The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP006762	Yersinia pestis 1413 chromosome, complete genome	4528383	137888	196709	4528383	protease,transposase,coat,tRNA	Tupanvirus(18.18%)	52	NA	NA
WP_011906184.1|137888_140276_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002211832.1|140289_141273_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	7.6e-35
WP_152328947.1|141629_141677_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_002211833.1|141771_142128_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_016674119.1|142165_142363_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_002227898.1|142459_143011_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	2.6e-16
WP_002211836.1|143014_144943_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	1.1e-127
WP_002216696.1|145333_145546_+	KTSC domain-containing protein	NA	A0A0K1LMB5	Caulobacter_phage	42.0	9.9e-09
WP_002211839.1|146304_146556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211840.1|146874_147558_+	MarC family NAAT transporter	NA	NA	NA	NA	NA
WP_002216686.1|147679_148342_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_002211842.1|148553_149522_+	iron/manganese ABC transporter substrate-binding protein YfeA	NA	NA	NA	NA	NA
WP_002211843.1|149518_150409_+	iron/manganese ABC transporter ATP-binding protein YfeB	NA	A0A1V0SKJ1	Klosneuvirus	27.5	2.9e-09
WP_002211844.1|150408_151293_+	iron/manganese ABC transporter permease subunit YfeC	NA	NA	NA	NA	NA
WP_002211845.1|151289_152183_+	iron/manganese ABC transporter permease subunit YfeD	NA	NA	NA	NA	NA
WP_002216683.1|152250_152463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211846.1|152487_153363_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_002211847.1|153491_154046_-	yfeABCD regulator yfeE	NA	NA	NA	NA	NA
WP_002220277.1|154456_155122_+	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_002209743.1|155356_156565_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002210828.1|156612_156963_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_002210829.1|157298_158135_+	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_002210830.1|158226_158988_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.9	3.1e-20
WP_002210831.1|159323_160991_+	pectate disaccharide-lyase	NA	NA	NA	NA	NA
WP_002210832.1|161031_161922_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002210833.1|161914_162835_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002210834.1|162848_163976_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	26.5	1.6e-12
WP_002210835.1|163991_165284_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210836.1|165581_166292_+	porin	NA	NA	NA	NA	NA
WP_016674211.1|166825_167374_+	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	32.9	5.2e-09
WP_002210838.1|167577_168969_+	L-cystine transporter	NA	NA	NA	NA	NA
WP_002210839.1|169183_170035_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	28.8	1.3e-11
WP_002210840.1|170419_171211_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_002210841.1|171397_172564_-	oligogalacturonate lyase	NA	NA	NA	NA	NA
WP_002210842.1|172890_174258_+	MFS transporter	NA	NA	NA	NA	NA
WP_002210843.1|174311_175115_-	molecular chaperone	NA	NA	NA	NA	NA
WP_002215120.1|175111_176275_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002210844.1|176271_178884_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002215118.1|178965_179745_-	fimbrial chaperone	NA	NA	NA	NA	NA
WP_002210846.1|179897_180440_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002210847.1|181097_181979_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_002210848.1|182433_184506_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.8	4.0e-86
WP_002210849.1|184525_185239_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_002210850.1|185334_185832_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002367629.1|186063_187311_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_002216616.1|187279_189931_+	PqiB family protein	NA	NA	NA	NA	NA
WP_002210852.1|190410_190965_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002216613.1|190970_191501_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002216611.1|191521_192079_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002210856.1|192109_192862_+	molecular chaperone	NA	NA	NA	NA	NA
WP_002210857.1|193066_195514_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_011906287.1|195719_196709_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 2
NZ_CP006762	Yersinia pestis 1413 chromosome, complete genome	4528383	512767	583149	4528383	tRNA,transposase,plate	Escherichia_phage(53.85%)	55	NA	NA
WP_002209686.1|512767_513247_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002209685.1|513327_514134_-	ImpE family protein	NA	NA	NA	NA	NA
WP_002354537.1|514153_514996_-	TagK domain-containing protein	NA	NA	NA	NA	NA
WP_002209684.1|515001_515262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011906308.1|515360_517640_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	23.1	2.9e-29
WP_002209681.1|521768_522605_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_001297096.1|522620_523400_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_011901829.1|523399_524422_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	1.2e-200
WP_002211571.1|525100_526450_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002211572.1|526453_526993_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002211573.1|527266_527752_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_002211574.1|528077_529580_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002211575.1|529603_530128_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_016674143.1|530232_530841_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002211577.1|530825_532016_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002209743.1|532040_533249_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002231031.1|533270_534821_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002211579.1|534948_535710_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_002211580.1|535866_536412_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002215317.1|536612_539288_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	32.3	1.0e-81
WP_002211582.1|540070_541951_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002211584.1|543069_544251_+	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_002215319.1|544257_545289_+	fimbrial protein	NA	NA	NA	NA	NA
WP_002211586.1|545328_546666_+	glycosyl transferase	NA	A0A292GJ55	Xanthomonas_phage	32.8	2.0e-70
WP_016583104.1|546662_547328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211588.1|547328_549011_+	OmpA family protein	NA	NA	NA	NA	NA
WP_011906313.1|549007_549490_+	DcrB-related protein	NA	NA	NA	NA	NA
