The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012266	Cronobacter dublinensis subsp. dublinensis LMG 23823 chromosome, complete genome	4431067	1864187	1874388	4431067	tRNA	Tupanvirus(28.57%)	12	NA	NA
WP_007725001.1|1864187_1866116_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	5.5e-130
WP_015741001.1|1866119_1866662_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.3	1.4e-14
WP_001124225.1|1866759_1866957_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|1867004_1867361_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_134792931.1|1867380_1867527_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_007747462.1|1867747_1868731_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.9	2.9e-34
WP_038883823.1|1868746_1871134_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	27.1	2.1e-06
WP_007725015.1|1871138_1871438_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_032967387.1|1871515_1872517_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_007725021.1|1872548_1873100_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_038883819.1|1873099_1873846_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	25.6	1.1e-06
WP_007725028.1|1873923_1874388_+	lipoprotein nlpC precursor	NA	S5MM68	Bacillus_phage	36.9	2.8e-11
>prophage 2
NZ_CP012266	Cronobacter dublinensis subsp. dublinensis LMG 23823 chromosome, complete genome	4431067	2598735	2666432	4431067	tail,protease,capsid,integrase,holin,head,lysis,terminase	Cronobacter_phage(27.08%)	76	2610667:2610694	2666508:2666535
WP_007714117.1|2598735_2599614_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_032966637.1|2599809_2601858_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.3	5.5e-88
WP_038883386.1|2601877_2602567_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_032966636.1|2602667_2603162_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_007714107.1|2603290_2604574_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_007714104.1|2604542_2607176_+	PqiB family protein	NA	NA	NA	NA	NA
WP_007714101.1|2607252_2608692_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_007698851.1|2608802_2609042_+	YebV family protein	NA	NA	NA	NA	NA
WP_007714097.1|2609152_2609344_+	YebW family protein	NA	NA	NA	NA	NA
WP_007714093.1|2609344_2609989_-	Serine/threonine protein phosphatase 1	NA	K7P6H8	Enterobacteria_phage	51.6	2.1e-57
2610667:2610694	attL	ATAAAAAAAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_032967635.1|2611432_2612128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071602715.1|2612469_2613003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032967636.1|2613554_2613968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032967638.1|2614255_2614822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007732003.1|2615368_2616274_-	NmrA/HSCARG family protein	NA	NA	NA	NA	NA
WP_007732006.1|2616413_2617331_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038883378.1|2617613_2618822_-	MFS transporter	NA	NA	NA	NA	NA
WP_071602714.1|2618960_2619611_+	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_038883377.1|2619761_2621024_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	97.1	3.9e-241
WP_032966629.1|2621007_2621445_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	F1C5A6	Cronobacter_phage	97.2	1.3e-74
WP_050569275.1|2621581_2621809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050569274.1|2621801_2622044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053532892.1|2624152_2625112_-	hypothetical protein	NA	I6PBN9	Cronobacter_phage	84.6	3.3e-160
WP_038883370.1|2625111_2628414_-	host specificity protein J	NA	F1C571	Cronobacter_phage	82.5	0.0e+00
WP_053532894.1|2628463_2629060_-|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	85.1	7.5e-86
WP_007709645.1|2629056_2629761_-	C40 family peptidase	NA	F1C573	Cronobacter_phage	96.2	3.4e-138
WP_053532896.1|2629763_2630516_-|tail	phage minor tail protein L	tail	F1C574	Cronobacter_phage	96.0	3.5e-141
WP_007728442.1|2630522_2630861_-|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	60.7	1.4e-36
WP_050569273.1|2630907_2633265_-|tail	phage tail tape measure protein	tail	Q9MCU6	Escherichia_phage	53.0	1.0e-210
