The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT904878	Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, chromosome: 1	4769894	991169	1034872	4769894	tRNA,transposase,bacteriocin,protease	Acinetobacter_phage(25.0%)	47	NA	NA
WP_000421096.1|991169_991448_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_000768134.1|991690_991957_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_001141622.1|991953_992271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071525158.1|993391_993571_-	type VI secretion system protein	NA	NA	NA	NA	NA
WP_001681938.1|993920_994205_-	DUF4102 domain-containing protein	NA	A0A0P0IRB7	Acinetobacter_phage	35.2	3.2e-10
WP_000234466.1|994546_995254_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001049802.1|997864_999121_-	nucleoside permease	NA	NA	NA	NA	NA
WP_000976287.1|999337_1000423_-	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
WP_000091706.1|1000535_1000811_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001148958.1|1000838_1001891_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000786887.1|1002045_1002765_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001107559.1|1002764_1003091_+	YggL family protein	NA	NA	NA	NA	NA
WP_000984827.1|1003140_1003860_+	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_000502119.1|1003982_1004441_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_000394189.1|1004759_1005806_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000252198.1|1005938_1006946_+	DUF1202 domain-containing protein	NA	NA	NA	NA	NA
WP_001096530.1|1007036_1008173_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_001174773.1|1008165_1008759_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_001277205.1|1008766_1009057_-	YggU family protein	NA	NA	NA	NA	NA
WP_001094848.1|1009053_1009620_-	YggT family protein	NA	NA	NA	NA	NA
WP_000997790.1|1009638_1010343_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_001055657.1|1010360_1011341_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000098333.1|1011470_1012157_+	global regulatory protein	NA	NA	NA	NA	NA
WP_001285491.1|1012203_1012620_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001053167.1|1012619_1013183_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000593242.1|1013398_1014346_-	glutathione synthase	NA	NA	NA	NA	NA
WP_001800534.1|1014365_1015097_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000286121.1|1015173_1015881_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_000856775.1|1015976_1016474_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_001113171.1|1016552_1017947_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_001062140.1|1018439_1019594_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
WP_001803086.1|1019649_1019949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729109.1|1020243_1020375_+	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001278580.1|1020383_1022360_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_000105550.1|1022587_1023508_+	agmatinase	NA	NA	NA	NA	NA
WP_000701830.1|1023608_1024367_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000098658.1|1024642_1026634_+	transketolase	NA	NA	NA	NA	NA
WP_000502119.1|1026822_1027281_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_000956919.1|1027385_1028042_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
WP_000367758.1|1028035_1028719_-	energy-coupling factor ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_000553254.1|1028700_1029408_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_000124001.1|1029408_1029987_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_000218564.1|1030012_1030438_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000218338.1|1030811_1031858_+	erythrose-4-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000111274.1|1031879_1033043_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_000034386.1|1033144_1034224_+	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000502119.1|1034413_1034872_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_LT904878	Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, chromosome: 1	4769894	1299712	1365703	4769894	tRNA,tail	Salmonella_phage(41.18%)	54	NA	NA
WP_000047238.1|1299712_1302343_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.3	3.5e-79
WP_000906486.1|1302577_1302763_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000271296.1|1304161_1304728_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	M1I5S4	Acanthocystis_turfacea_Chlorella_virus	27.6	7.2e-14
WP_001279499.1|1304724_1305150_+	DedA family protein	NA	NA	NA	NA	NA
WP_000611827.1|1305226_1306783_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_001130194.1|1306932_1307448_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_000645128.1|1307793_1309164_+	glycoporin	NA	NA	NA	NA	NA
WP_001187289.1|1309212_1310751_-	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_001275597.1|1310767_1311940_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_000378431.1|1312066_1312597_-	transcriptional repressor MprA	NA	NA	NA	NA	NA
WP_000165770.1|1313093_1314278_-	MFS transporter	NA	NA	NA	NA	NA
WP_001216613.1|1314442_1315438_-	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_000775015.1|1315507_1316572_-	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_000777898.1|1318120_1319080_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	71.8	4.0e-129
WP_000201426.1|1319090_1321235_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	49.0	3.5e-194
WP_001275403.1|1321207_1321618_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	41.8	4.3e-16
WP_000028873.1|1321614_1321860_-	glutaredoxin-like protein NrdH	NA	NA	NA	NA	NA
WP_010989219.1|1321958_1322135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000209805.1|1322131_1322563_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_001519557.1|1324069_1324396_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000281304.1|1324557_1324908_+	YgaC family protein	NA	NA	NA	NA	NA
WP_000492647.1|1324942_1325392_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_001051100.1|1326090_1326492_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_000022010.1|1326840_1327368_-	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_000137417.1|1327377_1327677_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000508175.1|1327859_1328018_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_000126152.1|1328588_1329266_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001095643.1|1330837_1332121_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	31.4	1.2e-32
WP_001176534.1|1332135_1333584_-	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000271916.1|1333605_1334874_-	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_001782268.1|1334899_1335886_-	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
WP_000382024.1|1336179_1337694_-	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_001574835.1|1337704_1338139_-	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_000744418.1|1338150_1338960_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_001237936.1|1339114_1339789_+	transcriptional regulator TctD	NA	NA	NA	NA	NA
