The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011010	Stenotrophomonas maltophilia strain ISMMS3 isolate Patient 2 chromosome 1, complete sequence	4804002	994751	1014361	4804002	tail,head	Rhizobium_phage(35.71%)	29	NA	NA
WP_049444478.1|994751_996884_-	hypothetical protein	NA	L7TLW2	Rhizobium_phage	31.5	3.6e-66
WP_005412402.1|996883_997474_-	hypothetical protein	NA	A0A2R2ZGD2	Ralstonia_phage	41.9	1.7e-26
WP_049444480.1|997624_998578_-	hypothetical protein	NA	L7TJ83	Rhizobium_phage	42.9	8.3e-63
WP_049444481.1|998604_999390_-	hypothetical protein	NA	A0A1B1IVZ8	uncultured_Mediterranean_phage	30.1	2.5e-20
WP_160314196.1|999389_999533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049444483.1|999549_1001106_-|head,tail	phage collar / T7-like phage head-to-tail joining protein	head,tail	L7TJ79	Rhizobium_phage	37.6	6.7e-86
WP_005412406.1|1001098_1001251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004154580.1|1001271_1001451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049444485.1|1001515_1002052_-	adenylate kinase	NA	A0A2H4J8A1	uncultured_Caudovirales_phage	46.1	1.4e-30
WP_049444487.1|1002176_1002383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004154583.1|1002370_1003204_-	hypothetical protein	NA	M1HMA9	Pelagibacter_phage	36.0	2.0e-36
WP_005412410.1|1003200_1003350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043033722.1|1003346_1003658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005412412.1|1003654_1003903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005412414.1|1004053_1004419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053091908.1|1004415_1004754_-	hypothetical protein	NA	A0A2H4P845	Pseudomonas_phage	52.1	2.8e-21
WP_065428123.1|1004735_1006574_-	ribonuclease H-like domain-containing protein	NA	A0A2R2ZGG6	Ralstonia_phage	50.5	2.8e-163
WP_053448915.1|1006586_1007237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005412417.1|1007247_1007496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065428124.1|1007661_1009128_-	toprim domain-containing protein	NA	L7TLT7	Rhizobium_phage	56.6	2.5e-151
WP_049434079.1|1009279_1009459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049444493.1|1009455_1009842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004154593.1|1009853_1010216_-	N-acetylmuramoyl-L-alanine amidase	NA	I6Q9Z5	Yersinia_phage	40.6	2.5e-15
WP_049444495.1|1010216_1010654_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A2I7QZP6	Vibrio_phage	31.1	1.2e-05
WP_049444497.1|1010637_1011303_-	hypothetical protein	NA	A0A076YJ33	Mesorhizobium_phage	40.8	1.3e-25
WP_160314197.1|1011302_1011461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005412421.1|1011460_1011745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005412422.1|1011737_1011881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049444498.1|1011925_1014361_-	T3/T7 RNA polymerase	NA	L7TQW5	Rhizobium_phage	40.7	5.6e-164
>prophage 2
NZ_CP011010	Stenotrophomonas maltophilia strain ISMMS3 isolate Patient 2 chromosome 1, complete sequence	4804002	1018308	1138576	4804002	integrase,tail,plate,capsid,transposase,head,protease	Escherichia_phage(17.24%)	116	1070725:1070771	1081453:1081499
WP_004154600.1|1018308_1019598_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.0	2.9e-135
WP_053448918.1|1019740_1022188_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.3	1.3e-221
WP_004146343.1|1022405_1022678_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	61.8	7.7e-22
WP_053448919.1|1023522_1025478_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_053448920.1|1025722_1026922_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_053448921.1|1026918_1027683_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_053448922.1|1027694_1028339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014036151.1|1028351_1028804_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	53.4	1.0e-42
WP_053448923.1|1028808_1029540_+	DNA polymerase III subunit epsilon	NA	A2I2Z6	Vibrio_virus	28.9	1.3e-07