WP_081225690.1|2633431_2633608_-	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_007732687.1|2633839_2634322_-	Lambda gpG analog	NA	K7PJU9	Enterobacteria_phage	81.7	1.0e-48
WP_007732685.1|2634370_2634874_-|tail	phage tail fibers	tail	Q9MCU9	Escherichia_phage	85.2	2.2e-75
WP_007732682.1|2634922_2635288_-	DUF3168 domain-containing protein	NA	K7PHI9	Enterobacteria_phage	83.5	4.6e-54
WP_007732679.1|2635284_2635770_-	HK97 gp10 family phage protein	NA	A0A0U3TGT7	Pseudomonas_phage	65.0	8.0e-54
WP_032967656.1|2635762_2636095_-|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	68.2	1.6e-37
WP_007732664.1|2636097_2636304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007732662.1|2636374_2636701_-|head,tail	phage gp6-like head-tail connector protein	head,tail	S4TSQ3	Salmonella_phage	56.5	1.5e-24
WP_007889812.1|2639260_2639428_-	hypothetical protein	NA	S4TR49	Salmonella_phage	67.3	3.2e-10
WP_007732656.1|2639465_2641406_-|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	91.1	0.0e+00
WP_007732655.1|2641464_2643123_-|terminase	terminase large subunit	terminase	Q3HQS7	Burkholderia_phage	71.1	2.0e-237
WP_038883350.1|2643126_2643624_-|terminase	terminase small subunit	terminase	S4TNN3	Salmonella_phage	70.3	3.1e-53
WP_032967289.1|2643728_2644097_-	HNH endonuclease	NA	S4TTG9	Salmonella_phage	82.8	2.7e-54
WP_007723109.1|2644089_2644680_-	hypothetical protein	NA	K7PGW6	Enterobacterial_phage	72.2	2.9e-82
WP_032967287.1|2644791_2645310_+	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	53.3	1.9e-37
WP_038883348.1|2645464_2646922_-	glycosyltransferase	NA	F1C589	Cronobacter_phage	87.0	2.1e-259
WP_032967286.1|2646969_2647386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050555353.1|2647573_2648056_-|lysis	lysis protein	lysis	G0ZNC9	Cronobacter_phage	72.4	6.3e-51
WP_053532898.1|2648055_2648679_-	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	91.3	8.3e-104
WP_007709085.1|2648675_2648960_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	54.3	2.9e-19
WP_007734264.1|2648946_2649327_-	hypothetical protein	NA	F1C592	Cronobacter_phage	94.4	8.5e-59
WP_007734261.1|2649417_2649825_-	type II toxin-antitoxin system HicB family antitoxin	NA	F1C593	Cronobacter_phage	66.7	3.5e-42
WP_032967702.1|2649874_2650051_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	62.1	4.2e-13
WP_007734259.1|2650227_2650917_-	antiterminator-like protein	NA	I6PDF8	Cronobacter_phage	49.8	7.1e-56
WP_032967701.1|2651080_2651446_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	81.7	8.1e-51
WP_032967700.1|2651442_2651733_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	86.5	2.6e-44
WP_032967699.1|2651725_2651893_-	hypothetical protein	NA	G8C7V4	Escherichia_phage	72.7	5.2e-13
WP_007734254.1|2652166_2652622_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	68.9	1.5e-57
WP_134792955.1|2652916_2653765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032967697.1|2653974_2654196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007734253.1|2654192_2654897_-	phage DNA replication protein P	NA	A0A2H4J1B6	uncultured_Caudovirales_phage	59.2	6.6e-73
WP_007734252.1|2654893_2655862_-	phage replication protein	NA	A5VW95	Enterobacteria_phage	85.6	7.7e-56
WP_032967696.1|2655921_2656740_-	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	63.6	4.0e-90
WP_050555394.1|2656784_2657366_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	59.2	2.4e-52
WP_007734250.1|2657429_2657645_-	helix-turn-helix domain-containing protein	NA	Q716D6	Shigella_phage	60.6	1.3e-16
WP_032967695.1|2657744_2658377_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	36.9	6.0e-33
WP_007734243.1|2658902_2659133_+	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	45.8	3.5e-07
WP_007734241.1|2659129_2659312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032967704.1|2659512_2659818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032967693.1|2659954_2660254_+	host nuclease inhibitor GamL	NA	NA	NA	NA	NA
WP_032967692.1|2660250_2661147_+	endonuclease	NA	Q858E0	Salmonella_phage	67.4	3.7e-113
WP_007734236.1|2661157_2662012_+	recombination protein RecT	NA	Q858E1	Salmonella_phage	73.9	3.2e-114
WP_007734232.1|2662178_2662931_+	hypothetical protein	NA	M1FN76	Enterobacteria_phage	90.4	4.0e-137
