phage	88.8	1.7e-184
WP_050822074.1|3842015_3843674_-|terminase	terminase large subunit	terminase	A0A2H4JHE9	uncultured_Caudovirales_phage	79.3	7.8e-258
WP_000124846.1|3843670_3844006_-	hypothetical protein	NA	A0A1B1P762	Bacillus_phage	31.2	3.0e-07
WP_050822075.1|3844157_3844493_-	HNH endonuclease	NA	D2XR61	Bacillus_phage	91.0	6.1e-53
WP_153601825.1|3844781_3844958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050822076.1|3844991_3846101_-	serine/threonine protein kinase	NA	B0FEC2	Escherichia_phage	34.1	1.3e-51
WP_050822077.1|3846049_3846553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050822078.1|3846808_3847453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000434821.1|3848068_3848269_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.2	2.4e-20
WP_050822079.1|3848390_3848933_-|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	91.7	5.0e-89
WP_050822080.1|3848932_3849397_-	ArpU family transcriptional regulator	NA	D2XR57	Bacillus_phage	92.9	3.0e-74
WP_050822082.1|3850944_3851223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050822083.1|3852308_3852716_+	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_016077319.1|3852824_3853016_-	DUF3954 domain-containing protein	NA	D2XR48	Bacillus_phage	63.5	1.1e-14
WP_050822084.1|3853088_3853451_-	hypothetical protein	NA	D2XR47	Bacillus_phage	89.2	1.1e-55
WP_050822085.1|3853425_3853614_-	hypothetical protein	NA	D2XR45	Bacillus_phage	83.6	2.8e-15
WP_050822086.1|3853616_3854939_-	replicative DNA helicase	NA	D2XR44	Bacillus_phage	95.5	4.6e-237
WP_050822087.1|3854935_3855886_-	DnaD domain protein	NA	D2XR43	Bacillus_phage	60.5	6.1e-74
WP_050822088.1|3856165_3856450_-	hypothetical protein	NA	D2XR42	Bacillus_phage	54.3	5.6e-23
WP_000215310.1|3856630_3856852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050822089.1|3856865_3857453_-	hypothetical protein	NA	D2XR41	Bacillus_phage	68.7	8.4e-74
WP_050822090.1|3857543_3857792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050822091.1|3857846_3858035_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J4N8	uncultured_Caudovirales_phage	54.2	9.4e-11
WP_050822092.1|3858190_3858625_+	helix-turn-helix transcriptional regulator	NA	D2XR39	Bacillus_phage	54.6	2.5e-30
WP_050822093.1|3858637_3859066_+	ImmA/IrrE family metallo-endopeptidase	NA	D2XR38	Bacillus_phage	80.3	4.6e-61
WP_050822094.1|3859108_3859996_+	hypothetical protein	NA	A0A1C8E993	Bacillus_phage	67.4	2.8e-52
WP_050822095.1|3860067_3860703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050822096.1|3860832_3862380_+	recombinase family protein	NA	I3VYZ3	Thermoanaerobacterium_phage	53.4	3.0e-142
WP_000954735.1|3862834_3863737_-	dipicolinic acid synthetase subunit A	NA	NA	NA	NA	NA
WP_001239756.1|3863907_3864159_-	YlmC/YmxH family sporulation protein	NA	NA	NA	NA	NA
WP_000592989.1|3864293_3865535_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	34.5	4.4e-56
WP_000868232.1|3865621_3866521_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000076754.1|3866675_3868814_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001229392.1|3868974_3869244_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_000766702.1|3869344_3870316_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_000399348.1|3870359_3871283_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_000776437.1|3871369_3871726_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_000582363.1|3871741_3872023_-	DUF503 family protein	NA	NA	NA	NA	NA
WP_000036343.1|3872019_3874080_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.9	3.8e-20
WP_001286524.1|3874084_3874396_-	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_000071127.1|3874396_3874669_-	YlxR family protein	NA	NA	NA	NA	NA
WP_000102604.1|3874680_3875787_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000359096.1|3875804_3876275_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000060005.1|3876611_3880913_-	PolC-type DNA polymerase III	NA	A0A0A8WJ41	Clostridium_phage	39.6	4.1e-24
WP_000814315.1|3881037_3882738_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001090243.1|3882847_3884104_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