WP_002211590.1|549847_550450_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211594.1|551711_552806_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_002211596.1|553134_554154_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002215840.1|554209_555796_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002211598.1|555792_556842_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.4	3.9e-21
WP_002211599.1|556914_557439_-	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
WP_002354621.1|557905_558385_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002211601.1|558614_559463_-	DUF4225 domain-containing protein	NA	NA	NA	NA	NA
WP_002211602.1|560293_562720_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	54.4	1.1e-255
WP_002211603.1|562731_563349_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	68.3	1.1e-87
WP_002211604.1|563350_564127_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	41.4	3.9e-42
WP_002228419.1|564484_565081_+	molecular chaperone	NA	A0A077SLS7	Escherichia_phage	49.2	9.2e-44
WP_002211606.1|565077_565647_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_002211607.1|565892_566549_-	DUF799 domain-containing protein	NA	NA	NA	NA	NA
WP_002215846.1|566545_566902_-	DUF4810 domain-containing protein	NA	NA	NA	NA	NA
WP_002215847.1|566928_567600_-	lipoprotein	NA	NA	NA	NA	NA
WP_002211610.1|568189_568621_+	hypothetical protein	NA	Q7Y3V7	Yersinia_phage	48.2	2.4e-25
WP_002211611.1|568715_569240_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	47.1	9.3e-24
WP_011906314.1|569465_570701_-	alanine transaminase	NA	NA	NA	NA	NA
WP_002211614.1|570966_572214_+	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_002211615.1|572291_573263_-	glucokinase	NA	NA	NA	NA	NA
WP_002211616.1|573443_573920_-	multidrug/biocide efflux PACE transporter	NA	NA	NA	NA	NA
WP_002211617.1|574022_574901_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016674232.1|575036_576026_+	glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
WP_002354622.1|576295_576610_+	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_002211621.1|576702_577932_-	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_002222185.1|580787_582203_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002213775.1|582690_583149_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP006762	Yersinia pestis 1413 chromosome, complete genome	4528383	939881	1010463	4528383	transposase,coat,plate,tail	Vibrio_phage(16.67%)	59	NA	NA
WP_002213759.1|939881_940340_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002208786.1|940538_942050_-	amino acid permease	NA	NA	NA	NA	NA
WP_002208788.1|942307_943180_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002208790.1|943837_944926_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_002208791.1|945089_945947_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	31.0	6.9e-24
WP_002208792.1|946017_948489_-	fimbrial biogenesis usher protein PsaC	NA	NA	NA	NA	NA
WP_002208793.1|948572_949394_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_002208794.1|949520_949997_-	adhesin PsaA	NA	NA	NA	NA	NA
WP_002216523.1|950541_951030_-	protein PsaF	NA	NA	NA	NA	NA
WP_002208796.1|951026_951671_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_002208797.1|951995_953696_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_002208798.1|953710_954649_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_002208799.1|954645_955779_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_002208801.1|956040_956496_+	NUDIX domain-containing protein	NA	D9ICN3	Escherichia_virus	44.3	2.9e-05
WP_002208802.1|956608_957607_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002208803.1|957642_959217_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.8	2.9e-12
WP_002208804.1|959325_960414_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002208805.1|960521_961232_-	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_002208806.1|961251_962805_-	xylulokinase	NA	NA	NA	NA	NA
WP_016674066.1|962808_964293_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_002208808.1|964643_965786_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_002230767.1|965782_966748_+	C-terminal binding protein	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	30.3	5.2e-28
WP_002208810.1|966758_967574_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.6	8.8e-13
WP_002208811.1|967642_967897_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_002208812.1|968271_969516_+	tryptophan permease	NA	NA	NA	NA	NA
WP_002228019.1|969619_970192_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_002208813.1|970331_971525_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_002224659.1|972109_973582_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	32.5	4.9e-46
WP_002208819.1|975262_976246_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_002208820.1|976304_977006_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_002208822.1|977447_978032_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	39.8	2.8e-13
WP_071525527.1|978682_980200_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_002208825.1|980281_982090_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002208826.1|982099_983200_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_002208827.1|983199_984228_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002208828.1|984229_985822_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.8	1.3e-20
WP_002208829.1|985882_986227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002208831.1|987211_988411_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	25.1	1.3e-23
WP_002208832.1|988514_989222_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_002208833.1|989755_991513_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.4	2.3e-98
WP_002208834.1|991674_991959_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_002213775.1|992097_992556_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002208835.1|992756_993761_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	47.7	3.1e-84
WP_002208836.1|993938_994166_+	YejL family protein	NA	NA	NA	NA	NA
WP_002208837.1|994193_995990_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_002230704.1|996220_996604_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	66.7	7.8e-36
WP_002208839.1|996960_998109_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_002208840.1|998121_998610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002208841.1|999309_999672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002208842.1|999797_1001234_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002208843.1|1001524_1002265_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002208845.1|1002562_1003342_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	52.4	7.1e-52
WP_002208846.1|1003438_1003786_-	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	41.3	6.4e-21
WP_002215458.1|1003782_1004043_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_002208847.1|1004039_1005176_-|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	30.5	4.5e-31
WP_002208848.1|1005179_1005635_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	43.8	4.3e-17