WP_032967691.1|2663591_2663810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134792954.1|2664368_2664563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032967689.1|2665105_2665378_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	64.4	1.1e-28
WP_038883315.1|2665346_2666432_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	66.5	1.3e-141
2666508:2666535	attR	ATAAAAAAAGACCGAATACGATTCCTGT	NA	NA	NA	NA
>prophage 3
NZ_CP012266	Cronobacter dublinensis subsp. dublinensis LMG 23823 chromosome, complete genome	4431067	2796161	2805111	4431067		Burkholderia_phage(33.33%)	9	NA	NA
WP_007732459.1|2796161_2797832_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	38.6	1.2e-24
WP_007732461.1|2798033_2798216_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_007732463.1|2798305_2799220_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_038883273.1|2799398_2800310_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_007716359.1|2800313_2800811_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.3	3.4e-31
WP_038883325.1|2800794_2802183_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	53.6	3.3e-100
WP_007716354.1|2802288_2802987_-	phosphohydrolase	NA	S4W232	Pandoravirus	25.8	5.6e-08
WP_007716352.1|2803596_2804721_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	55.7	3.3e-103
WP_007716350.1|2804871_2805111_+	DinI family protein	NA	K7PKM2	Enterobacterial_phage	82.3	4.7e-31
>prophage 4
NZ_CP012266	Cronobacter dublinensis subsp. dublinensis LMG 23823 chromosome, complete genome	4431067	2863162	2872129	4431067		Enterobacteria_phage(33.33%)	9	NA	NA
WP_038883261.1|2863162_2864266_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	28.7	2.7e-41
WP_038883259.1|2864265_2865198_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_032967536.1|2865198_2865651_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_032967537.1|2865622_2866045_-	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_032967538.1|2866041_2866911_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	2.9e-110
WP_007728977.1|2866913_2867987_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	52.5	3.0e-101
WP_038870797.1|2868379_2869270_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	40.9	2.8e-44
WP_007728981.1|2869503_2870499_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A0K1L6Z1	Scale_drop_disease_virus	26.1	4.2e-09
WP_038883258.1|2870713_2872129_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	35.3	1.3e-16
>prophage 5
NZ_CP012266	Cronobacter dublinensis subsp. dublinensis LMG 23823 chromosome, complete genome	4431067	3014145	3028196	4431067	holin,protease,lysis	Salmonella_phage(27.78%)	24	NA	NA
WP_032806383.1|3014145_3014610_-|lysis	lysis protein	lysis	F1C590	Cronobacter_phage	59.6	2.2e-37
WP_053532902.1|3014609_3015233_-	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	90.8	3.4e-105
WP_007709085.1|3015229_3015514_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	54.3	2.9e-19
WP_007747946.1|3015500_3015881_-	membrane protein	NA	F1C592	Cronobacter_phage	97.6	4.5e-60
WP_071602705.1|3016086_3016269_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	52.5	4.4e-13
WP_007728176.1|3016325_3016739_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	41.5	3.8e-20
WP_007728178.1|3016921_3017680_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	59.9	7.8e-80
WP_050569268.1|3017698_3018712_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	63.8	1.5e-126
WP_050555368.1|3018744_3019470_-	antirepressor	NA	G0ZND1	Cronobacter_phage	54.8	1.7e-55
WP_038883190.1|3019485_3019869_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	75.6	1.2e-49
WP_007728842.1|3019865_3020195_-|protease	SOS-response repressor and protease LexA	protease	U5P451	Shigella_phage	48.1	4.8e-18
WP_007728839.1|3020191_3021370_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	82.2	2.7e-103
WP_007728837.1|3021369_3021606_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_053532904.1|3021602_3022499_-	GntR family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	61.0	6.7e-38