3883351:3883368	attR	GTAACGTAATTTCTTTAT	NA	NA	NA	NA
>prophage 8
NZ_CP010106	Bacillus thuringiensis serovar indiana strain HD521 chromosome, complete genome	5429688	4532678	4540364	5429688		Staphylococcus_phage(16.67%)	9	NA	NA
WP_000221067.1|4532678_4533602_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.5	1.5e-45
WP_000609141.1|4533727_4534663_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.8	1.2e-21
WP_000018029.1|4534664_4535357_-	response regulator transcription factor	NA	B5LWA6	Feldmannia_species_virus	28.8	1.4e-06
WP_001014310.1|4535699_4535894_+	YwbE family protein	NA	NA	NA	NA	NA
WP_050822116.1|4535932_4537132_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.2	9.5e-72
WP_000587818.1|4537427_4537751_+	heme oxygenase	NA	NA	NA	NA	NA
WP_048533848.1|4537823_4538588_-	class B sortase	NA	NA	NA	NA	NA
WP_050822117.1|4538620_4539391_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.6	9.9e-14
WP_003310941.1|4539380_4540364_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.9	6.5e-18
>prophage 1
NZ_CP010108	Bacillus thuringiensis serovar indiana strain HD521 plasmid pBTHD521-2, complete sequence	49838	68	49754	49838	portal,integrase,terminase,holin,tail	Bacillus_phage(90.74%)	67	13231:13247	49803:49819
WP_050822230.1|68_1241_+	hypothetical protein	NA	A0A1B1P786	Bacillus_phage	44.1	7.6e-82
WP_158336184.1|1355_1499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153601949.1|1620_1785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050822231.1|1802_2237_-	helix-turn-helix transcriptional regulator	NA	A0A1B1P7A0	Bacillus_phage	56.2	4.4e-35
WP_050822232.1|2427_2628_+	helix-turn-helix transcriptional regulator	NA	A0A1B1P7A4	Bacillus_phage	57.9	2.2e-10
WP_050822233.1|2788_2977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050822234.1|2985_3513_+	Holliday junction resolvase RecU	NA	A0A1B1P798	Bacillus_phage	79.8	6.4e-81
WP_050822235.1|3524_4037_+	hypothetical protein	NA	A0A1B1P794	Bacillus_phage	57.6	2.6e-47
WP_080989212.1|4090_4507_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A1B1P791	Bacillus_phage	71.7	6.3e-15
WP_050822236.1|4534_4909_+	hypothetical protein	NA	A0A1B1P7A1	Bacillus_phage	74.2	6.6e-48
WP_050822237.1|4926_5739_+	hypothetical protein	NA	A0A1B1P796	Bacillus_phage	66.3	1.4e-98
WP_080989213.1|5738_5879_+	Fur-regulated basic protein FbpA	NA	A0A1B1P7A8	Bacillus_phage	69.8	1.1e-08
WP_050822238.1|5879_6344_+	hypothetical protein	NA	A0A1B1P7B7	Bacillus_phage	68.2	3.7e-56
WP_050822239.1|6481_7108_+	hypothetical protein	NA	A0A288WG53	Bacillus_phage	57.2	1.1e-58
WP_050822240.1|7147_7402_+	hypothetical protein	NA	A0A1B1P779	Bacillus_phage	88.0	2.5e-38
WP_050822241.1|7438_7771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050822242.1|7798_8047_+	hypothetical protein	NA	A0A2H4JC71	uncultured_Caudovirales_phage	93.9	4.4e-40
WP_050822243.1|8083_8311_+	hypothetical protein	NA	A0A288WFX6	Bacillus_phage	98.7	4.6e-36
WP_050822244.1|8330_8561_+	hypothetical protein	NA	A0A0E3TAK6	Staphylococcus_phage	63.5	6.7e-19
WP_050822245.1|8563_9151_+	HNH endonuclease	NA	A0A1S5SBA6	Streptococcus_phage	38.1	2.1e-32
WP_050822246.1|9182_9308_+	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_050822247.1|9333_9615_+	hypothetical protein	NA	A0A1B1P7B9	Bacillus_phage	57.5	1.2e-20
WP_050822248.1|9826_10333_+	ArpU family transcriptional regulator	NA	A0A1B1P7B2	Bacillus_phage	83.2	1.4e-69
WP_050822249.1|11254_11488_+	hypothetical protein	NA	H0USW0	Bacillus_phage	52.5	5.4e-16
WP_050822250.1|11507_12035_+	ParB N-terminal domain-containing protein	NA	A0A1B1P7B5	Bacillus_phage	80.7	1.0e-78
WP_050822251.1|12047_13079_+	DNA cytosine methyltransferase	NA	A0A1B1P7C6	Bacillus_phage	85.1	1.5e-179
WP_050822252.1|13230_13464_+	hypothetical protein	NA	A0A1B1P7D4	Bacillus_phage	74.0	2.1e-23
13231:13247	attL	ATGAAAAACACTAAACA	NA	NA	NA	NA
WP_050822288.1|13596_13737_+	BC1881 family protein	NA	NA	NA	NA	NA
WP_050822253.1|13750_13984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050822254.1|14043_14985_+	hypothetical protein	NA	A0A1B1P7C9	Bacillus_phage	74.8	1.3e-103