WP_002208850.1|1006244_1007300_-|tail	tail protein	tail	M1PVV2	Vibrio_phage	27.2	1.3e-37
WP_002208852.1|1007296_1008703_-	hypothetical protein	NA	Q8SBG8	Shigella_phage	33.7	2.1e-17
WP_002208853.1|1008969_1010463_-|coat	coat protein	coat	NA	NA	NA	NA
>prophage 4
NZ_CP006762	Yersinia pestis 1413 chromosome, complete genome	4528383	1013641	1023671	4528383		Escherichia_phage(42.86%)	10	NA	NA
WP_002208859.1|1013641_1013932_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	46.3	7.7e-12
WP_002208860.1|1014528_1015323_-	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_002208861.1|1015298_1016111_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_116463120.1|1016113_1016809_-	aldolase	NA	A0A077SK32	Escherichia_phage	55.4	5.9e-58
WP_002208862.1|1016841_1018146_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	46.0	1.7e-90
WP_002215470.1|1018356_1018836_-	antitermination protein Q	NA	S5M7R9	Escherichia_phage	61.0	2.3e-37
WP_002208864.1|1019109_1019832_+	LexA family transcriptional regulator	NA	F1C599	Cronobacter_phage	51.9	2.2e-63
WP_002208866.1|1020037_1020280_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	65.0	6.9e-22
WP_002208867.1|1020451_1021387_+	omptin family outer membrane beta-barrel protein YcoA	NA	NA	NA	NA	NA
WP_011906348.1|1021883_1023671_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.5	4.0e-10
>prophage 5
NZ_CP006762	Yersinia pestis 1413 chromosome, complete genome	4528383	1046764	1103351	4528383	protease,transposase,holin,tRNA	Enterobacteria_phage(16.67%)	46	NA	NA
WP_002210815.1|1046764_1047274_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_002210814.1|1047331_1048525_-	nicotinamide mononucleotide deamidase-related protein YfaY	NA	NA	NA	NA	NA
WP_002221775.1|1049143_1050352_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_002210812.1|1050608_1051151_-	membrane protein	NA	NA	NA	NA	NA
WP_002228030.1|1051508_1052951_+	catalase	NA	A0A2K9L0T1	Tupanvirus	38.8	4.9e-99
WP_002210810.1|1053018_1055199_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.3	1.1e-44
WP_002210809.1|1055468_1056584_+	porin OmpF2	NA	Q1MVN1	Enterobacteria_phage	54.5	2.1e-110
WP_002210807.1|1056995_1057886_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_002210806.1|1058010_1058214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209743.1|1059438_1060647_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002210804.1|1062030_1063365_-	arginine/agmatine antiporter	NA	NA	NA	NA	NA
WP_002353933.1|1063860_1064559_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002210802.1|1064693_1065632_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.7	8.6e-20
WP_002210801.1|1065628_1066783_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011191984.1|1067043_1067976_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210799.1|1068711_1069566_+	3-mercaptopyruvate sulfurtransferase	NA	NA	NA	NA	NA
WP_002210798.1|1069776_1071192_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_002210797.1|1071215_1072073_-	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_002223523.1|1072187_1072886_-	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	6.4e-12
WP_032465620.1|1072979_1073750_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A285PWH2	Cedratvirus	28.2	3.9e-10
WP_002210794.1|1073812_1074889_-	urea ABC transporter permease subunit UrtC	NA	NA	NA	NA	NA
WP_002210793.1|1074888_1076490_-	urea ABC transporter permease subunit UrtB	NA	NA	NA	NA	NA
WP_002210792.1|1076613_1077882_-	urea ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210791.1|1078309_1078783_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	50.7	1.7e-37
WP_002210790.1|1079028_1079910_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_002210789.1|1079912_1080773_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_011906354.1|1080875_1081805_-	phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210787.1|1081841_1082678_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	6.1e-17
WP_002210786.1|1082885_1083134_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002210785.1|1083318_1084422_-	suppressor of fused domain protein	NA	NA	NA	NA	NA
WP_011906355.1|1084734_1085076_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_002210782.1|1085101_1085641_-	class IV adenylate cyclase	NA	NA	NA	NA	NA
WP_002210781.1|1085850_1087563_+	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_002210780.1|1087683_1088619_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_002210778.1|1088957_1089137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002228612.1|1089210_1090149_-|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_002210776.1|1090448_1091378_-	DUF4097 domain-containing protein	NA	NA	NA	NA	NA
WP_002213759.1|1091792_1092251_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002214195.1|1093178_1094042_-	xanthosine phosphorylase	NA	Q5YBA4	Grouper_iridovirus	40.7	2.3e-51
WP_002214197.1|1094387_1095236_+	DMT family transporter	NA	NA	NA	NA	NA
WP_002214199.1|1095273_1096167_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002228035.1|1096398_1098447_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	28.5	1.4e-19
WP_002218278.1|1098811_1099408_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_002218281.1|1099465_1100938_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011906357.1|1100960_1102664_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.4	1.0e-55
WP_011906358.1|1102892_1103351_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP006762	Yersinia pestis 1413 chromosome, complete genome	4528383	1173878	1183020	4528383	transposase	Escherichia_phage(28.57%)	11	NA	NA
WP_002210709.1|1173878_1174079_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	51.7	1.6e-08
WP_002215949.1|1174078_1174621_+	ash family protein	NA	NA	NA	NA	NA
WP_011906363.1|1174613_1175573_+	toprim domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	41.0	2.8e-50
WP_002210707.1|1175569_1176658_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	60.4	1.4e-114
WP_002210705.1|1177006_1177321_-	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_002215951.1|1177326_1177644_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	48.1	2.0e-13
WP_050880973.1|1178248_1179271_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	2.7e-200
WP_001297096.1|1179270_1180050_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002215393.1|1180942_1181128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002212204.1|1181290_1181542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215390.1|1182252_1183020_+	esterase	NA	G1DB77	Mycobacterium_phage	36.0	3.4e-06
>prophage 7
NZ_CP006762	Yersinia pestis 1413 chromosome, complete genome	4528383	2620864	2700234	4528383	transposase,plate,tRNA	Yellowstone_lake_phycodnavirus(18.18%)	58	NA	NA
WP_002210509.1|2620864_2623681_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2H4UVG0	Bodo_saltans_virus	26.1	1.0e-63