WP_000872343.1|1339775_1341191_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000947097.1|1341431_1342337_+	HoxN/HupN/NixA family nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000701509.1|1343058_1343955_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_000178741.1|1344248_1345178_-	VirK family antimicrobial peptide resistance protein	NA	NA	NA	NA	NA
WP_001801692.1|1345694_1346747_+	SPI-2 type III secretion system effector PipB2	NA	NA	NA	NA	NA
WP_001682025.1|1347768_1349949_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_000274373.1|1350008_1350926_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001239947.1|1350957_1352202_-	esterase family protein	NA	NA	NA	NA	NA
WP_001111827.1|1352311_1355968_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
WP_001221113.1|1356048_1357164_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_000905046.1|1357847_1358414_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	1.1e-86
WP_000046142.1|1358556_1359729_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
WP_001207656.1|1359738_1360254_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
WP_001280897.1|1360308_1360611_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
WP_000763311.1|1360625_1360745_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001282793.1|1360737_1363815_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
WP_000980381.1|1363811_1364297_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
WP_001011760.1|1364293_1365394_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
WP_000972389.1|1365484_1365703_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
>prophage 3
NZ_LT904878	Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, chromosome: 1	4769894	2052123	2059435	4769894	integrase,protease	Dickeya_phage(16.67%)	7	2053374:2053388	2064553:2064567
WP_001201759.1|2052123_2053242_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
WP_000125880.1|2053238_2055185_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
2053374:2053388	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_000447499.1|2055314_2055536_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|2055859_2056180_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934058.1|2056210_2058487_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
WP_001117984.1|2058698_2058896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001539594.1|2059057_2059435_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
2064553:2064567	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 4
NZ_LT904878	Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, chromosome: 1	4769894	2130573	2204673	4769894	head,integrase,holin,tail,transposase,protease,terminase	Salmonella_phage(75.41%)	91	2112639:2112658	2183246:2183265
2112639:2112658	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_001262313.1|2130573_2131866_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	5.0e-252
WP_000065276.1|2131910_2132159_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001754984.1|2132199_2132439_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	96.2	9.7e-37
WP_010989138.1|2132444_2133326_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
WP_000034527.1|2133322_2134387_-	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
WP_000187053.1|2134464_2135145_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
WP_001764962.1|2135141_2135927_-	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
WP_000995349.1|2135932_2136229_-	host-nuclease inhibitor protein Gam	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
WP_000186242.1|2136319_2136520_-	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
WP_001009036.1|2136808_2137213_-	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
WP_000869365.1|2137342_2137579_+	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	98.7	1.1e-37
WP_001574095.1|2137544_2137919_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_001681803.1|2138003_2138987_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
WP_000800010.1|2138989_2139739_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113623.1|2139749_2140097_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
WP_000065105.1|2140093_2140618_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
WP_000445792.1|2140617_2141091_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
WP_000208074.1|2141094_2141667_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
WP_001220318.1|2141760_2142027_+	hypothetical protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
WP_010989139.1|2142108_2142270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000509711.1|2142512_2142692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000963896.1|2142702_2143200_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_001217670.1|2143384_2143624_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
WP_001574100.1|2143613_2143919_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
WP_000929790.1|2143958_2144561_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_001096560.1|2144769_2145381_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
WP_001617856.1|2145377_2145524_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047634.1|2145513_2146311_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
WP_001534733.1|2146709_2146835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798706.1|2146970_2147420_-	lipoprotein	NA	NA	NA	NA	NA
WP_001294876.1|2147636_2148026_+	membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
WP_000226307.1|2148012_2148294_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
WP_001075998.1|2148293_2148908_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
WP_000495544.1|2149485_2149863_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
WP_001070544.1|2149959_2150187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001118118.1|2150276_2151029_+	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
WP_000204794.1|2150994_2152398_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
WP_000113511.1|2152397_2153867_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
WP_138010671.1|2153751_2154489_+|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	88.1	7.8e-101
WP_000873182.1|2154503_2155736_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
WP_000128060.1|2155740_2156238_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
WP_000627464.1|2156249_2157191_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
WP_001040702.1|2157232_2157601_+	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
WP_001125675.1|2157566_2157974_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
WP_000008737.1|2157970_2158525_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
WP_001142488.1|2158511_2158901_+	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
WP_000389379.1|2158875_2159439_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