WP_008268107.1|1029650_1030355_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_053448924.1|1030919_1031324_+	hypothetical protein	NA	A0A1C9C5K8	Heterosigma_akashiwo_virus	35.3	3.8e-17
WP_053448925.1|1031373_1032420_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_053448926.1|1032440_1033190_+	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
WP_053448927.1|1033189_1033957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053448928.1|1033953_1034343_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_049456890.1|1034818_1035136_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_053448929.1|1035502_1046389_+	autotransporter-associated beta strand repeat-containing protein	NA	NA	NA	NA	NA
WP_053451250.1|1046446_1046890_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_053448930.1|1046972_1048094_-	DUF3667 domain-containing protein	NA	NA	NA	NA	NA
WP_053448931.1|1048643_1050695_+	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	41.8	6.2e-47
WP_004154630.1|1050701_1051022_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_008267969.1|1051132_1051732_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_053448932.1|1051799_1052159_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_004154632.1|1052236_1052764_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_053448933.1|1052760_1054710_-	DUF3488 domain-containing transglutaminase family protein	NA	NA	NA	NA	NA
WP_053448934.1|1054702_1055647_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_053448935.1|1055649_1056603_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_053448936.1|1056645_1058481_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_053448937.1|1058576_1059146_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_049457624.1|1059258_1059768_+	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_004154640.1|1059875_1060070_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_053448938.1|1060161_1061139_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_053448939.1|1061217_1062000_+	serine/threonine protein phosphatase	NA	NA	NA	NA	NA
WP_008268782.1|1062136_1063081_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_053448940.1|1063163_1063907_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.9	1.1e-12
WP_005408313.1|1064059_1064299_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	44.6	4.6e-10
WP_049457622.1|1064442_1065705_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_053448941.1|1065891_1067256_+	aminodeoxychorismate synthase component I	NA	NA	NA	NA	NA
WP_004154649.1|1067421_1068483_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_053448942.1|1068595_1069261_+	dTMP kinase	NA	W8D0J5	Erwinia_phage	34.9	3.2e-21
WP_053448943.1|1069257_1070214_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_004154652.1|1070210_1070564_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
1070725:1070771	attL	CCTTCACACGGCAAGGGTCACAGGTTCGATCCCTGTACCGCCCACCA	NA	NA	NA	NA
WP_148564930.1|1070866_1071169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053448945.1|1071461_1074809_-|tail	phage tail tape measure protein	tail	A0A2R3UAA7	Siphoviridae_environmental_samples	27.5	2.3e-30
WP_053451251.1|1074818_1075094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053448946.1|1075475_1076618_-|capsid	phage major capsid protein	capsid	Q2NPI4	Xanthomonas_virus	25.2	2.3e-14
WP_053448947.1|1076614_1077280_-|head,protease	HK97 family phage prohead protease	head,protease	Q9MCV5	Escherichia_phage	28.5	3.1e-08
WP_148564931.1|1077246_1077558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053448948.1|1077827_1078262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053448949.1|1078267_1078522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053448950.1|1078518_1078809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053448951.1|1078805_1079177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053448952.1|1079283_1079478_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_148564932.1|1079605_1080130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053448954.1|1080160_1081333_-|integrase	integrase family protein	integrase	NA	NA	NA	NA