WP_002210508.1|2623680_2624190_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_002228112.1|2624257_2624716_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_002210506.1|2624696_2625650_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_002210504.1|2626231_2627053_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_002224759.1|2627525_2628701_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.3	6.9e-51
WP_011191702.1|2628716_2631950_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_002210501.1|2632177_2632792_-	LysE family translocator	NA	NA	NA	NA	NA
WP_002210499.1|2633115_2633916_+	threonine/serine exporter ThrE family protein	NA	NA	NA	NA	NA
WP_002210498.1|2633912_2634368_+	threonine/serine exporter	NA	NA	NA	NA	NA
WP_002210497.1|2634517_2635000_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	42.6	4.7e-30
WP_071525509.1|2635388_2635703_+	DUF3757 domain-containing protein	NA	NA	NA	NA	NA
WP_011906415.1|2635829_2636294_+	DUF3757 domain-containing protein	NA	NA	NA	NA	NA
WP_002210492.1|2636383_2637253_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	NA	NA	NA	NA
WP_002210491.1|2637269_2637647_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_002210490.1|2637660_2638479_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_002210489.1|2638471_2639467_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_002210488.1|2639450_2640755_-	peptidylprolyl isomerase SurA	NA	NA	NA	NA	NA
WP_016674007.1|2640822_2643165_-	LPS assembly protein LptD	NA	NA	NA	NA	NA
WP_002210486.1|2643349_2644183_+	co-chaperone DjlA	NA	NA	NA	NA	NA
WP_002210485.1|2644480_2645101_-|tRNA	bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA	tRNA	NA	NA	NA	NA
WP_002214747.1|2646323_2647067_-	DUF2285 domain-containing protein	NA	NA	NA	NA	NA
WP_002210482.1|2647396_2648410_+	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_002210481.1|2648420_2648981_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002210480.1|2648989_2650492_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002210479.1|2650654_2651173_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_002210478.1|2651246_2651690_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002210477.1|2651722_2653567_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002210476.1|2653559_2654543_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002210475.1|2654560_2657149_+	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	28.7	1.9e-77
WP_002210474.1|2657252_2659601_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.9	2.1e-14
WP_002224087.1|2659613_2661833_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_002214739.1|2661858_2662962_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_002210473.1|2662954_2663572_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_002214737.1|2663577_2663943_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_002210471.1|2663935_2664427_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002210470.1|2664546_2665902_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_011906413.1|2665898_2667488_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002210468.1|2671012_2671366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002220588.1|2671621_2674528_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.6	3.0e-23
WP_002210466.1|2674972_2677342_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.5e-31
WP_002210465.1|2677537_2678305_+	DedA family protein	NA	NA	NA	NA	NA
WP_002210464.1|2678373_2679084_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	34.1	1.0e-20
WP_002214276.1|2679070_2680678_-	thiamine/thiamine pyrophosphate ABC transporter permease ThiP	NA	NA	NA	NA	NA
WP_002214274.1|2680653_2681646_-	thiamine ABC transporter substrate binding subunit	NA	NA	NA	NA	NA
WP_002210461.1|2682585_2684247_-	HTH-type transcriptional regulator SgrR	NA	NA	NA	NA	NA
WP_002224086.1|2684910_2686092_+	MFS transporter	NA	NA	NA	NA	NA
WP_002210456.1|2686332_2686935_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_002210455.1|2686949_2688380_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_002210454.1|2688381_2689473_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_002210453.1|2689475_2691038_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_002210452.1|2691360_2691576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002216434.1|2692254_2693211_+	transcriptional regulator LeuO	NA	NA	NA	NA	NA
WP_002216437.1|2693764_2695570_+	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.2	3.5e-38
WP_002209743.1|2695644_2696853_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_011906411.1|2697352_2699080_+	acetolactate synthase 3 large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	29.2	2.3e-58
WP_002424260.1|2699052_2699577_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_002213775.1|2699775_2700234_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP006762	Yersinia pestis 1413 chromosome, complete genome	4528383	3327048	3415368	4528383	tRNA,protease,transposase,plate	Staphylococcus_phage(25.0%)	60	NA	NA
WP_100067904.1|3327048_3328402_+|transposase	IS3-like element IS1661 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.7	1.1e-55
WP_002211645.1|3328650_3330075_+	MFS transporter	NA	NA	NA	NA	NA
WP_002211646.1|3330333_3332514_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_002224898.1|3332585_3333914_-	lysine N(6)-hydroxylase/L-ornithine N(5)-oxygenase family protein	NA	NA	NA	NA	NA
WP_002211648.1|3333910_3335659_-	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_002211649.1|3335655_3336606_-	acetyltransferase	NA	NA	NA	NA	NA
WP_002211651.1|3338500_3339724_+	MFS transporter	NA	NA	NA	NA	NA
WP_002228661.1|3339671_3339866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211652.1|3340013_3340847_-	intradiol ring-cleavage dioxygenase	NA	NA	NA	NA	NA
WP_011192996.1|3341223_3342582_-	peptidase	NA	NA	NA	NA	NA
WP_011906169.1|3343143_3343887_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002215903.1|3343867_3344518_-	acyl-homoserine-lactone synthase	NA	NA	NA	NA	NA
WP_002215902.1|3345693_3346344_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002215900.1|3346794_3347190_+	lipoprotein	NA	NA	NA	NA	NA
WP_002213014.1|3349465_3349966_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_041175540.1|3350008_3351559_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002211664.1|3351570_3352923_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002210015.1|3352919_3353606_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002228049.1|3353605_3355342_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002210014.1|3355345_3355837_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002210013.1|3356254_3358903_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	29.5	4.8e-92
WP_011906172.1|3358899_3361248_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.9	1.2e-17
WP_002210009.1|3361263_3363561_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002210008.1|3363547_3364315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086016632.1|3364410_3365107_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	48.5	1.3e-60