WP_050822255.1|14989_15826_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P7C7	Bacillus_phage	88.5	1.5e-140
WP_050822256.1|16077_16278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050822257.1|16283_16625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050822258.1|16676_18140_+|terminase	terminase B	terminase	A0A1B1P7D5	Bacillus_phage	84.8	4.6e-246
WP_050822259.1|18156_19683_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	71.5	5.7e-215
WP_050822260.1|19698_20619_+	hypothetical protein	NA	A0A1B1P7D7	Bacillus_phage	49.2	2.5e-72
WP_050822261.1|20718_21915_+	hypothetical protein	NA	A0A1B1P7E4	Bacillus_phage	74.7	1.6e-156
WP_050822262.1|21942_22878_+	hypothetical protein	NA	A0A1B1P7E3	Bacillus_phage	84.7	2.1e-143
WP_050822263.1|22889_23213_+	hypothetical protein	NA	A0A1B1P7E2	Bacillus_phage	61.3	8.6e-28
WP_050822264.1|23218_23635_+	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	57.2	2.4e-38
WP_050822265.1|23637_24012_+	hypothetical protein	NA	A0A1B1P7D8	Bacillus_phage	51.6	6.9e-29
WP_050822289.1|24011_24425_+	hypothetical protein	NA	A0A1B1P7D0	Bacillus_phage	70.1	3.3e-48
WP_050822266.1|24435_24789_+	hypothetical protein	NA	A0A1B1P7D3	Bacillus_phage	75.0	2.3e-50
WP_050822267.1|24803_25052_+	hypothetical protein	NA	A0A1B1P7E7	Bacillus_phage	59.8	3.0e-20
WP_050822268.1|25051_25864_+	hypothetical protein	NA	A0A1B1P7D9	Bacillus_phage	71.1	3.2e-103
WP_050822269.1|25896_26391_+	hypothetical protein	NA	A0A1B1P7E5	Bacillus_phage	44.1	9.1e-29
WP_050822270.1|26453_26744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050822271.1|26783_31814_+|tail	phage tail tape measure protein	tail	A0A1B1P7S6	Bacillus_phage	73.5	0.0e+00
WP_050822272.1|31825_33316_+|tail	phage tail protein	tail	A0A0S2MV63	Bacillus_phage	58.2	3.9e-168
WP_050822273.1|33312_38307_+	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	55.2	0.0e+00
WP_050822274.1|38318_38699_+	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	72.5	1.4e-42
WP_001115042.1|38734_38974_+	peptidase	NA	A0A1B1P7E0	Bacillus_phage	100.0	7.4e-37
WP_050822275.1|39016_39247_+|holin	phage holin	holin	A0A0S2MVE8	Bacillus_phage	96.1	2.2e-33
WP_050822062.1|39263_39974_+	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A0S2MVR5	Bacillus_phage	95.7	5.0e-89
WP_050822276.1|40709_40979_+	helix-turn-helix domain-containing protein	NA	A0A2H4JDR0	uncultured_Caudovirales_phage	49.4	7.6e-14
WP_050822277.1|40990_41365_-	hypothetical protein	NA	D2XQ01	Bacillus_virus	55.9	9.6e-31
WP_080989214.1|41406_41715_-	YolD-like family protein	NA	NA	NA	NA	NA
WP_050822279.1|42449_42758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050822280.1|42873_43413_-	hypothetical protein	NA	A0A1B1P777	Bacillus_phage	85.5	1.2e-82
WP_050822281.1|43428_43668_-	hypothetical protein	NA	A0A1B1P789	Bacillus_phage	83.5	2.5e-32
WP_050822282.1|43760_44123_-	hypothetical protein	NA	A0A1B1P795	Bacillus_phage	87.5	9.5e-52
WP_050822283.1|44132_45248_-	ParM/StbA family protein	NA	A0A1B1P792	Bacillus_phage	93.0	8.2e-195
WP_050822284.1|45388_46357_-|integrase	site-specific integrase	integrase	A0A1B1P793	Bacillus_phage	74.1	7.5e-136
WP_050822290.1|46446_46998_-	hypothetical protein	NA	A0A1B1P785	Bacillus_phage	67.4	2.2e-47
WP_050822285.1|47108_47387_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_145974771.1|47544_48669_-	DnaD domain protein	NA	A0A1B1P784	Bacillus_phage	55.5	2.5e-90
WP_000532685.1|49514_49754_-	hypothetical protein	NA	A0A1B1P790	Bacillus_phage	78.5	2.7e-26
49803:49819	attR	TGTTTAGTGTTTTTCAT	NA	NA	NA	NA
>prophage 1
NZ_CP010109	Bacillus thuringiensis serovar indiana strain HD521 plasmid pBTHD521-3, complete sequence	71771	188	45920	71771	terminase,holin,head,tail,portal	Bacillus_phage(69.05%)	58	NA	NA
WP_000142654.1|188_458_+	helix-turn-helix transcriptional regulator	NA	B5LPU7	Bacillus_virus	84.8	2.4e-28
WP_000444008.1|632_1169_+	hypothetical protein	NA	E5DV63	Deep-sea_thermophilic_phage	44.1	2.4e-27
WP_050822291.1|1739_1988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000572098.1|2338_2539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050822292.1|2734_3367_+	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	39.4	2.5e-31
