The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009230	Aggregatibacter aphrophilus NJ8700 chromosome, complete genome	2313256	467861	511604	2313256	head,integrase,tail,terminase,tRNA,portal,protease,capsid	Mannheimia_phage(25.71%)	64	478606:478625	514468:514487
WP_005700197.1|467861_469172_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_005700198.1|469216_470074_-	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_005700199.1|470136_471090_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_005700200.1|471657_472620_-	hypothetical protein	NA	K4F6D5	Cronobacter_phage	43.2	3.6e-29
WP_044055203.1|472814_473000_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_044055294.1|473014_473203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080987744.1|473424_473607_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_012771319.1|473712_473946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012771320.1|473947_474289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012771321.1|474346_475141_-	DUF2303 family protein	NA	NA	NA	NA	NA
WP_012771322.1|475209_475569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044055205.1|475648_476062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012771324.1|476064_476676_-	YqaJ viral recombinase family protein	NA	A0A0M3LPU0	Mannheimia_phage	72.3	3.9e-82
WP_012771325.1|476672_477455_-	phage recombination protein Bet	NA	A0A0M3LR26	Mannheimia_phage	59.5	6.0e-83
WP_012771326.1|477461_478424_-	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	47.3	1.1e-59
WP_012771327.1|478426_478591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012771328.1|478568_478850_-	hypothetical protein	NA	Q776W5	Haemophilus_phage	42.9	2.9e-08
478606:478625	attL	AAAAGTGCGGTGGTTTTTCG	NA	NA	NA	NA
WP_044055207.1|479695_480220_+	hypothetical protein	NA	Q7Y5W8	Haemophilus_phage	68.8	3.1e-59
WP_012771330.1|480313_480526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012771331.1|480903_481323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012771332.1|481312_481786_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_044055208.1|481797_482052_-	type II toxin-antitoxin system HicA family toxin	NA	K7PH44	Enterobacterial_phage	42.9	8.3e-10
WP_012771333.1|482205_482901_-	helix-turn-helix transcriptional regulator	NA	Q7Y5W5	Haemophilus_phage	64.0	4.3e-77
WP_012771334.1|483019_483232_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	52.2	5.6e-12
WP_012771335.1|483280_483724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012771336.1|483775_484483_+	phage antirepressor KilAC domain-containing protein	NA	D0UIL6	Aggregatibacter_phage	99.6	6.9e-131
WP_012771337.1|484479_485205_+	helix-turn-helix domain-containing protein	NA	D0UIL5	Aggregatibacter_phage	83.6	1.5e-96
WP_012771338.1|485201_485846_+	replication P	NA	D0UIL4	Aggregatibacter_phage	43.8	6.9e-37
WP_012771339.1|485842_486361_+	DNA N-6-adenine-methyltransferase	NA	D0UIL3	Aggregatibacter_phage	81.2	1.7e-78
WP_012771340.1|486330_486966_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	27.4	5.4e-18
WP_044055209.1|487032_487317_+	DUF1364 domain-containing protein	NA	A0A0M3LQ97	Mannheimia_phage	75.6	3.5e-33
WP_006718646.1|487313_487676_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	49.2	6.0e-30
WP_012771342.1|487668_488175_+	antitermination protein	NA	K7PHU3	Enterobacteria_phage	32.0	4.2e-13
WP_148207219.1|488332_488554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044055211.1|488550_489093_+	lysozyme	NA	I6PBN2	Cronobacter_phage	50.6	1.3e-36
WP_080987745.1|489044_489386_+	DUF2570 family protein	NA	NA	NA	NA	NA
WP_049756018.1|489291_489573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044055212.1|489614_489926_+	HNH endonuclease	NA	B5WZZ4	Pseudomonas_phage	51.7	2.4e-19
WP_012771347.1|490034_490499_+	hypothetical protein	NA	Q77WA1	Escherichia_phage	43.0	8.3e-16
WP_012771348.1|490498_492010_+|terminase	terminase large subunit	terminase	K7PLY2	Enterobacterial_phage	66.6	1.3e-190
WP_012771349.1|492006_493245_+|portal	phage portal protein	portal	A0A0R6PDY3	Moraxella_phage	66.8	5.2e-150
WP_012771350.1|493234_493894_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0R6PFZ5	Moraxella_phage	63.4	1.4e-72
WP_012771351.1|493895_495089_+|capsid	phage major capsid protein	capsid	A0A0R6PKI4	Moraxella_phage	66.8	2.4e-139