WP_015386538.1|3022495_3022663_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_015740892.1|3022856_3023393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071602701.1|3023423_3023681_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	77.5	1.9e-25
WP_032966864.1|3023778_3024474_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	73.5	2.2e-89
WP_007716873.1|3024747_3025119_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	70.7	5.7e-44
WP_007716876.1|3025150_3025975_+	YfdQ family protein	NA	U5P439	Shigella_phage	67.9	3.3e-100
WP_032966860.1|3026107_3026500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007716879.1|3026489_3026765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007716881.1|3026800_3027010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007716884.1|3027011_3028196_+	hypothetical protein	NA	A0A2D1GN00	Marinobacter_phage	32.1	2.2e-36
>prophage 6
NZ_CP012266	Cronobacter dublinensis subsp. dublinensis LMG 23823 chromosome, complete genome	4431067	3388146	3489691	4431067	tail,protease,capsid,tRNA,integrase,portal,holin,head,lysis,terminase	Cronobacter_phage(58.57%)	107	3417151:3417210	3490413:3490487
WP_007726962.1|3388146_3388920_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_032967439.1|3388950_3389499_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_004385557.1|3389517_3389766_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_007681558.1|3390038_3391400_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_007726968.1|3391562_3392354_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_007726970.1|3392381_3393671_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_007726974.1|3393732_3394326_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_007726977.1|3394448_3395327_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_007726980.1|3395413_3397075_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_007726983.1|3397291_3397636_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_007726984.1|3397728_3398019_-	RnfH family protein	NA	NA	NA	NA	NA
WP_007681574.1|3398008_3398446_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_007726986.1|3398594_3399077_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	48.1	1.0e-29
WP_007726988.1|3399268_3400438_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_007726990.1|3400447_3402583_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	29.4	1.3e-26
WP_007726992.1|3402606_3403956_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_038884352.1|3404045_3416207_-	BapA prefix-like domain-containing protein	NA	NA	NA	NA	NA
3417151:3417210	attL	GACGCGGGTTCAACTCCCGCCAGCTCCACCAAATAAAACAAGGGGTTACGCGCAAGCGTA	NA	NA	NA	NA
WP_134792935.1|3417343_3417817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134792936.1|3418153_3418789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164474027.1|3418944_3419220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032967442.1|3419422_3419971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038884354.1|3420081_3421782_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	97.0	2.9e-260
WP_032966269.1|3421784_3422333_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	91.2	5.6e-80
WP_007710789.1|3422304_3423030_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	90.0	1.5e-96
WP_032966270.1|3423019_3423451_-|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	46.0	2.0e-24
WP_007710796.1|3423452_3425300_-	hypothetical protein	NA	F1BUK3	Cronobacter_phage	91.1	2.0e-169
WP_007710799.1|3425308_3425896_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	98.5	4.7e-109
WP_007710801.1|3425888_3427073_-	bacteriophage protein	NA	F1BUK6	Cronobacter_phage	97.2	8.1e-217
WP_007710803.1|3427069_3427396_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	100.0	2.8e-55
WP_007710805.1|3427395_3429453_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	98.2	0.0e+00
WP_007710810.1|3429640_3429898_-	phage gene	NA	A5X9I7	Aeromonas_virus	64.6	1.2e-21
WP_007710820.1|3430044_3430377_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	97.3	7.4e-51
WP_007710822.1|3430376_3430718_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	98.0	7.3e-54
WP_007710824.1|3430718_3431012_-|holin	holin	holin	C7BGD7	Burkholderia_phage	50.6	6.8e-16