WP_050822293.1|3558_3780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050822294.1|3780_4638_+	hypothetical protein	NA	A0A218KCJ2	Bacillus_phage	31.6	3.2e-37
WP_050822295.1|4621_5380_+	ATP-binding protein	NA	U5PVD6	Bacillus_phage	38.8	6.3e-37
WP_050822296.1|5394_5658_+	hypothetical protein	NA	A0A1B1P8D7	Bacillus_phage	63.8	6.1e-16
WP_002094320.1|5614_5860_+	hypothetical protein	NA	A0A1B1P7W1	Bacillus_phage	87.2	1.4e-30
WP_050822297.1|5856_6120_+	hypothetical protein	NA	A0A0S2GLK4	Bacillus_phage	60.2	9.7e-22
WP_001145518.1|7492_7681_-	hypothetical protein	NA	A0A288WGN0	Bacillus_phage	64.8	8.8e-09
WP_050822298.1|7793_8423_+	Holliday junction resolvase RecU	NA	A0A2H4J3A4	uncultured_Caudovirales_phage	59.8	8.5e-48
WP_000441085.1|8561_8948_+	ArpU family transcriptional regulator	NA	A0A1B1P853	Bacillus_phage	44.8	4.5e-23
WP_000218072.1|9006_9345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050822307.1|10413_10767_+	DUF2513 domain-containing protein	NA	A0A1Q1PVT8	Staphylococcus_phage	29.0	3.1e-07
WP_001250601.1|11173_11365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000539630.1|11582_11795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001018891.1|12086_12662_+	recombinase family protein	NA	I1ZBD6	Salisaeta_icosahedral_phage	40.9	1.4e-28
WP_074595344.1|12851_13109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000265603.1|13240_13462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000810413.1|14043_14802_+	hypothetical protein	NA	D2XPX8	Bacillus_virus	60.3	3.9e-55
WP_000062322.1|14798_16028_+|terminase	PBSX family phage terminase large subunit	terminase	A0A059T7K2	Staphylococcus_phage	62.7	1.2e-146
WP_000461485.1|16040_17465_+|portal	phage portal protein	portal	A0A0S2MVB2	Bacillus_phage	92.9	1.5e-257
WP_002099121.1|17538_18306_+|head	phage head protein	head	A0A0S2MVF0	Bacillus_phage	94.5	7.0e-137
WP_000811675.1|18380_19112_+	DUF4355 domain-containing protein	NA	A0A0A7AQU8	Bacillus_phage	62.7	1.9e-70
WP_000116909.1|19229_20075_+	hypothetical protein	NA	A0A0S2MVF8	Bacillus_phage	87.9	2.0e-137
WP_000654244.1|20118_20430_+	hypothetical protein	NA	A0A0A7AQX9	Bacillus_phage	89.0	6.3e-44
WP_000616218.1|20426_20771_+|head,tail	head-tail adaptor protein	head,tail	A0A0A7AR32	Bacillus_phage	92.1	1.1e-57
WP_000061894.1|20745_21153_+	HK97 gp10 family phage protein	NA	A0A0A7AQU9	Bacillus_phage	93.3	2.5e-64
WP_000997644.1|21158_21521_+	hypothetical protein	NA	A0A0S2MV90	Bacillus_phage	90.8	1.3e-56
WP_000729987.1|21535_22129_+	hypothetical protein	NA	A0A0S2MV81	Bacillus_phage	98.0	5.3e-108
WP_000150395.1|22175_22604_+	hypothetical protein	NA	A0A0A7AQY2	Bacillus_phage	94.4	1.1e-67
WP_050552134.1|22708_22915_+	hypothetical protein	NA	A0A0A7AQY2	Bacillus_phage	95.6	1.1e-31
WP_000418556.1|22915_25855_+|tail	phage tail tape measure protein	tail	A0A0A7AR36	Bacillus_phage	80.1	4.7e-282
WP_003318990.1|25867_27340_+	Phage-related protein	NA	A0A0A7AQV1	Bacillus_phage	68.5	1.1e-199
WP_080989217.1|27336_30027_+	hypothetical protein	NA	H0USX5	Bacillus_phage	75.2	3.9e-291
WP_080989218.1|29996_31655_+	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	64.2	2.0e-189
WP_001000911.1|31666_32035_+	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	61.5	1.3e-32
WP_000373887.1|32074_32500_+|holin	phage holin family protein	holin	A0A1B1P787	Bacillus_phage	95.0	1.6e-69
WP_000405788.1|32499_33435_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MVR5	Bacillus_phage	88.4	5.1e-166
WP_000957442.1|33635_33938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000056021.1|33963_35334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001057811.1|35403_35745_-	YolD-like family protein	NA	NA	NA	NA	NA
WP_025967161.1|35741_37007_-	Y-family DNA polymerase	NA	O64031	Bacillus_phage	48.1	1.9e-107
WP_000467326.1|37119_37341_-	helix-turn-helix transcriptional regulator	NA	A0A0S2GLH4	Bacillus_phage	78.1	8.4e-27
WP_000575736.1|37640_38936_+	cell division protein FtsK	NA	B3RH36	Bacillus_virus	45.4	1.8e-108
WP_080014686.1|38877_39453_+	hypothetical protein	NA	B3RH37	Bacillus_virus	64.2	2.8e-69