WP_053448955.1|1081583_1082147_-	hypothetical protein	NA	NA	NA	NA	NA
1081453:1081499	attR	CCTTCACACGGCAAGGGTCACAGGTTCGATCCCTGTACCGCCCACCA	NA	NA	NA	NA
WP_053448956.1|1082199_1082607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053448957.1|1083172_1083553_+	tautomerase family protein	NA	NA	NA	NA	NA
WP_053448958.1|1083584_1084658_-	phage late control D family protein	NA	D5LGY1	Escherichia_phage	52.8	1.7e-96
WP_053448959.1|1084648_1084864_-|tail	tail protein X	tail	A0A193GYC8	Enterobacter_phage	54.3	3.6e-14
WP_004154659.1|1084847_1085315_-|tail	phage tail protein	tail	A0A218M4I2	Erwinia_phage	36.1	8.3e-16
WP_053448960.1|1085317_1087780_-|tail	phage tail tape measure protein	tail	K4ICR4	Acidithiobacillus_phage	26.6	2.7e-12
WP_004154663.1|1087900_1088191_-|tail	phage tail assembly protein	tail	A0A193GYZ8	Enterobacter_phage	54.9	4.2e-18
WP_004154666.1|1088272_1088776_-|tail	phage major tail tube protein	tail	A0A193GYM4	Enterobacter_phage	54.8	7.1e-45
WP_053448961.1|1088778_1089978_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	D5LGY7	Escherichia_phage	53.4	1.9e-125
WP_053448962.1|1090672_1092190_-|tail	tail fiber protein	tail	V9IQX0	Stenotrophomonas_phage	56.4	1.3e-70
WP_053448963.1|1092197_1093499_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	50.6	4.8e-45
WP_053448964.1|1093491_1094388_-|plate	baseplate J/gp47 family protein	plate	V5YTH6	Pseudomonas_phage	53.5	3.3e-77
WP_005408332.1|1094390_1094729_-	GPW/gp25 family protein	NA	A0A193GYY8	Enterobacter_phage	62.2	7.8e-32
WP_053448965.1|1094781_1095372_-|plate	phage baseplate assembly protein V	plate	A0A193GYL5	Enterobacter_phage	38.7	2.8e-24
WP_053448966.1|1095368_1095920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053448967.1|1096037_1096298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053448968.1|1096281_1096659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053448969.1|1096655_1097141_-	glycoside hydrolase family 104 protein	NA	D5LH07	Escherichia_phage	54.7	2.7e-41
WP_053448970.1|1097137_1097488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053448971.1|1097484_1097934_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_053448972.1|1098266_1098650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053448973.1|1098801_1099353_-	hypothetical protein	NA	A0A2H4PGJ5	Streptomyces_phage	32.4	1.1e-06
WP_053448974.1|1099394_1099622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053448975.1|1099780_1102117_-	toprim domain-containing protein	NA	D5LH15	Escherichia_phage	43.4	2.3e-138
WP_080374871.1|1102597_1102822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053448976.1|1102833_1103088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053448977.1|1103299_1103686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053448978.1|1103814_1105953_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_053448979.1|1105964_1107470_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_053448980.1|1107479_1108613_-	MFS transporter	NA	NA	NA	NA	NA
WP_053448981.1|1108624_1109401_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_053448982.1|1109527_1110175_+	Qnr family pentapeptide repeat protein	NA	NA	NA	NA	NA
WP_053448983.1|1110190_1110865_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_053448984.1|1110942_1112322_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_053451252.1|1112454_1113318_+	DMT family transporter	NA	NA	NA	NA	NA
WP_053448985.1|1113474_1114356_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_053448986.1|1114394_1115273_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053451253.1|1115286_1116186_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	20.6	1.0e-06
WP_053448987.1|1116292_1117810_+	MFS transporter	NA	NA	NA	NA	NA
WP_053448988.1|1117793_1119881_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_053448989.1|1120212_1120617_-	GFA family protein	NA	NA	NA	NA	NA
WP_080374872.1|1120788_1121763_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_053448991.1|1121762_1123784_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_053448992.1|1123872_1125294_-	MFS transporter	NA	NA	NA	NA	NA