WP_007710825.1|3431021_3431477_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	99.3	8.5e-82
WP_032966271.1|3431473_3432601_-	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	98.4	3.3e-207
WP_032966272.1|3432597_3433305_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	99.1	2.7e-127
WP_007710834.1|3433304_3433805_-	hypothetical protein	NA	F1BUL7	Cronobacter_phage	96.3	8.7e-88
WP_032966274.1|3433801_3434293_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	100.0	2.3e-77
WP_007710839.1|3434350_3435049_-	phage gene	NA	F1BUM0	Cronobacter_phage	97.8	3.3e-125
WP_007710841.1|3435052_3436075_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	97.6	4.7e-189
WP_007710842.1|3436135_3436960_-|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	95.3	3.7e-152
WP_032966284.1|3437124_3438903_+|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	97.6	0.0e+00
WP_007710845.1|3438899_3439937_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	98.6	8.2e-197
WP_007751594.1|3439936_3440260_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	99.1	1.5e-53
WP_032966276.1|3440670_3441096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032991145.1|3441088_3441793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007710851.1|3441880_3443743_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	93.7	0.0e+00
WP_032966277.1|3444042_3444345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007710855.1|3444372_3444606_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_007751600.1|3444672_3445074_-	hypothetical protein	NA	F1BUN2	Cronobacter_phage	95.5	8.6e-70
WP_007710857.1|3445077_3445389_-	hypothetical protein	NA	F1BUN5	Cronobacter_phage	98.1	9.7e-53
WP_007710858.1|3445486_3445678_-	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_032966278.1|3445688_3446192_-	hypothetical protein	NA	F1BUN6	Cronobacter_phage	99.4	6.3e-86
WP_007710860.1|3446285_3447203_+	phage repressor protein CI	NA	F1BUN8	Cronobacter_phage	99.7	1.4e-176
WP_007710861.1|3447202_3448219_+|integrase	site-specific integrase	integrase	F1BUN9	Cronobacter_phage	100.0	1.9e-198
WP_032966280.1|3448569_3448884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032966282.1|3449269_3450037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032966283.1|3450026_3450455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038884361.1|3450539_3451805_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	96.2	2.0e-237
WP_032966622.1|3451788_3452226_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	F1C5A6	Cronobacter_phage	96.6	1.5e-72
WP_038884363.1|3452818_3453604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081642525.1|3453864_3454230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053532910.1|3456433_3457393_-	hypothetical protein	NA	I6PBN9	Cronobacter_phage	83.7	1.8e-158
WP_038884377.1|3457392_3460695_-	host specificity protein J	NA	F1C571	Cronobacter_phage	82.1	0.0e+00
WP_053532894.1|3460744_3461341_-|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	85.1	7.5e-86
WP_007716443.1|3461337_3462042_-	C40 family peptidase	NA	F1C573	Cronobacter_phage	97.4	8.1e-140
WP_053532912.1|3462044_3462797_-|tail	phage minor tail protein L	tail	F1C574	Cronobacter_phage	96.8	1.1e-142
WP_007710483.1|3462803_3463142_-|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	62.5	1.9e-38
WP_038884382.1|3463188_3466461_-|tail	phage tail tape measure protein	tail	F1C575	Cronobacter_phage	93.6	0.0e+00
WP_032966252.1|3466556_3466877_-	lipoprotein	NA	M1PRT9	Cellulophaga_phage	71.7	7.2e-35
WP_007710490.1|3467002_3467272_-	DUF4035 domain-containing protein	NA	K7PLY6	Enterobacterial_phage	59.8	3.8e-21
WP_007710495.1|3467295_3467691_-|tail	phage tail assembly chaperone	tail	F1C576	Cronobacter_phage	86.3	1.7e-57
WP_004388601.1|3467740_3468196_-	hypothetical protein	NA	A0A1W6JP06	Morganella_phage	75.0	1.4e-55
WP_007710500.1|3468242_3468572_-	DUF3168 domain-containing protein	NA	A0A1P8DTJ3	Proteus_phage	51.8	1.0e-20
WP_007710503.1|3468568_3469018_-	HK97 gp10 family phage protein	NA	A0A220NRP5	Escherichia_phage	85.2	3.2e-65
WP_032966254.1|3469014_3469356_-|head	phage head closure protein	head	A0A1J0GUY4	Halomonas_phage	39.6	1.1e-06