WP_001135544.1|2159442_2160588_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
WP_000257259.1|2160599_2161040_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
WP_000389047.1|2161043_2161496_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
WP_000990867.1|2161673_2163626_+	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
WP_000346974.1|2163625_2164276_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
WP_000388505.1|2164279_2164582_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
WP_000042301.1|2164584_2165616_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
WP_000826019.1|2165612_2165948_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
WP_000050472.1|2166142_2166874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144794.1|2166873_2167302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001685627.1|2167360_2168116_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
WP_000564971.1|2168203_2168341_+	hypothetical protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
WP_001270647.1|2168356_2168710_+	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
WP_001197092.1|2168710_2169910_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
WP_000049938.1|2169906_2170587_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
WP_001681975.1|2170586_2172098_+	hypothetical protein	NA	S4TP62	Salmonella_phage	59.4	1.5e-111
WP_000421106.1|2172112_2172631_+|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
WP_000480169.1|2173552_2174254_-	DUF1076 domain-containing protein	NA	NA	NA	NA	NA
WP_000497443.1|2174566_2174845_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
WP_000193884.1|2175270_2177883_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
WP_000291724.1|2178090_2179101_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|2179266_2179809_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224084.1|2179805_2180915_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086472.1|2181013_2183122_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
WP_000053045.1|2183134_2185042_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
2183246:2183265	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000333152.1|2185056_2186310_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433416.1|2186314_2187955_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|2187951_2188515_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001764860.1|2188768_2188936_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|2189035_2189554_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156455.1|2189622_2191383_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877174.1|2191568_2192021_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_010989142.1|2192092_2193145_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|2193499_2194009_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202371.1|2194225_2194831_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950867.1|2194817_2196971_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|2196989_2197436_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420526.1|2197559_2199614_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
WP_000424187.1|2199649_2200108_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|2200202_2200865_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000975203.1|2201035_2201452_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|2201496_2201814_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140485.1|2201871_2203083_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000502119.1|2204214_2204673_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_LT904878	Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, chromosome: 1	4769894	2650703	2724294	4769894	tRNA,head,integrase,plate,tail,transposase,protease	Burkholderia_virus(39.47%)	85	2641033:2641048	2696899:2696914
2641033:2641048	attL	GATTTTACCTGCCTTT	NA	NA	NA	NA
WP_000502118.1|2650703_2651162_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_001766314.1|2651693_2651945_+	acid shock protein	NA	NA	NA	NA	NA
WP_023377421.1|2652248_2653034_+|protease	serine protease	protease	NA	NA	NA	NA
WP_001183821.1|2653068_2653398_-	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_000500278.1|2653384_2653747_-	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_001539987.1|2653858_2654029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001118268.1|2654163_2655198_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_000014056.1|2655372_2656761_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_001219360.1|2656771_2658301_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_000769298.1|2658827_2659772_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001281695.1|2659953_2660343_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
WP_000988475.1|2660314_2660767_-	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
WP_010989166.1|2660756_2660972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000631816.1|2660961_2661192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131941.1|2661188_2661872_-	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
WP_000132655.1|2661868_2662084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001315283.1|2662076_2662460_-	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	58.9	2.3e-27
WP_000197790.1|2662456_2662759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000632575.1|2662768_2663041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001140134.1|2663329_2663860_-	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
WP_000843446.1|2663887_2664157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000960673.1|2664159_2665326_-	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
WP_000990529.1|2665336_2667106_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
WP_124682070.1|2667283_2667622_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	57.1	1.9e-22
WP_100208317.1|2667710_2668307_+	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000793143.1|2668550_2668901_+	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
WP_001104436.1|2668903_2669632_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	57.4	2.7e-61
WP_000264664.1|2669615_2670266_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
WP_000175097.1|2670262_2670589_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
WP_000227700.1|2670588_2670900_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000124060.1|2670899_2671445_+	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
WP_000167502.1|2671441_2673037_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
WP_000090679.1|2673036_2674533_+	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
WP_000117561.1|2674513_2675335_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
WP_000135517.1|2675337_2675796_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
WP_001273072.1|2676010_2677126_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