WP_000718642.1|39472_39961_+	hypothetical protein	NA	A6XML4	Bacillus_virus	53.8	6.7e-16
WP_000914192.1|40146_40578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000128983.1|40670_41258_+	DUF3967 domain-containing protein	NA	A0A1Z1LZN4	Bacillus_phage	35.4	3.9e-10
WP_000064366.1|41366_41867_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000820697.1|41929_42868_-	hypothetical protein	NA	V9QKZ6	Oenococcus_phage	37.6	7.3e-11
WP_000210486.1|43161_43632_+	NUDIX hydrolase	NA	D0R7J3	Paenibacillus_phage	37.7	6.2e-19
WP_000272494.1|43959_44148_+	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_000359170.1|44342_44600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000124665.1|44722_45097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001018642.1|45098_45920_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	44.2	4.4e-52
>prophage 1
NZ_CP010111	Bacillus thuringiensis serovar indiana strain HD521 plasmid pBTHD521-5, complete sequence	253580	64271	120471	253580	transposase,integrase	Bacillus_phage(29.41%)	57	65070:65085	127518:127533
WP_050822404.1|64271_64985_+|transposase	transposase	transposase	NA	NA	NA	NA
65070:65085	attL	TTATTTTTGTACAAAT	NA	NA	NA	NA
WP_017762474.1|65320_65950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017762473.1|65949_66585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000377388.1|66635_67250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050822405.1|67233_67818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080989226.1|67943_68327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050822406.1|68343_68982_+	NERD domain-containing protein	NA	A0A2R2ZH57	Clostridioides_phage	36.1	1.3e-22
WP_102947895.1|69180_69384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050822407.1|69835_70306_-	hypothetical protein	NA	A0A0K2CZD8	Paenibacillus_phage	43.4	1.9e-20
WP_080989227.1|70586_71948_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A142F1Q5	Bacillus_phage	37.4	2.2e-77
WP_050822409.1|73113_75777_+	type IA DNA topoisomerase	NA	A0A1V0SIB2	Klosneuvirus	20.6	1.3e-12
WP_050822411.1|76205_76850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001014125.1|76882_77083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050822412.1|77158_77446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050822413.1|77469_78225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050822414.1|78258_78696_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_000207868.1|78769_79063_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_050822415.1|79252_80344_+	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	45.6	4.6e-89
WP_050822416.1|80658_80976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050822417.1|80972_81350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050822418.1|81476_82097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050822420.1|83552_84530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080989229.1|84835_85261_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_080989245.1|85522_86347_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_050822421.1|87365_88778_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_050822422.1|88770_89502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050822531.1|90019_90352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050822423.1|90456_91563_+	tyrosine recombinase XerS	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	27.1	5.8e-07
WP_050822532.1|91799_92102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050822424.1|93065_93443_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_050822425.1|93501_95361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050822426.1|95599_96688_-	inositol-3-phosphate synthase	NA	A0A0H4IPK5	Stenotrophomonas_phage	42.2	3.5e-73
WP_050822427.1|96715_97348_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_050822428.1|97341_98304_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A0E3FNQ3	Synechococcus_phage	28.2	1.1e-17