WP_002210005.1|3365715_3366351_+	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_002210002.1|3367679_3369842_+	ornithine decarboxylase SpeF	NA	NA	NA	NA	NA
WP_002210001.1|3370397_3371357_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002210000.1|3371402_3372902_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.7	5.2e-19
WP_002209999.1|3372934_3373918_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002209998.1|3374000_3376034_-	TonB-dependent siderophore receptor	NA	A0A0P0I887	Acinetobacter_phage	26.1	4.5e-05
WP_002209997.1|3376137_3377238_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002209995.1|3377554_3378631_-	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_002230648.1|3378813_3379086_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_002228057.1|3379263_3380379_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_002209991.1|3380716_3381436_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_002209990.1|3381435_3381762_+	YggL family protein	NA	NA	NA	NA	NA
WP_002209989.1|3381872_3382799_+	glutaminase B	NA	NA	NA	NA	NA
WP_038905510.1|3384139_3393472_+	pore forming RTX toxin family protein	NA	NA	NA	NA	NA
WP_002209987.1|3393661_3394792_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_002215614.1|3394784_3395378_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_002215612.1|3395477_3395768_-	YggU family protein	NA	NA	NA	NA	NA
WP_002209984.1|3395764_3396319_-	YggT family protein	NA	NA	NA	NA	NA
WP_002209983.1|3396606_3397428_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_002215609.1|3397560_3398259_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_002209981.1|3398278_3399403_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_002209980.1|3399511_3400627_-	agmatine deiminase	NA	M1I1E2	Acanthocystis_turfacea_Chlorella_virus	50.7	3.0e-96
WP_002209978.1|3401675_3402098_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_002209977.1|3402097_3402661_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_002209976.1|3402776_3403736_-	glutathione synthase	NA	NA	NA	NA	NA
WP_002209975.1|3403761_3404493_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_002209973.1|3404744_3405452_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_002228653.1|3405549_3406062_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_002209971.1|3406254_3407409_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	62.1	1.7e-126
WP_002209969.1|3408615_3410595_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_002209968.1|3410754_3411075_+	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_071525520.1|3411108_3411219_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002209967.1|3411364_3412117_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_002209965.1|3412607_3414602_+	transketolase	NA	NA	NA	NA	NA
WP_050880979.1|3414909_3415368_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP006762	Yersinia pestis 1413 chromosome, complete genome	4528383	3736641	3805378	4528383	protease,transposase,plate	Escherichia_phage(28.57%)	53	NA	NA
WP_002213775.1|3736641_3737100_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002226586.1|3737268_3737724_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_032485934.1|3737934_3739686_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_002220006.1|3739754_3740273_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_002211286.1|3740538_3740727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011901829.1|3741360_3742383_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	1.2e-200
WP_001297096.1|3742382_3743162_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002213066.1|3744972_3746034_-	porin OmpA	NA	NA	NA	NA	NA
WP_002213065.1|3746391_3746898_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_002213064.1|3747126_3747762_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_002213063.1|3747863_3750002_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_002213062.1|3750031_3750478_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_002221095.1|3750671_3752726_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	25.8	1.5e-16
WP_002213060.1|3752786_3753251_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_002213058.1|3753429_3754110_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_002213056.1|3754425_3754842_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_002213054.1|3754950_3755268_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_002213052.1|3755328_3756519_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	W6LLI2	Streptococcus_phage	28.1	2.1e-26
WP_002213049.1|3756612_3756891_+	acylphosphatase	NA	NA	NA	NA	NA
WP_002213046.1|3756942_3757272_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_002213039.1|3760917_3763335_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002213038.1|3763488_3764235_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	31.4	3.3e-14
WP_002213036.1|3764965_3765184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213034.1|3765447_3765972_+	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_002213032.1|3765961_3767245_+	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_002213030.1|3767246_3767984_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011906264.1|3767999_3769238_+	hydroxymethylglutaryl-CoA synthase family protein	NA	NA	NA	NA	NA
WP_002213026.1|3769230_3769950_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_002213025.1|3769951_3770704_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_002213024.1|3770706_3771495_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002228570.1|3771581_3772022_+	lipocalin-like domain-containing protein	NA	NA	NA	NA	NA
WP_002213017.1|3772059_3772308_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_002213016.1|3772406_3773255_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_002213014.1|3774243_3774744_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002214707.1|3774786_3776337_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002213011.1|3776348_3777701_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002210015.1|3777697_3778384_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002214568.1|3778383_3780120_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002210014.1|3780123_3780615_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_042659392.1|3781002_3783645_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.6	2.8e-92
WP_002211928.1|3783647_3785996_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.1	4.5e-17
WP_013060322.1|3786011_3788312_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002211930.1|3788308_3789082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211931.1|3789235_3789496_+	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_002211932.1|3789511_3791695_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002214564.1|3791867_3792338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016674153.1|3794502_3795735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211936.1|3795731_3799154_+	type VI secretion system membrane subunit	NA	NA	NA	NA	NA