WP_000537457.1|2678102_2678441_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_000271668.1|2678442_2678889_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_001101804.1|2678888_2679353_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_001789770.1|2679349_2679604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729859.1|2679593_2681021_+|tail	tail protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
WP_000034292.1|2681020_2681542_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
WP_000110118.1|2681544_2681826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000084228.1|2681923_2682259_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001148841.1|2682203_2682341_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000135574.1|2682434_2684900_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	42.6	2.2e-168
WP_000458383.1|2684899_2685784_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.0	7.5e-50
WP_010989167.1|2685780_2685996_+	membrane protein	NA	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
WP_000808000.1|2685983_2687138_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
WP_000148263.1|2687134_2687662_+|plate	phage baseplate assembly protein V	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
WP_000859114.1|2687718_2688066_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
WP_001219103.1|2688056_2689160_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
WP_000852584.1|2689152_2689731_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
WP_024131174.1|2691239_2691716_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	56.4	1.9e-44
WP_001057643.1|2691722_2692340_-|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
WP_024131173.1|2692851_2693325_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	53.0	4.3e-36
WP_001165548.1|2693396_2693969_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
WP_000412353.1|2694249_2695632_+	amino acid permease	NA	NA	NA	NA	NA
WP_000524877.1|2695693_2696029_-	GlpM family protein	NA	NA	NA	NA	NA
WP_001080045.1|2696155_2696887_+	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_000924582.1|2696951_2697251_-	hypothetical protein	NA	NA	NA	NA	NA
2696899:2696914	attR	GATTTTACCTGCCTTT	NA	NA	NA	NA
WP_000824321.1|2697367_2698519_+	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
WP_000928668.1|2698671_2700378_+	amidohydrolase	NA	NA	NA	NA	NA
WP_001681605.1|2700488_2701790_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
WP_000092483.1|2701865_2702795_+	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_000259129.1|2702791_2704195_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_000066606.1|2704362_2706009_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_001170615.1|2706208_2707384_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000753325.1|2707486_2708995_+	YdgA family protein	NA	NA	NA	NA	NA
WP_077949083.1|2709115_2709334_+	PTS maltose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000565566.1|2709700_2710702_+	adenosine deaminase	NA	NA	NA	NA	NA
WP_021013203.1|2710775_2711891_-	oxidoreductase	NA	NA	NA	NA	NA
WP_000361450.1|2711993_2712149_+	division septum protein Blr	NA	NA	NA	NA	NA
WP_000217946.1|2712447_2712663_+	transcription modulator YdgT	NA	NA	NA	NA	NA
WP_000214061.1|2712751_2713192_+	DUF2569 domain-containing protein	NA	NA	NA	NA	NA
WP_000133179.1|2713268_2713850_+	electron transport complex subunit RsxA	NA	NA	NA	NA	NA
WP_001092600.1|2713849_2714428_+	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_000915581.1|2714420_2716442_+	electron transport complex subunit RsxC	NA	NA	NA	NA	NA
WP_000231887.1|2716442_2717501_+	electron transport complex subunit RsxD	NA	NA	NA	NA	NA
WP_000920820.1|2717504_2718125_+	electron transport complex subunit RsxG	NA	NA	NA	NA	NA
WP_001289628.1|2718127_2718820_+	electron transport complex subunit E	NA	NA	NA	NA	NA
WP_001030324.1|2718819_2719455_+	endonuclease III	NA	NA	NA	NA	NA
WP_000100913.1|2720055_2721561_+	dipeptide/tripeptide permease DtpA	NA	NA	NA	NA	NA
WP_000765713.1|2721665_2722271_+	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_000168626.1|2723019_2724294_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 6
NZ_LT904878	Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, chromosome: 1	4769894	2905320	2909732	4769894		Escherichia_phage(50.0%)	7	NA	NA
WP_000497459.1|2905320_2905560_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	87.3	5.5e-32
WP_001036668.1|2905771_2905936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001529135.1|2906432_2907242_+	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
WP_001277616.1|2907314_2907692_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_000158843.1|2907839_2908382_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
WP_001766395.1|2908573_2909302_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
WP_000281950.1|2909318_2909732_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 7
NZ_LT904878	Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, chromosome: 1	4769894	3113585	3120819	4769894		Morganella_phage(33.33%)	8	NA	NA
WP_001157299.1|3113585_3115016_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377043.1|3115089_3115785_-	phosphohydrolase	NA	S4W232	Pandoravirus	27.5	2.1e-07
WP_000107435.1|3115864_3116176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001080666.1|3116826_3118011_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
WP_024131163.1|3118271_3118460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208507.1|3118470_3118683_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
WP_000457648.1|3119128_3120397_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
WP_000394197.1|3120399_3120819_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 8
NZ_LT904878	Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, chromosome: 1	4769894	3227119	3237626	4769894		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126347.1|3227119_3228433_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565909.1|3228459_3229539_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
WP_000648783.1|3229543_3230317_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018220.1|3230332_3231307_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973711.1|3231312_3231864_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
WP_000857536.1|3231864_3232743_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
WP_001023656.1|3232790_3233690_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
WP_000697846.1|3233689_3234775_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_000981469.1|3235151_3236045_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111852.1|3236222_3237626_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 9
NZ_LT904878	Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, chromosome: 1	4769894	3313517	3322688	4769894	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195338.1|3313517_3315551_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