WP_008267329.1|1125323_1125758_+	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_053448993.1|1125840_1126443_-	short chain dehydrogenase	NA	NA	NA	NA	NA
WP_053448994.1|1126543_1127422_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053448995.1|1127458_1128280_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_053448996.1|1128298_1128976_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_006422551.1|1129063_1130101_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_049434422.1|1130179_1131343_+	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_053448997.1|1131629_1132613_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_053448998.1|1132688_1133588_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053448999.1|1133913_1134126_+	DUF4287 domain-containing protein	NA	NA	NA	NA	NA
WP_049456208.1|1134237_1134945_+	YitT family protein	NA	NA	NA	NA	NA
WP_053449000.1|1135018_1135561_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_006422622.1|1135650_1136217_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_180879650.1|1136236_1136704_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_049456205.1|1136720_1137671_+	aspartate carbamoyltransferase catalytic subunit	NA	NA	NA	NA	NA
WP_053449001.1|1138084_1138576_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP011010	Stenotrophomonas maltophilia strain ISMMS3 isolate Patient 2 chromosome 1, complete sequence	4804002	1857441	1880345	4804002	tail,terminase,head	Xanthomonas_virus(23.53%)	26	NA	NA
WP_053449452.1|1857441_1857978_+	hypothetical protein	NA	Q2NPA7	Xanthomonas_phage	53.0	8.0e-39
WP_053449453.1|1857974_1858301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053449454.1|1858297_1858513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053449455.1|1859333_1859792_+|terminase	terminase small subunit	terminase	I6NV32	Burkholderia_virus	53.5	4.2e-12
WP_148565011.1|1859742_1861275_+|terminase	phage terminase large subunit	terminase	H9C0U8	Aeromonas_phage	39.9	9.6e-77
WP_053449457.1|1861274_1862633_+	DUF1073 domain-containing protein	NA	A0A2H4J4I9	uncultured_Caudovirales_phage	50.9	1.7e-125
WP_053449458.1|1862636_1863839_+	DUF2213 domain-containing protein	NA	A0A2I7S040	Vibrio_phage	32.4	7.1e-19
WP_053449459.1|1863842_1864310_+	hypothetical protein	NA	A0A2R3UAC1	Siphoviridae_environmental_samples	60.1	1.1e-31
WP_053449460.1|1864322_1865255_+	DUF2184 domain-containing protein	NA	A0A2R3UA82	Siphoviridae_environmental_samples	71.7	4.4e-125
WP_053449461.1|1865300_1865645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053449462.1|1865647_1866160_+	hypothetical protein	NA	A0A059VG19	Pseudomonas_phage	53.5	2.4e-40
WP_053449463.1|1866156_1866513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187299802.1|1866569_1867589_+|head	head morphogenesis protein	head	A0A2H4IY91	uncultured_Caudovirales_phage	43.5	1.6e-51
WP_053449465.1|1867578_1868004_+	hypothetical protein	NA	A0A076G8G8	Sinorhizobium_phage	38.2	1.5e-19
WP_053449466.1|1868000_1868408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053449467.1|1868451_1868910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053449468.1|1868906_1869149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148564957.1|1869226_1869781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053449470.1|1869888_1870356_+	hypothetical protein	NA	W6EKF5	Rhizobium_phage	52.6	7.7e-38
WP_053449471.1|1870458_1870851_+	hypothetical protein	NA	W6EC11	Rhizobium_phage	31.1	1.4e-11
WP_053449472.1|1870879_1871194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053449473.1|1871193_1874124_+|tail	phage tail length tape measure family protein	tail	A0A2R3UAA7	Siphoviridae_environmental_samples	29.4	2.5e-81
WP_053449474.1|1874120_1874477_+	hypothetical protein	NA	C4ML17	Xanthomonas_virus	43.2	3.8e-21
WP_049458474.1|1874473_1874935_+	DUF1833 family protein	NA	I7GYA2	Xanthomonas_virus	53.0	1.2e-38
WP_053449475.1|1874934_1875330_+	hypothetical protein	NA	A5H1M4	Xanthomonas_virus	48.0	2.8e-28