WP_002211937.1|3799197_3800799_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_002211938.1|3800816_3801875_+	PAAR domain protein	NA	NA	NA	NA	NA
WP_002211939.1|3801889_3802345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211940.1|3802565_3804329_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_016674055.1|3804292_3805378_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 10
NZ_CP006762	Yersinia pestis 1413 chromosome, complete genome	4528383	4300938	4395249	4528383	integrase,transposase,lysis,tail,tRNA,terminase	Escherichia_phage(12.5%)	93	4311485:4311515	4350586:4350616
WP_002211184.1|4300938_4301637_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_087768167.1|4302374_4302482_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002220632.1|4303016_4304705_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	28.9	3.0e-31
WP_002211181.1|4304864_4305986_+	ribonuclease D	NA	NA	NA	NA	NA
WP_002211180.1|4306222_4306492_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_002211179.1|4306495_4307308_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_002220631.1|4307332_4308019_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_002211743.1|4308739_4309012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215627.1|4309152_4310238_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_002211740.1|4310308_4310965_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_002211739.1|4311067_4311514_+	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
4311485:4311515	attL	ATATTGAATAAGCCGAGTTGGGCTAAATAAC	NA	NA	NA	NA
WP_002211738.1|4311540_4312779_-|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	53.3	2.3e-121
WP_011901829.1|4312848_4313871_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	1.2e-200
WP_001297096.1|4313870_4314650_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002215632.1|4314817_4315078_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	42.9	1.7e-10
WP_071525537.1|4315377_4316127_-	DNA adenine methylase	NA	Q5QF26	Pseudomonas_virus	48.5	1.5e-54
WP_002211736.1|4316102_4316549_+	recombination protein NinB	NA	A0A2H4J8D9	uncultured_Caudovirales_phage	62.5	3.9e-47
WP_002211735.1|4316622_4317228_+	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	56.9	2.8e-56
WP_002215636.1|4317228_4317618_+	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	68.8	1.4e-45
WP_002215638.1|4317621_4317840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211732.1|4317888_4318452_+	hypothetical protein	NA	B6SD63	Bacteriophage	58.0	9.4e-30
WP_002211731.1|4318875_4319085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215644.1|4319081_4319357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002430108.1|4319602_4319800_+	hypothetical protein	NA	B6SD15	Bacteriophage	64.4	4.9e-18
WP_002211730.1|4319830_4320343_+	lysozyme	NA	I6PBN2	Cronobacter_phage	61.6	9.7e-50
WP_002211729.1|4320327_4320786_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	45.3	4.9e-21
WP_002211727.1|4321331_4322045_+	hypothetical protein	NA	Q5MBW0	Stx1-converting_phage	60.2	7.6e-69
WP_002211725.1|4322501_4323137_+	hypothetical protein	NA	I6S676	Salmonella_phage	71.4	7.2e-87
WP_002211724.1|4323167_4323617_+	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	72.9	1.0e-47
WP_011906214.1|4323626_4325117_+|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	76.5	7.8e-225
WP_002228445.1|4325116_4325845_+	hypothetical protein	NA	A0A1B0VMH0	Pseudomonas_phage	51.4	4.6e-61
WP_002228446.1|4325863_4326505_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	54.1	3.8e-59
WP_002211721.1|4326505_4327618_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	58.2	6.0e-121
WP_002211720.1|4327739_4328513_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	62.3	2.8e-69
WP_002211719.1|4328526_4329732_+	hypothetical protein	NA	A0A1B0VMF8	Pseudomonas_phage	79.2	1.8e-142
WP_002211718.1|4329779_4330262_+	hypothetical protein	NA	G8C7P9	Escherichia_phage	46.1	6.4e-27
WP_002211717.1|4330258_4330513_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	53.1	2.2e-18
WP_002211716.1|4330514_4330865_+	hypothetical protein	NA	I6PD77	Cronobacter_phage	56.0	6.9e-31
WP_002211715.1|4330866_4331451_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	52.1	3.6e-48
WP_002211714.1|4331447_4331855_+	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_002211713.1|4331920_4332841_+|tail	phage tail protein	tail	I6PBN6	Cronobacter_phage	49.1	4.4e-61
WP_002211712.1|4332853_4333165_+	hypothetical protein	NA	I6PDG2	Cronobacter_phage	58.3	1.4e-30
WP_071525538.1|4333212_4333473_+	hypothetical protein	NA	A0A0S2SY90	Pseudomonas_phage	50.0	3.7e-13
WP_011906212.1|4333473_4336989_+|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	33.2	5.2e-118
WP_002211710.1|4336991_4337333_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	50.0	1.7e-21
WP_002213759.1|4337638_4338097_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002211709.1|4338216_4338969_+|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	67.7	9.4e-102
WP_002211708.1|4338971_4339682_+	peptidase P60	NA	K7P6F5	Enterobacteria_phage	76.8	1.3e-108
WP_002211706.1|4340664_4341096_-	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	58.4	2.5e-30
WP_002211705.1|4341219_4341387_+	hypothetical protein	NA	G9L6D7	Escherichia_phage	61.8	5.2e-13
WP_002211704.1|4341460_4342468_+	hypothetical protein	NA	A0A2H4J0P1	uncultured_Caudovirales_phage	33.0	4.1e-36
WP_002214482.1|4342566_4343118_+	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	58.0	9.5e-27
WP_002211701.1|4343260_4343476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211700.1|4343531_4344152_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	57.0	3.2e-55
WP_002359202.1|4344326_4344548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211698.1|4344723_4347927_+	host specificity protein J	NA	F1C571	Cronobacter_phage	60.5	0.0e+00
WP_002211697.1|4347926_4348925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211696.1|4348941_4349859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097608205.1|4349920_4350289_+|tail	phage tail protein	tail	B6SCW7	Bacteriophage	42.0	5.0e-08
WP_002214492.1|4350699_4351872_-	MFS transporter	NA	NA	NA	NA	NA
4350586:4350616	attR	ATATTGAATAAGCCGAGTTGGGCTAAATAAC	NA	NA	NA	NA
WP_002211693.1|4351875_4353075_-	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.6	2.4e-38
WP_002211692.1|4353091_4353832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002214494.1|4354923_4355280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002227934.1|4355696_4356227_-	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_002211689.1|4356462_4358037_-	sodium/proton antiporter NhaB	NA	NA	NA	NA	NA