WP_007710510.1|3469352_3469679_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	50.9	7.3e-27
WP_007710513.1|3469688_3469889_-	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	83.0	1.5e-14
WP_007710515.1|3469940_3471161_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	91.6	9.0e-203
WP_007710517.1|3471174_3472029_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	76.4	1.4e-117
WP_007710518.1|3472037_3473342_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	87.8	5.4e-222
WP_038884387.1|3473341_3475099_-|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	91.1	0.0e+00
WP_032966255.1|3475098_3475572_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	89.2	7.8e-78
WP_032966256.1|3475706_3476048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032966258.1|3476111_3476465_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	73.5	1.2e-46
WP_007710533.1|3476604_3477054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032966259.1|3477040_3477637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032966260.1|3477914_3478379_-|lysis	lysis protein	lysis	F1C590	Cronobacter_phage	56.1	3.3e-33
WP_007710538.1|3478378_3479002_-	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	91.8	1.8e-106
WP_007710540.1|3478998_3479283_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	54.3	3.7e-19
WP_053532914.1|3479269_3479650_-	hypothetical protein	NA	F1C592	Cronobacter_phage	96.8	1.0e-59
WP_134792932.1|3480013_3480295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038884395.1|3480509_3481268_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	61.1	7.1e-81
WP_038884397.1|3481286_3482336_-	DUF968 domain-containing protein	NA	S5FV02	Shigella_phage	65.3	3.2e-132
WP_038884399.1|3482332_3482713_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	76.6	5.5e-50
WP_032967401.1|3482932_3483271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007725984.1|3483365_3483701_-|protease	SOS-response repressor and protease LexA	protease	U5P451	Shigella_phage	49.0	4.9e-18
WP_007725983.1|3483697_3484876_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	82.4	2.4e-104
WP_007725982.1|3484875_3485112_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_007725981.1|3485108_3485990_-	GntR family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	59.1	1.0e-38
WP_015386538.1|3485986_3486154_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_007730303.1|3486347_3486884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032967586.1|3486912_3487143_-	transcriptional regulator	NA	U5P445	Shigella_phage	64.1	3.1e-16
WP_032967594.1|3487230_3487899_+	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	76.4	1.7e-99
WP_071602770.1|3488354_3488561_+	excisionase	NA	I6PBM8	Cronobacter_phage	71.7	3.8e-21
WP_007730305.1|3488521_3489691_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.7	6.7e-147
3490413:3490487	attR	GACGCGGGTTCAACTCCCGCCAGCTCCACCAAATAAAACAAGGGGTTACGCGCAAGCGTAGCCCCTTTTTCTTTG	NA	NA	NA	NA
>prophage 7
NZ_CP012266	Cronobacter dublinensis subsp. dublinensis LMG 23823 chromosome, complete genome	4431067	3647319	3654448	4431067	tRNA	Salmonella_phage(33.33%)	6	NA	NA
WP_007718993.1|3647319_3647562_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	60.0	7.3e-16
WP_007718991.1|3647817_3648498_+	helix-turn-helix transcriptional regulator	NA	E7C9R0	Salmonella_phage	48.9	6.0e-47
WP_007718986.1|3649090_3649846_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A7K9	Microcystis_virus	34.1	9.4e-09
WP_007718984.1|3649992_3651510_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	37.8	3.5e-87
WP_097564053.1|3651519_3652618_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	7.0e-05
WP_007718979.1|3652714_3654448_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.0	7.5e-62
>prophage 1
NZ_CP012267	Cronobacter dublinensis subsp. dublinensis LMG 23823 plasmid pCDU1, complete sequence	197338	0	14556	197338		Mycobacterium_phage(33.33%)	12	NA	NA
WP_007679865.1|3750_4128_-	response regulator	NA	NA	NA	NA	NA
WP_007727556.1|4139_4418_-	DUF1427 family protein	NA	NA	NA	NA	NA
WP_007727557.1|4414_4657_-	DUF1427 family protein	NA	NA	NA	NA	NA
WP_007727558.1|4716_5403_-	hydrolase	NA	NA	NA	NA	NA
WP_007727559.1|5703_7578_+	amidohydrolase	NA	NA	NA	NA	NA