WP_000703137.1|3315791_3316250_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197951.1|3316421_3316952_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|3317008_3317476_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598632.1|3317522_3318242_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272853.1|3318238_3319924_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
WP_001240415.1|3320146_3320878_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|3320937_3321045_+	protein YohO	NA	NA	NA	NA	NA
WP_000824854.1|3321025_3321757_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|3321740_3322688_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 10
NZ_LT904878	Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, chromosome: 1	4769894	3557197	3563228	4769894		Salmonella_virus(50.0%)	6	NA	NA
WP_000377769.1|3557197_3558139_+	membrane protein	NA	E7DYY8	Enterobacteria_phage	88.2	2.4e-147
WP_001682026.1|3559381_3559771_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	91.5	6.9e-56
WP_000703599.1|3559739_3559994_+	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
WP_000400611.1|3560010_3561933_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.2	5.6e-300
WP_106417236.1|3562922_3563066_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	87.8	9.0e-14
WP_106417237.1|3563081_3563228_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	73.9	1.1e-14
>prophage 11
NZ_LT904878	Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, chromosome: 1	4769894	4219723	4229488	4769894	capsid,integrase	Enterobacteria_phage(50.0%)	10	4216294:4216307	4227697:4227710
4216294:4216307	attL	CGAAGGCCGGACTC	NA	NA	NA	NA
WP_015701354.1|4219723_4220275_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.1e-30
WP_000556589.1|4220207_4220531_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
WP_010989311.1|4220953_4221814_+|capsid	phage capsid protein	capsid	NA	NA	NA	NA
WP_000468230.1|4221817_4222057_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
WP_000214423.1|4222072_4222639_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
WP_000493739.1|4222914_4224078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989310.1|4224052_4225126_+	serine/threonine protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
WP_000573583.1|4225122_4226199_+	serine/threonine protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
WP_000772672.1|4226261_4227527_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.0	1.6e-74
WP_000152561.1|4227997_4229488_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	36.1	4.0e-11
4227697:4227710	attR	CGAAGGCCGGACTC	NA	NA	NA	NA
>prophage 12
NZ_LT904878	Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, chromosome: 1	4769894	4368451	4442987	4769894	head,integrase,plate,tail,portal,lysis,capsid,terminase	Salmonella_phage(83.33%)	80	4398789:4398804	4421792:4421807
WP_000954536.1|4368451_4369711_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
WP_000975154.1|4370021_4371305_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_000511749.1|4372285_4373068_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000193665.1|4373924_4374146_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
WP_000246267.1|4374142_4374604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989301.1|4375150_4376824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989300.1|4376904_4379190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000905294.1|4379481_4379745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000434168.1|4379826_4380279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000622308.1|4380458_4380947_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001143724.1|4380943_4381237_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_000449622.1|4381663_4382677_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000488995.1|4382840_4384430_-	DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001120833.1|4384413_4385925_-	ATP-dependent helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
WP_001210944.1|4386778_4387318_+	Vi polysaccharide biosynthesis regulator TviA	NA	NA	NA	NA	NA
WP_000466893.1|4387562_4388840_+	Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
WP_000127915.1|4388842_4389889_+	Vi polysaccharide biosynthesis UDP-N-acetylglucosaminuronic acid C-4 epimerase TviC	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
WP_010989299.1|4389912_4392408_+	Vi polysaccharide biosynthesis protein TviD	NA	NA	NA	NA	NA
WP_000632616.1|4392407_4394144_+	Vi polysaccharide biosynthesis glycosyltransferase TviE	NA	NA	NA	NA	NA
WP_000720235.1|4394188_4395256_+	Vi polysaccharide ABC transporter protein VexA	NA	NA	NA	NA	NA
WP_001023498.1|4395265_4396060_+	Vi polysaccharide ABC transporter inner membrane protein VexB	NA	NA	NA	NA	NA
WP_000467404.1|4396085_4396781_+	Vi polysaccharide ABC transporter ATP-binding protein VexC	NA	NA	NA	NA	NA
WP_000431675.1|4396803_4398108_+	Vi polysaccharide ABC transporter inner membrane protein VexD	NA	NA	NA	NA	NA
WP_000052242.1|4398127_4400098_+	Vi polysaccharide transport protein VexE	NA	NA	NA	NA	NA
4398789:4398804	attL	CGCTGTGCGCTGTCGG	NA	NA	NA	NA
WP_000354257.1|4400399_4401146_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001681808.1|4401145_4402036_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001681810.1|4402046_4402304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000902197.1|4402950_4403304_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
WP_000027757.1|4403410_4404436_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
WP_000052560.1|4404439_4405072_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
WP_000102106.1|4405188_4405431_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
WP_000460852.1|4405463_4405973_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
WP_000956167.1|4405980_4406181_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
WP_000963479.1|4406144_4406486_+	DUF5347 domain-containing protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
WP_001244240.1|4406553_4406787_+	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
WP_000785510.1|4406786_4407014_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
WP_001090717.1|4407010_4407595_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
WP_000104130.1|4407591_4408452_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
WP_001154438.1|4411005_4411194_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	96.8	7.9e-26
WP_001217561.1|4411205_4411439_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	92.2	2.2e-33
WP_000835188.1|4411534_4411753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000829584.1|4411762_4412827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789323.1|4412823_4413888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080839.1|4413907_4414603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001681813.1|4414651_4415695_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
WP_001098453.1|4415694_4417461_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
WP_000216272.1|4417603_4418437_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
WP_000730751.1|4418453_4419518_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