WP_002211688.1|4358280_4359000_+	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_002211687.1|4359217_4360753_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_011906208.1|4361218_4362523_+	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_002216508.1|4362538_4363741_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	29.1	7.6e-29
WP_002211685.1|4364005_4364875_-	pirin family protein	NA	NA	NA	NA	NA
WP_002211684.1|4365072_4365978_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211683.1|4366012_4367131_-	DMT family transporter	NA	NA	NA	NA	NA
WP_002216501.1|4367238_4368513_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.1	1.5e-11
WP_011906207.1|4368662_4370597_-	protein kinase YeaG	NA	NA	NA	NA	NA
WP_002430110.1|4371040_4371790_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_002211679.1|4371862_4372738_-	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
WP_011906206.1|4373051_4374047_-	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002211677.1|4374394_4374808_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_002217933.1|4374878_4375151_+	YeaC family protein	NA	NA	NA	NA	NA
WP_002211676.1|4375284_4375932_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	33.0	1.8e-21
WP_002211675.1|4375946_4376963_-	asparaginase	NA	NA	NA	NA	NA
WP_011192431.1|4377079_4378930_-	signal peptide peptidase SppA	NA	NA	NA	NA	NA
WP_002211673.1|4379092_4379644_+	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_002211670.1|4380875_4382801_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.4	4.2e-37
WP_002211669.1|4382797_4383088_+	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
WP_002211668.1|4383100_4383487_-	pyrimidine (deoxy)nucleoside triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_002211667.1|4383584_4384391_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_002211665.1|4385200_4386061_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002210664.1|4388004_4389351_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.3	1.9e-81
WP_002210665.1|4389657_4390674_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_002210666.1|4392007_4392472_+	YchJ family protein	NA	NA	NA	NA	NA
WP_002230891.1|4392555_4393404_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	37.3	7.0e-13
WP_002209743.1|4394040_4395249_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
>prophage 1
NZ_CP006761	Yersinia pestis 1413 plasmid pCD, complete sequence	71523	24063	49992	71523	transposase	Enterobacteria_phage(42.86%)	21	NA	NA
WP_000255944.1|24063_25086_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_011901819.1|26578_27985_-	T3SS effector protein-tyrosine-phosphatase YopH	NA	NA	NA	NA	NA
WP_002213287.1|29667_30534_-	type III secretion system effector acetyltransferase YopJ	NA	NA	NA	NA	NA
WP_002213290.1|30929_33128_-	T3SS effector protein kinase YopO/YpkA	NA	NA	NA	NA	NA
WP_002233145.1|33145_33574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213291.1|34319_34559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213292.1|35731_36610_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_002233140.1|36590_36665_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_002229817.1|36906_37161_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_002233137.1|37298_37547_-	phospholipase	NA	A0A1B2LRT6	Wolbachia_phage	47.1	9.2e-06
WP_002213294.1|37963_38371_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	29.2	4.7e-07
WP_002213008.1|38394_38712_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_002213246.1|38883_39342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042469136.1|39410_39680_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011901828.1|42291_44607_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	51.5	2.9e-279
WP_002213258.1|44770_45322_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	80.3	5.9e-77
WP_002224338.1|45340_45805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002229829.1|45943_46273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086016640.1|46372_47471_+|transposase	IS3-like element ISYpe1 family transposase	transposase	S5WIU1	Leptospira_phage	38.5	1.4e-45
WP_002213267.1|47619_48045_-	type III secretion system chaperone SycH	NA	NA	NA	NA	NA
WP_002220893.1|48819_49992_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	95.4	1.6e-220
>prophage 1
NZ_CP006760	Yersinia pestis 1413 plasmid pMT, complete sequence	137017	11886	115731	137017	tail,transposase,terminase	Salmonella_phage(80.26%)	99	NA	NA
WP_002209743.1|11886_13095_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_016674166.1|13176_15288_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_016674165.1|15287_20528_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_011901847.1|20529_21267_+	type-F conjugative transfer system pilin acetylase TraX	NA	NA	NA	NA	NA
WP_008324922.1|21333_22053_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_011901848.1|22045_22837_+	DsbA family protein	NA	NA	NA	NA	NA
WP_011201827.1|22984_23539_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.1	7.8e-21
WP_100228227.1|23516_23660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011201829.1|23878_23956_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_086028848.1|23936_24812_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_002211760.1|26018_27041_+|transposase	IS110-like element IS1618 family transposase	transposase	NA	NA	NA	NA
WP_002211758.1|29116_30880_-	phospholipase D	NA	NA	NA	NA	NA
WP_002211757.1|30957_31446_-	phospholipase D family protein	NA	NA	NA	NA	NA
WP_002211756.1|32184_32460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215065.1|32482_33424_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.8	1.0e-68
WP_002211754.1|33489_34110_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	31.1	6.5e-08
WP_002215068.1|34309_34636_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002211753.1|34635_34863_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_002211752.1|35164_36370_+	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	90.5	1.7e-206
WP_002215070.1|36366_37338_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	67.3	1.5e-112
WP_002228775.1|37716_39114_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_002211750.1|39275_39476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211749.1|39976_40654_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.6e-28
WP_002211748.1|40653_40875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215082.1|40885_41305_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_002211747.1|41358_42138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211746.1|42536_43043_+	antirestriction protein	NA	A0A1I9S7Y0	Rhodococcus_phage	29.5	1.1e-08
WP_002211745.1|43755_43986_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_002211744.1|44058_46068_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	30.3	7.7e-26
WP_011901829.1|46191_47214_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	1.2e-200
WP_001297096.1|47213_47993_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002211769.1|48126_48735_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	62.2	4.8e-64