WP_187299803.1|1875320_1880345_+	carbohydrate-binding protein	NA	C4ML20	Xanthomonas_virus	47.6	0.0e+00
>prophage 4
NZ_CP011010	Stenotrophomonas maltophilia strain ISMMS3 isolate Patient 2 chromosome 1, complete sequence	4804002	2908944	2937005	4804002	portal,terminase,tail,capsid,head,protease	uncultured_Caudovirales_phage(25.0%)	39	NA	NA
WP_053450081.1|2908944_2913972_-	hypothetical protein	NA	C4ML20	Xanthomonas_virus	47.0	0.0e+00
WP_053450082.1|2913962_2914358_-	hypothetical protein	NA	Q52PK9	Xanthomonas_phage	46.8	2.0e-26
WP_053450083.1|2914357_2914819_-	DUF1833 family protein	NA	Q52PL0	Xanthomonas_phage	46.4	3.0e-34
WP_053450084.1|2914815_2915172_-	hypothetical protein	NA	C4ML17	Xanthomonas_virus	42.4	3.5e-22
WP_053450085.1|2915235_2918826_-|tail	phage tail tape measure protein	tail	A0A2H4J7J3	uncultured_Caudovirales_phage	26.8	7.6e-24
WP_148564978.1|2918877_2919276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053451339.1|2919312_2919531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008265925.1|2919635_2919983_-	hypothetical protein	NA	G9FHI3	Rhodococcus_phage	52.2	3.4e-22
WP_053450086.1|2919986_2920439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053450087.1|2920506_2920845_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_053450088.1|2920841_2921243_-	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	28.9	1.6e-07
WP_053450089.1|2921235_2921583_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_008267712.1|2921582_2921891_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J8C5	uncultured_Caudovirales_phage	52.0	7.1e-24
WP_187299770.1|2921890_2922382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053450090.1|2922448_2923660_-|capsid	phage major capsid protein	capsid	A0A2H4J8D1	uncultured_Caudovirales_phage	63.9	3.0e-142
WP_053450091.1|2923656_2924304_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JA51	uncultured_Caudovirales_phage	74.8	3.2e-82
WP_053450092.1|2924296_2925553_-|portal	phage portal protein	portal	A0A2H4JFN7	uncultured_Caudovirales_phage	71.9	1.7e-164
WP_053451340.1|2925549_2927340_-|terminase	terminase	terminase	A0A0U2C138	Paracoccus_phage	50.1	6.9e-151
WP_053450093.1|2927389_2927668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080374937.1|2927965_2928292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148564979.1|2928288_2928537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053450094.1|2928529_2928913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053450095.1|2928919_2929282_-	hypothetical protein	NA	Q3HQZ9	Burkholderia_phage	63.2	2.4e-39
WP_053450096.1|2929281_2929560_-	hypothetical protein	NA	K7ZJS3	Xanthomonas_citri_phage	48.9	2.1e-14
WP_008265830.1|2929556_2929760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008267275.1|2929815_2930298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040006572.1|2930294_2930750_-	hypothetical protein	NA	K7ZPX3	Xanthomonas_citri_phage	35.1	4.9e-13
WP_053450097.1|2930746_2931232_-	glycoside hydrolase family 104 protein	NA	Q8SBE0	Shigella_phage	66.0	4.9e-51
WP_053450098.1|2931327_2932044_-	hypothetical protein	NA	C8CLH7	Xylella_phage	48.5	1.4e-49
WP_148564981.1|2932147_2932402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053450100.1|2932401_2932701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053450102.1|2932897_2933266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040008728.1|2933265_2933463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053450103.1|2933459_2934122_-	hypothetical protein	NA	A0A1B0VMD9	Pseudomonas_phage	38.3	2.4e-24
WP_053450104.1|2934111_2935005_-	helix-turn-helix domain-containing protein	NA	A0A0U4IBP5	Pseudomonas_phage	39.4	1.1e-29
WP_053450105.1|2935006_2935321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053450106.1|2935547_2935733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187299771.1|2935792_2936236_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_187299772.1|2936234_2937005_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	29.5	6.6e-18