WP_000059175.1|4419521_4420172_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
WP_000673540.1|4420265_4420730_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
WP_000868184.1|4420729_4420933_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000171566.1|4420936_4421152_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
WP_001097942.1|4421132_4421642_+	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.0	1.3e-91
WP_000731034.1|4421646_4422024_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
4421792:4421807	attR	CGCTGTGCGCTGTCGG	NA	NA	NA	NA
WP_001772475.1|4422023_4422449_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
WP_001039966.1|4422544_4422976_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	2.5e-75
WP_000343944.1|4422968_4423415_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
WP_000993749.1|4423483_4424062_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
WP_000177408.1|4424058_4424418_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
WP_000268327.1|4424404_4425313_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
WP_001086816.1|4425305_4425911_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
WP_000104806.1|4425907_4427527_+|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
WP_000006337.1|4427533_4427941_+|tail	tail assembly protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
WP_000161708.1|4428138_4428861_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_000388790.1|4429074_4429293_+	Hin recombinase	NA	A0A1S6L009	Salmonella_phage	90.3	1.4e-29
WP_000046101.1|4429395_4430568_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
WP_001207653.1|4430577_4431093_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
WP_001280965.1|4431147_4431450_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
WP_000763315.1|4431464_4431584_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	94.9	1.2e-14
WP_001282813.1|4431576_4434357_+|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
WP_000980405.1|4434356_4434842_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
WP_001011750.1|4434838_4435939_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
WP_001775272.1|4436006_4436225_+	positive regulator of late gene transcription	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
WP_001039750.1|4436311_4436689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000457555.1|4436908_4438183_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
WP_001222413.1|4438314_4438584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989298.1|4438683_4439043_-	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
WP_000022216.1|4439084_4439984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881183.1|4440057_4440966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097965.1|4441037_4442987_-	DUF1738 domain-containing protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
>prophage 13
NZ_LT904878	Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, chromosome: 1	4769894	4743625	4769894	4769894	head,integrase,plate,tail,portal,lysis,capsid,terminase	Salmonella_phage(83.87%)	36	4738589:4738603	4750755:4750769
4738589:4738603	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
WP_001012560.1|4743625_4745272_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
WP_001311244.1|4745411_4745510_-	ilv operon leader peptide	NA	NA	NA	NA	NA
WP_000290950.1|4746135_4747188_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
WP_000900883.1|4747376_4747568_-	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_001047327.1|4747583_4748153_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
WP_001247706.1|4748278_4748500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|4748532_4749042_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956176.1|4749049_4749346_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.4	4.9e-22
WP_000996717.1|4749463_4749805_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_001244218.1|4749872_4750106_+	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
WP_000752613.1|4750105_4750333_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_000104152.1|4750329_4751187_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
4750755:4750769	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
WP_000017503.1|4751183_4753598_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_001580533.1|4753751_4753940_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
WP_000822803.1|4754007_4754307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001251692.1|4754415_4755294_-	hypothetical protein	NA	A0A2H4J8D6	uncultured_Caudovirales_phage	49.4	6.1e-52
WP_001146827.1|4755907_4756822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000185757.1|4756818_4757559_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_000518064.1|4757593_4758631_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
WP_001098422.1|4758630_4760397_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_000216244.1|4760539_4761373_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
WP_000742518.1|4761389_4762448_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
WP_000059191.1|4762451_4763102_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_000673504.1|4763197_4763662_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.4e-76
WP_000868175.1|4763661_4763865_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|4763868_4764084_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001341072.1|4764103_4764577_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
WP_000727853.1|4764578_4764956_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
WP_001080928.1|4764952_4765381_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	77.3	2.2e-47
WP_001039939.1|4765476_4765908_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
WP_000829146.1|4765900_4766347_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
WP_000993754.1|4766415_4766994_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
WP_000177595.1|4766990_4767350_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
WP_000268271.1|4767336_4768245_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
WP_001086816.1|4768237_4768843_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
WP_094516709.1|4768839_4769894_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	79.5	8.1e-152
>prophage 1
NZ_LT904879	Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, plasmid: 2	215515	113765	149858	215515	transposase,integrase	Escherichia_phage(27.27%)	31	137449:137463	148088:148102
WP_001300563.1|113765_114878_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_001048870.1|115329_116583_+	ParA family protein	NA	NA	NA	NA	NA
WP_001278833.1|116579_117587_+	peptide transporter	NA	A0A1I9KFW9	Aeromonas_phage	32.1	3.9e-10
WP_000875157.1|117770_118163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000621889.1|118159_118681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000915491.1|118673_119513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001160355.1|119512_120484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000137273.1|120833_121868_+	hypothetical protein	NA	A0A0A7NPX4	Enterobacteria_phage	34.3	6.7e-42