WP_050822429.1|98325_98904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050822430.1|98940_100224_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_050822431.1|100225_101389_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_050822432.1|101385_102549_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_050822433.1|102523_103810_-	hypothetical protein	NA	A0A218MN59	uncultured_virus	28.8	1.3e-42
WP_050822434.1|103877_104984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050822435.1|105140_105938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050822436.1|105940_106741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050822437.1|106740_107745_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.8	2.5e-17
WP_050822533.1|108516_108942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050822438.1|109153_109747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050822439.1|109763_109988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050822440.1|111021_111534_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_050822441.1|111555_111906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050822442.1|112137_113181_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3T6D9	Bacillus_phage	23.1	3.4e-09
WP_050822443.1|113393_113720_+	helix-turn-helix transcriptional regulator	NA	A9D9J6	Lactobacillus_prophage	35.7	5.3e-09
WP_050822444.1|114286_114565_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A1B1P791	Bacillus_phage	31.1	1.1e-10
WP_000920508.1|114985_116074_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q332I1	Clostridium_botulinum_C_phage	69.6	1.0e-141
WP_000762772.1|116077_116482_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	68.4	2.4e-51
WP_003304273.1|116798_116993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050822445.1|117238_117511_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	66.7	3.1e-23
WP_050822446.1|118000_118516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050822447.1|119205_120471_+	Y-family DNA polymerase	NA	O64031	Bacillus_phage	48.6	2.5e-107
127518:127533	attR	TTATTTTTGTACAAAT	NA	NA	NA	NA
>prophage 2
NZ_CP010111	Bacillus thuringiensis serovar indiana strain HD521 plasmid pBTHD521-5, complete sequence	253580	128067	227937	253580	transposase,protease,integrase	Bacillus_phage(75.0%)	59	129818:129849	186658:186689
WP_050822456.1|128067_128748_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_050822457.1|128990_129374_-	hypothetical protein	NA	A0A0S2MVJ1	Bacillus_phage	34.2	9.6e-10
129818:129849	attL	GGGGTCACCATACATGCCCATCAACTTAAGAA	NA	NA	NA	NA
WP_050822458.1|132005_132257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050822534.1|133113_134196_-	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
WP_050822459.1|134225_135323_-	endospore germination permease	NA	NA	NA	NA	NA
WP_050822460.1|135361_136774_-	spore germination protein	NA	NA	NA	NA	NA
WP_050822461.1|137290_138691_+	helix-turn-helix domain containing protein	NA	NA	NA	NA	NA
WP_050822462.1|139233_139668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050822463.1|139876_140245_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_050822464.1|141109_141691_-	hypothetical protein	NA	A0A1B1P7T2	Bacillus_phage	46.5	1.9e-41
WP_080989234.1|142058_142259_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_080989235.1|142759_146194_-	pesticidal protein	NA	NA	NA	NA	NA
WP_050822466.1|146955_148386_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_050822467.1|148530_149010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145974775.1|149079_149475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050822469.1|149679_150204_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_080989246.1|151965_155346_-	pesticidal protein	NA	NA	NA	NA	NA
WP_153601960.1|156767_156902_+	exosporium leader peptide-containing protein	NA	NA	NA	NA	NA
WP_145974777.1|157083_157272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050822472.1|158511_158847_-	ETX/MTX2 family pore-forming toxin	NA	A0A2I7SC07	Paenibacillus_phage	57.9	7.5e-19
WP_050822473.1|158856_159135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050822474.1|159814_160726_-	ETX/MTX2 family pore-forming toxin	NA	NA	NA	NA	NA