WP_002211770.1|49036_51925_-|tail	phage tail protein	tail	J9Q6E3	Salmonella_phage	33.1	4.5e-11
WP_002211771.1|52005_52584_-	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	38.8	3.4e-27
WP_011901830.1|52640_57272_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	88.7	0.0e+00
WP_002211773.1|57293_57881_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	92.8	5.1e-103
WP_002211774.1|57868_58666_-|tail	tail protein	tail	J9Q7R4	Salmonella_phage	96.2	1.4e-156
WP_011901831.1|58658_59357_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	99.6	6.4e-137
WP_000440566.1|59446_59782_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	97.3	5.7e-59
WP_002211776.1|59823_64401_-	tape measure protein	NA	J9Q712	Salmonella_phage	90.5	0.0e+00
WP_000952684.1|64408_64633_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	4.2e-34
WP_000163862.1|64758_65076_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
WP_002211778.1|65135_65882_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	98.8	5.2e-129
WP_002211779.1|65956_66340_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	98.4	1.1e-66
WP_002211780.1|66341_66815_-	hypothetical protein	NA	J9Q711	Salmonella_phage	99.4	8.9e-82
WP_001027662.1|66805_67150_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
WP_002211781.1|67247_68081_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	99.6	2.9e-152
WP_002211782.1|68080_68515_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	99.3	3.1e-73
WP_002211783.1|68558_69221_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	97.2	8.5e-107
WP_002211784.1|69295_70171_-	hypothetical protein	NA	J9Q710	Salmonella_phage	99.7	8.5e-163
WP_002231160.1|70197_71094_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	96.3	3.9e-147
WP_025476623.1|71116_72691_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.4	6.4e-302
WP_002211787.1|72724_73981_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	100.0	1.8e-251
WP_002211788.1|73983_74625_-	hypothetical protein	NA	J9Q6D4	Salmonella_phage	98.1	1.2e-108
WP_000176291.1|74820_75087_-	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
WP_002211789.1|75096_75987_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.7	6.2e-169
WP_002211790.1|75992_76247_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	97.6	2.0e-40
WP_002211791.1|76239_76878_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.1	4.7e-110
WP_002211792.1|76874_77543_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	98.2	9.5e-114
WP_002228791.1|77542_78241_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	98.7	9.6e-125
WP_002211794.1|78317_79877_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	99.0	1.1e-293
WP_002214131.1|79879_80158_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	97.8	4.4e-41
WP_002211796.1|80217_80640_+	hypothetical protein	NA	J9Q806	Salmonella_phage	85.0	4.1e-62
WP_002214134.1|80644_81172_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	98.0	6.4e-81
WP_002211799.1|81495_82146_+	hypothetical protein	NA	J9Q754	Salmonella_phage	99.5	4.1e-114
WP_002214137.1|82230_82458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213759.1|82683_83142_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	35.3	5.0e-13
WP_002211801.1|83817_84300_-	hypothetical protein	NA	J9Q805	Salmonella_phage	94.4	5.1e-85
WP_002211802.1|84505_84787_-	hypothetical protein	NA	J9Q753	Salmonella_phage	93.5	6.1e-46
WP_002213775.1|84986_85445_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	35.3	5.0e-13
WP_011901832.1|85683_86439_-	hypothetical protein	NA	J9Q742	Salmonella_phage	98.4	3.8e-135
WP_002231164.1|86637_87780_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	100.0	1.7e-219
WP_002231165.1|87887_90203_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	98.8	0.0e+00
WP_011201798.1|90280_90850_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	99.5	3.8e-103
WP_002213303.1|90862_91609_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	96.4	4.1e-134
WP_038918515.1|91598_91958_-	hypothetical protein	NA	J9Q741	Salmonella_phage	100.0	5.2e-58
WP_002213300.1|93744_94830_-	exonuclease	NA	J9Q7S9	Salmonella_phage	98.6	7.7e-206
WP_002213298.1|95245_96268_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002389821.1|96627_96852_-	hypothetical protein	NA	J9Q739	Salmonella_phage	97.3	1.5e-34
WP_002214164.1|98036_99101_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	98.6	2.4e-188
WP_002222711.1|99669_99882_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	95.7	6.8e-34
WP_002227818.1|99881_100217_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	91.0	5.2e-52
WP_002228796.1|100213_100393_-	hypothetical protein	NA	J9Q6J1	Salmonella_phage	86.4	5.8e-18
WP_002228797.1|100433_100709_-	hypothetical protein	NA	J9Q738	Salmonella_phage	95.6	1.7e-45
WP_002222869.1|100776_101187_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.8	4.1e-75
WP_002222868.1|101170_101542_-	DUF2591 domain-containing protein	NA	J9Q7S7	Salmonella_phage	87.8	4.0e-61
WP_002222866.1|101695_102526_-	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	98.6	9.3e-127
WP_002213439.1|102529_102730_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	97.0	1.1e-25
WP_161597819.1|102820_103852_-	recombinase	NA	J9Q736	Salmonella_phage	99.1	6.9e-196
WP_000920226.1|103899_104166_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
WP_002225551.1|104165_105110_-	exonuclease	NA	J9Q7S6	Salmonella_phage	99.0	1.3e-180
WP_002213132.1|105170_106199_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	98.5	1.3e-165
WP_002213135.1|106318_106750_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	98.6	2.6e-72
WP_002215095.1|106970_107222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011201800.1|107294_107858_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	65.1	2.6e-64
WP_002425587.1|107887_108313_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	100.0	7.5e-72
WP_002221186.1|108327_111852_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.2	0.0e+00
WP_002211767.1|112032_113268_-	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	99.3	3.0e-238
WP_002211766.1|113364_115731_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	94.4	0.0e+00
>prophage 2
NZ_CP006760	Yersinia pestis 1413 plasmid pMT, complete sequence	137017	124200	129953	137017	transposase	Salmonella_phage(83.33%)	7	NA	NA
WP_002224363.1|124200_124506_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	97.0	3.2e-48
WP_002224361.1|124651_124867_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.6	7.7e-33
WP_002231172.1|125026_126349_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	99.1	1.6e-258
WP_016256030.1|126383_126641_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	95.3	3.4e-35
WP_002224265.1|126941_127736_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	96.6	3.7e-141
WP_002224263.1|127988_128711_+	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_002209743.1|128744_129953_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