WP_000163156.1|121895_122573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000952687.1|123138_123591_+	transfer repressor	NA	NA	NA	NA	NA
WP_000867278.1|123580_124015_+	plasmid transfer protein	NA	NA	NA	NA	NA
WP_000178792.1|124011_124575_+	plasmid transfer protein	NA	NA	NA	NA	NA
WP_001232104.1|124694_128993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001209619.1|129266_129779_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001255990.1|129765_131274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011011070.1|131463_132471_+	plasmid transfer protein	NA	NA	NA	NA	NA
WP_000682729.1|132493_135670_+	conjugal transfer protein TraN	NA	NA	NA	NA	NA
WP_000792088.1|135696_136569_-	lipoprotein	NA	NA	NA	NA	NA
137449:137463	attL	AGTAAGTTGGCAGCA	NA	NA	NA	NA
WP_000412211.1|137691_138351_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_000656305.1|138551_138929_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001138064.1|138995_141962_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000147567.1|141964_142525_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|142650_143001_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|143203_144217_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000703418.1|144374_144848_+	trimethoprim-resistant dihydrofolate reductase DfrA7	NA	A0A1B2IAU3	Erwinia_phage	33.3	1.4e-15
WP_000679427.1|145077_145425_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|145418_146258_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_001067855.1|146491_147196_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|147695_148556_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
148088:148102	attR	TGCTGCCAACTTACT	NA	NA	NA	NA
WP_001387387.1|148705_149107_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|149153_149858_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 1
NZ_LT904880	Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, plasmid: 3	106516	0	106516	106516	terminase,integrase,tail	Salmonella_phage(91.38%)	129	1451:1474	83237:83260
WP_001113021.1|0_255_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	98.8	4.1e-41
WP_011011099.1|251_1151_+	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.3	4.0e-168
WP_000176291.1|1160_1427_+	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
1451:1474	attL	AGCCTGCTTCCGTATATATAAATA	NA	NA	NA	NA
WP_000215412.1|1622_2264_+	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	99.5	1.8e-109
WP_001007302.1|2266_3523_+|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	99.8	5.3e-251
WP_000423989.1|3556_5131_+	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.0	3.2e-301
WP_001055287.1|5153_6050_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	96.6	5.7e-146
WP_001130336.1|6076_6952_+	hypothetical protein	NA	J9Q710	Salmonella_phage	100.0	3.8e-163
WP_001115046.1|7026_7950_+	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	100.0	3.3e-157
WP_000801184.1|7993_8428_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	100.0	2.1e-74
WP_000057119.1|8427_9261_+	hypothetical protein	NA	J9Q7R2	Salmonella_phage	100.0	2.6e-153
WP_001027662.1|9358_9703_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
WP_000523626.1|9693_10167_+	hypothetical protein	NA	J9Q711	Salmonella_phage	100.0	2.3e-82
WP_000469441.1|10168_10552_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	100.0	1.7e-67
WP_000072376.1|10626_11373_+	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	96.8	7.8e-125
WP_000163862.1|11432_11750_+	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
WP_002228782.1|11830_12100_+	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	8.4e-37
WP_000081619.1|12107_16691_+	tape measure protein	NA	J9Q712	Salmonella_phage	93.1	0.0e+00
WP_000440566.1|16732_17068_+|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	97.3	5.7e-59
WP_011011098.1|17124_17856_+|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	98.7	4.8e-135
WP_000528167.1|17848_18646_+|tail	tail protein	tail	J9Q7R4	Salmonella_phage	95.8	1.2e-155
WP_001293197.1|18633_19221_+|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	92.3	1.1e-102
WP_011011097.1|19235_23624_+	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	86.7	0.0e+00
WP_000270398.1|23706_26259_+|tail	tail fiber domain-containing protein	tail	A0A0A0YQM3	Citrobacter_virus	52.5	2.3e-152
WP_000064174.1|26373_26697_+	hypothetical protein	NA	J9Q6E7	Salmonella_phage	97.2	2.7e-50
WP_000856755.1|26710_27403_+	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	95.7	1.1e-125
WP_011011096.1|27471_27816_+	hypothetical protein	NA	J9Q7G2	Salmonella_phage	83.6	5.9e-27
WP_001287064.1|27866_28418_-	hypothetical protein	NA	A0A2H4J5U3	uncultured_Caudovirales_phage	39.8	7.8e-29
WP_000161333.1|28748_29414_+	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	95.0	8.0e-113
WP_000062815.1|29413_29773_+	hypothetical protein	NA	J9Q7G3	Salmonella_phage	100.0	2.3e-45
WP_000966077.1|29821_30577_+	DUF2971 domain-containing protein	NA	J9Q7Y9	Salmonella_phage	43.0	3.2e-57
WP_001238819.1|30646_31702_-	hypothetical protein	NA	A0A2I7RNF6	Vibrio_phage	42.6	5.1e-61
WP_000078184.1|31983_32709_+	hypothetical protein	NA	J9Q7R8	Salmonella_phage	98.3	2.4e-139
WP_011011095.1|32769_34110_+	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	99.6	3.8e-247
WP_011011094.1|34172_35384_+	hypothetical protein	NA	J9Q720	Salmonella_phage	96.5	6.6e-214
WP_000209842.1|35385_36438_-	hypothetical protein	NA	J9Q6F5	Salmonella_phage	56.7	1.9e-92
WP_000642525.1|36621_37416_+	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	96.2	4.9e-141
WP_011011093.1|37716_37974_+	hypothetical protein	NA	J9Q7R9	Salmonella_phage	92.9	4.9e-34
WP_000413053.1|38008_39331_+	DNA ligase	NA	J9Q7G5	Salmonella_phage	98.4	5.8e-256
WP_000901956.1|39330_39507_+	hypothetical protein	NA	J9Q729	Salmonella_phage	96.6	2.6e-23
WP_011011092.1|39496_39703_+	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.5	8.1e-32
WP_000613550.1|39702_39855_+	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	98.0	8.9e-20
WP_000067984.1|39851_40157_+	hypothetical protein	NA	J9Q7S1	Salmonella_phage	98.0	9.2e-48
WP_011011091.1|41164_41455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062551.1|41729_42458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000747129.1|42536_43091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000336844.1|43368_43923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011011090.1|43976_44810_+	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	65.1	2.4e-90
WP_000159906.1|44819_45023_+	hypothetical protein	NA	A0A0B6VT64	Edwardsiella_phage	49.2	4.4e-06
WP_000131231.1|45038_45419_+	hypothetical protein	NA	Q716B1	Shigella_phage	67.2	6.7e-40
WP_000869626.1|45418_45664_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	41.6	2.1e-10
WP_001117719.1|45828_46320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000798892.1|46580_47687_+|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	32.2	2.1e-25