WP_050822475.1|162006_162423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050822476.1|163376_166097_-	phosphodiesterase	NA	NA	NA	NA	NA
WP_050822478.1|173779_174037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050822479.1|174681_176337_-	peptidase M4 family protein	NA	NA	NA	NA	NA
WP_050822480.1|176854_177832_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	68.4	2.9e-135
WP_050822481.1|178065_179067_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_153601961.1|180836_181010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050822482.1|181436_181628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050822483.1|181873_182056_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_050822536.1|182021_182357_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	55.7	1.9e-09
WP_050822484.1|182566_183685_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	80.9	2.2e-171
WP_080989237.1|184136_185138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050822487.1|188531_189308_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
186658:186689	attR	GGGGTCACCATACATGCCCATCAACTTAAGAA	NA	NA	NA	NA
WP_050822488.1|189603_190104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162490181.1|192925_193216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050822491.1|195115_195613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080989241.1|196846_200242_+	pesticidal protein	NA	NA	NA	NA	NA
WP_145974778.1|200941_201223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050822493.1|201308_202175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050822494.1|202272_202614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050822495.1|202829_203951_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_080989247.1|203968_204370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050822497.1|204428_206675_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	29.3	8.9e-47
WP_050822498.1|206859_207855_-	DUF4046 domain-containing protein	NA	NA	NA	NA	NA
WP_050822499.1|208963_210658_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_050822501.1|211634_213347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050822502.1|214909_215209_-	DUF2325 domain-containing protein	NA	NA	NA	NA	NA
WP_050822503.1|215205_215589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033699716.1|215750_216326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050822504.1|216342_218556_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A7KUS1	Bacillus_phage	38.3	1.5e-14
WP_050822505.1|218552_222557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000765120.1|222587_224687_-	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_000892003.1|224689_225604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001233532.1|225604_225955_-	PrgI family protein	NA	NA	NA	NA	NA
WP_001216651.1|226021_226441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050822506.1|226557_226743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050822507.1|227001_227937_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP010112	Bacillus thuringiensis serovar indiana strain HD521 plasmid pBTHD521-6, complete sequence	314883	252174	261098	314883	transposase	Bacillus_phage(50.0%)	9	NA	NA
WP_050822710.1|252174_253938_-	sulfate permease	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.0	2.2e-37
WP_050822713.1|254038_254479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050822714.1|254468_254831_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_050822715.1|256129_256531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050822716.1|256769_257882_-	helix-turn-helix domain-containing protein	NA	A0A288TXV8	Enterococcus_phage	47.4	1.5e-79
WP_050822719.1|257893_258292_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	66.7	5.8e-50
WP_050822722.1|259123_259318_+	hypothetical protein	NA	W8CYN5	Bacillus_phage	54.7	7.9e-13
WP_050822724.1|259330_260497_+	DNA translocase FtsK	NA	W8CYG2	Bacillus_phage	83.2	2.4e-189
WP_050822726.1|260486_261098_+	hypothetical protein	NA	W8CZ47	Bacillus_phage	74.8	4.5e-86