WP_044055213.1|495135_495450_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	38.8	2.4e-14
WP_044055215.1|495449_495773_+|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	47.2	2.6e-16
WP_012771353.1|495765_496248_+	HK97 gp10 family phage protein	NA	A0A220NRP5	Escherichia_phage	31.5	8.9e-13
WP_012771354.1|496249_496594_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_012771355.1|496597_497254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012771356.1|497315_497723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044055217.1|497767_497992_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_044055296.1|498077_498500_+	membrane lipoprotein lipid attachment site-containing protein	NA	NA	NA	NA	NA
WP_012771359.1|498591_498783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012771360.1|498841_502174_+	tape measure protein	NA	A0A2P1CKJ3	Pantoea_phage	22.6	1.3e-30
WP_012771361.1|502189_502525_+|tail	phage tail protein	tail	A0A1W6JNT2	Morganella_phage	36.7	3.6e-13
WP_012771362.1|502524_503259_+|tail	phage minor tail protein L	tail	A0A0M3LSQ5	Mannheimia_phage	55.1	1.5e-72
WP_012771363.1|503261_504023_+	C40 family peptidase	NA	S5MQI8	Escherichia_phage	45.3	3.5e-56
WP_012771364.1|504046_504568_+|tail	tail assembly protein	tail	NA	NA	NA	NA
WP_049756019.1|504571_507916_+	host specificity protein J	NA	A0A0M3LR06	Mannheimia_phage	51.5	6.0e-257
WP_049756020.1|507916_508459_+	hypothetical protein	NA	A0A0M3LQG1	Mannheimia_phage	70.0	2.0e-16
WP_044055218.1|508458_508833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012771365.1|508798_509689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012771366.1|509758_510052_+	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	75.3	1.0e-35
WP_044055219.1|510079_510262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012771367.1|510404_511604_-|integrase	site-specific integrase	integrase	G9L697	Escherichia_phage	57.3	2.6e-130
514468:514487	attR	AAAAGTGCGGTGGTTTTTCG	NA	NA	NA	NA
>prophage 2
NZ_CP009230	Aggregatibacter aphrophilus NJ8700 chromosome, complete genome	2313256	1786889	1856355	2313256	protease,plate,tRNA,integrase	Staphylococcus_phage(15.38%)	59	1778365:1778384	1857492:1857511
1778365:1778384	attL	TAAAAAAACGACCGCACTTT	NA	NA	NA	NA
WP_005702062.1|1786889_1787324_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_005702061.1|1787320_1788157_-	virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_005702060.1|1788153_1788627_-	YchJ family protein	NA	NA	NA	NA	NA
WP_005702059.1|1788629_1789298_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_005702058.1|1789423_1790923_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	45.0	1.1e-82
WP_005702056.1|1791166_1791982_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_005702055.1|1792057_1793890_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	43.6	3.6e-131
WP_005702054.1|1793938_1794715_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005702053.1|1794853_1795126_-	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.2	4.2e-20
WP_005702052.1|1795291_1795882_-	DUF416 family protein	NA	NA	NA	NA	NA
WP_005702051.1|1795899_1796964_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_005702050.1|1796971_1797754_-	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_005702049.1|1798070_1802339_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.0	5.4e-69
WP_005702047.1|1802442_1806471_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	26.2	1.4e-21
WP_005702046.1|1806739_1807111_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_005702045.1|1807162_1807654_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_005702044.1|1808017_1808707_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_005630840.1|1808711_1809140_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_005702043.1|1809309_1809861_-	