WP_000224608.1|47678_48065_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000790461.1|48326_48539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000030420.1|48648_50811_+	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	86.4	0.0e+00
WP_000127343.1|50907_52143_+	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	99.5	1.8e-238
WP_000645855.1|52323_55842_+	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.1	0.0e+00
WP_001031298.1|55838_56282_+	hypothetical protein	NA	J9Q7S4	Salmonella_phage	97.9	3.0e-71
WP_000459729.1|56375_56966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102109.1|57211_57643_+	hypothetical protein	NA	J9Q6I8	Salmonella_phage	100.0	4.0e-73
WP_000045710.1|57762_58791_+	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	98.8	1.1e-164
WP_001108398.1|58851_59796_+	exonuclease	NA	J9Q7S6	Salmonella_phage	99.4	6.8e-182
WP_000920226.1|59795_60062_+	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
WP_001051805.1|60064_61141_+	recombinase	NA	J9Q736	Salmonella_phage	99.7	5.5e-204
WP_000589750.1|61232_61433_+	hypothetical protein	NA	J9Q6J0	Salmonella_phage	93.9	9.3e-25
WP_000715582.1|61436_62279_+	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	97.1	2.3e-125
WP_000801005.1|62441_62813_+	DUF2591 domain-containing protein	NA	J9Q7S7	Salmonella_phage	98.4	3.0e-69
WP_000737807.1|62796_63207_+	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.1	1.4e-75
WP_000699340.1|63275_63551_+	hypothetical protein	NA	J9Q738	Salmonella_phage	96.7	5.9e-46
WP_000859650.1|63591_63897_+	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	90.8	4.9e-33
WP_011011087.1|63896_64100_+	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	4.0e-31
WP_154080930.1|64282_64423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001293470.1|64628_65684_-	replication protein RepA	NA	J9Q7H0	Salmonella_phage	98.0	1.5e-185
WP_000364575.1|66428_67073_+	hypothetical protein	NA	J9Q739	Salmonella_phage	98.1	2.4e-122
WP_001288958.1|67148_67643_+	GNAT family N-acetyltransferase	NA	J9Q6J3	Salmonella_phage	97.6	2.3e-88
WP_000832167.1|67674_68178_-	hypothetical protein	NA	J9Q7Z6	Salmonella_phage	98.2	5.5e-90
WP_000174806.1|68406_69492_+	exonuclease SbcCD subunit D	NA	J9Q7S9	Salmonella_phage	98.9	2.7e-206
WP_000107766.1|69488_69725_+	hypothetical protein	NA	J9Q7H1	Salmonella_phage	98.4	1.1e-29
WP_000670362.1|69721_71638_+	AAA family ATPase	NA	J9Q741	Salmonella_phage	98.6	0.0e+00
WP_000009516.1|71627_72374_+	hypothetical protein	NA	J9Q6J5	Salmonella_phage	98.0	4.4e-136
WP_000047571.1|72386_72956_+	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	99.5	1.7e-103
WP_000623686.1|73033_75349_+	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	99.7	0.0e+00
WP_011011111.1|75456_76599_+	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	99.5	2.4e-218
WP_000673231.1|76681_77611_+	hypothetical protein	NA	J9Q742	Salmonella_phage	99.0	3.8e-161
WP_011011110.1|77726_78842_+	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	98.1	7.6e-217
WP_006812548.1|78843_79257_+	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	97.8	4.7e-71
WP_000781812.1|79253_79730_+	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	100.0	1.4e-90
WP_000386471.1|79729_80374_+	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	100.0	5.2e-117
WP_000564632.1|80437_80857_+	hypothetical protein	NA	J9Q743	Salmonella_phage	98.6	2.9e-68
WP_000208226.1|80866_81424_+	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	99.5	7.0e-102
WP_011011109.1|81468_82395_+	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	85.4	4.1e-107
WP_000559567.1|82580_83174_+	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	99.5	4.6e-112
WP_000262979.1|83376_83607_+	hypothetical protein	NA	J9Q7H5	Salmonella_phage	100.0	2.1e-36
83237:83260	attR	TATTTATATATACGGAAGCAGGCT	NA	NA	NA	NA
WP_011011108.1|84192_84801_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	99.5	2.2e-117
WP_024134091.1|84943_85438_+	hypothetical protein	NA	J9Q6J9	Salmonella_phage	96.3	1.9e-79
WP_000872126.1|85447_85636_+	hypothetical protein	NA	J9Q800	Salmonella_phage	100.0	1.2e-26
WP_000462606.1|85744_86587_+	hypothetical protein	NA	J9Q7T3	Salmonella_phage	71.1	2.1e-70
WP_000333240.1|86695_87268_+	hypothetical protein	NA	J9Q7H6	Salmonella_phage	98.9	8.2e-98
WP_011011107.1|87391_89095_+	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	98.9	0.0e+00
WP_001291673.1|89153_89843_+	hypothetical protein	NA	J9Q6K2	Salmonella_phage	98.3	6.1e-124
WP_000766011.1|90123_90495_+	hypothetical protein	NA	J9Q7T4	Salmonella_phage	100.0	3.2e-63
WP_000086990.1|90586_91228_+	HD domain-containing protein	NA	J9Q7H7	Salmonella_phage	100.0	9.7e-116
WP_000861921.1|91224_91767_+	hypothetical protein	NA	J9Q748	Salmonella_phage	93.1	2.6e-93
WP_011011105.1|91775_92087_+	hypothetical protein	NA	A0A1B5FPC7	Escherichia_phage	56.9	3.0e-14
WP_000218758.1|92083_92371_+	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	58.8	9.9e-28
WP_000860613.1|92431_92635_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	95.5	1.5e-30
WP_011011104.1|92808_93090_+	hypothetical protein	NA	J9Q7T5	Salmonella_phage	71.6	3.2e-31
WP_000916329.1|93174_93492_+	hypothetical protein	NA	J9Q750	Salmonella_phage	80.0	8.1e-47
WP_000132517.1|93501_94692_+	hypothetical protein	NA	J9Q803	Salmonella_phage	54.6	5.4e-120
WP_011011103.1|96128_96374_-	hypothetical protein	NA	J9Q751	Salmonella_phage	92.5	5.8e-37
WP_000276519.1|96516_96732_+	hypothetical protein	NA	J9Q6K7	Salmonella_phage	95.8	4.5e-33
WP_000594283.1|96742_96961_+	hypothetical protein	NA	J9Q804	Salmonella_phage	98.6	6.4e-35
WP_000559556.1|97055_97370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786235.1|97446_97758_+	hypothetical protein	NA	J9Q7T7	Salmonella_phage	92.2	1.1e-45
WP_000218787.1|97886_98279_+	hypothetical protein	NA	J9Q7I1	Salmonella_phage	65.4	1.7e-41
WP_011011102.1|98399_98687_+	hypothetical protein	NA	J9Q753	Salmonella_phage	94.6	1.5e-47
WP_024134090.1|98646_98880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001009195.1|98892_99375_+	hypothetical protein	NA	J9Q805	Salmonella_phage	96.9	5.5e-87
WP_000234274.1|100006_100234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072873.1|100318_100969_-	hypothetical protein	NA	J9Q754	Salmonella_phage	100.0	1.4e-114
WP_011011101.1|101291_101600_-	periplasmic protein	NA	NA	NA	NA	NA
WP_000182009.1|101603_102131_-	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	96.6	4.1e-80
WP_000683475.1|102135_102558_-	hypothetical protein	NA	J9Q806	Salmonella_phage	85.7	8.2e-63
WP_001291547.1|102617_102896_-	hypothetical protein	NA	J9Q7T9	Salmonella_phage	98.9	3.4e-41
WP_000218382.1|102898_104458_-	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	99.4	5.7e-295
WP_011011100.1|104522_105221_+	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	99.6	1.9e-125
WP_000164561.1|105220_105889_+	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	99.5	1.1e-114
WP_094544361.1|105885_106516_+	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	99.0	1.3e-109