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_005702041.1|1809862_1810273_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_005702040.1|1811137_1811653_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_005702039.1|1812415_1812724_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005702038.1|1812720_1813068_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_005702037.1|1813130_1813688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005702035.1|1813674_1813863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005702034.1|1813862_1814108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049756048.1|1814100_1814943_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_005702032.1|1815182_1815485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005702031.1|1815764_1816262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005594660.1|1817392_1817776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005702029.1|1817934_1818246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005702028.1|1818270_1818723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012771837.1|1818736_1818997_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_005594653.1|1819007_1819217_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_012771838.1|1819410_1819914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005702023.1|1820036_1821281_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	40.6	5.9e-85
WP_005702022.1|1822147_1823239_+	YdcF family protein	NA	NA	NA	NA	NA
WP_005702021.1|1823660_1824785_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	28.0	6.2e-25
WP_005702020.1|1824852_1826766_+	N-6 DNA methylase	NA	A0A1W6JNK1	Staphylococcus_phage	46.8	5.4e-154
WP_080514048.1|1827868_1828372_+	restriction endonuclease subunit S	NA	A0A1W6JNN3	Staphylococcus_phage	34.0	2.9e-14
WP_012771842.1|1828641_1831242_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	21.6	1.8e-30
WP_012771843.1|1831266_1832592_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	31.1	8.9e-47
WP_012771844.1|1832681_1833386_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_005702013.1|1833442_1834132_-	nicotinamide riboside transporter PnuC	NA	U5J9C5	Bacillus_phage	34.4	1.8e-35
WP_012771846.1|1834329_1837188_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.0	6.5e-18
WP_005702011.1|1837190_1837850_+|tRNA	bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA	tRNA	NA	NA	NA	NA
WP_005702010.1|1838041_1838539_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_005702008.1|1838560_1840045_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_005702007.1|1840054_1840471_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_005702004.1|1840471_1842223_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_005702002.1|1842186_1843185_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_005702001.1|1843186_1843972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005702000.1|1843986_1844673_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_005701999.1|1844676_1846020_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_012771847.1|1846016_1846874_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_005701996.1|1846899_1847526_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_005701995.1|1847527_1848955_+	type VI secretion system domain-containing protein	NA	NA	NA	NA	NA
WP_005701994.1|1848951_1852635_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_005701993.1|1853124_1856355_+|protease	autotransporter serine protease	protease	NA	NA	NA	NA
1857492:1857511	attR	TAAAAAAACGACCGCACTTT	NA	NA	NA	NA
>prophage 3
NZ_CP009230	Aggregatibacter aphrophilus NJ8700 chromosome, complete genome	2313256	2261906	2271942	2313256	tRNA,integrase	Escherichia_phage(16.67%)	8	2259303:2259317	2265783:2265797
2259303:2259317	attL	AAAGTGCGGTCATTT	NA	NA	NA	NA
WP_005701717.1|2261906_2263148_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B5FPC6	Escherichia_phage	38.6	9.8e-72
WP_012771980.1|2263546_2265418_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.5	1.0e-35
WP_005701714.1|2265489_2267268_-	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	31.6	2.1e-43
2265783:2265797	attR	AAAGTGCGGTCATTT	NA	NA	NA	NA
WP_005701713.1|2267390_2267606_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_005701711.1|2267830_2268859_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.5	4.7e-112
WP_012771983.1|2268930_2269164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005701708.1|2269163_2269742_+	thymidine kinase	NA	A0A076YPF1	Citrobacter_phage	51.6	2.4e-52
WP_005701707.1|2269926_2271942_-	NAD-dependent DNA ligase LigA	NA	A0A289ZTZ3	Serratia_phage	49.1	3.3e-141