WP_007727560.1|7582_8011_+	DoxX family protein	NA	NA	NA	NA	NA
WP_007727561.1|7997_9611_+	MFS transporter	NA	NA	NA	NA	NA
WP_007727562.1|9664_10483_+	alpha/beta hydrolase	NA	A0A220NRX7	Mycobacterium_phage	28.9	1.6e-14
WP_007727563.1|10541_11918_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_007727568.1|12193_13393_+	Starvation sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.2	1.2e-37
WP_007727571.1|13380_14100_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007750709.1|14262_14556_-	NINE protein	NA	M4ZS56	Bacillus_phage	67.2	5.8e-15
>prophage 2
NZ_CP012267	Cronobacter dublinensis subsp. dublinensis LMG 23823 plasmid pCDU1, complete sequence	197338	21649	22984	197338		Streptococcus_phage(100.0%)	1	NA	NA
WP_007727619.1|21649_22984_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	22.1	1.9e-12
>prophage 3
NZ_CP012267	Cronobacter dublinensis subsp. dublinensis LMG 23823 plasmid pCDU1, complete sequence	197338	30109	32767	197338		Cronobacter_phage(100.0%)	1	NA	NA
WP_038884987.1|30109_32767_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.4	1.0e-97
>prophage 4
NZ_CP012267	Cronobacter dublinensis subsp. dublinensis LMG 23823 plasmid pCDU1, complete sequence	197338	38729	38996	197338		Rhizobium_phage(100.0%)	1	NA	NA
WP_071602800.1|38729_38996_+	PAAR domain-containing protein	NA	R9U4D0	Rhizobium_phage	51.2	6.4e-05
>prophage 5
NZ_CP012267	Cronobacter dublinensis subsp. dublinensis LMG 23823 plasmid pCDU1, complete sequence	197338	49049	49808	197338		Indivirus(100.0%)	1	NA	NA
WP_007712564.1|49049_49808_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	27.8	7.4e-14
>prophage 6
NZ_CP012267	Cronobacter dublinensis subsp. dublinensis LMG 23823 plasmid pCDU1, complete sequence	197338	56329	63880	197338	integrase	Pandoravirus(33.33%)	4	54448:54463	62900:62915
54448:54463	attL	AAACGGAATGGAATAT	NA	NA	NA	NA
WP_007712584.1|56329_57721_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	29.8	7.7e-41
WP_038885023.1|58722_59697_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	36.6	2.6e-11
WP_007728657.1|59780_60677_-	transcription regulator Mig-14	NA	NA	NA	NA	NA
WP_007728659.1|60763_63880_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.2	2.0e-57
62900:62915	attR	AAACGGAATGGAATAT	NA	NA	NA	NA
>prophage 7
NZ_CP012267	Cronobacter dublinensis subsp. dublinensis LMG 23823 plasmid pCDU1, complete sequence	197338	71717	75975	197338		Saudi_moumouvirus(50.0%)	3	NA	NA
WP_082355750.1|71717_73169_+	hypothetical protein	NA	A0A1S5V1S5	Saudi_moumouvirus	33.7	1.4e-13
WP_032967522.1|73176_73737_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_081591119.1|74019_75975_+	acyltransferase	NA	A0A193GZ69	Enterobacter_phage	24.7	1.2e-34
>prophage 8
NZ_CP012267	Cronobacter dublinensis subsp. dublinensis LMG 23823 plasmid pCDU1, complete sequence	197338	80259	86454	197338		uncultured_Caudovirales_phage(100.0%)	5	NA	NA
WP_007733177.1|80259_81912_-	methyl-accepting chemotaxis protein I	NA	A0A2H4J162	uncultured_Caudovirales_phage	50.0	2.9e-10
WP_007733179.1|82650_83247_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_007733187.1|83396_83816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007733190.1|83878_84277_-	Exc2 family lipoprotein	NA	NA	NA	NA	NA
WP_007733193.1|84507_86454_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.4	4.0e-11
>prophage 9
NZ_CP012267	Cronobacter dublinensis subsp. dublinensis LMG 23823 plasmid pCDU1, complete sequence	197338	89676	97435	197338		Only_Syngen_Nebraska_virus(50.0%)	4	NA	NA
WP_007733202.1|89676_92388_-	magnesium-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	23.1	1.2e-34
WP_007733206.1|92938_94060_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_007733211.1|94205_94373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007733213.1|94498_97435_+	autotransporter domain-containing protein	NA	A0A160DDD4	Gordonia_phage	38.8	4.5e-06
>prophage 10
NZ_CP012267	Cronobacter dublinensis subsp. dublinensis LMG 23823 plasmid pCDU1, complete sequence	197338	116866	135534	197338		Escherichia_phage(50.0%)	5	NA	NA
WP_007733234.1|116866_117835_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	57.5	6.7e-92
WP_007733236.1|117842_119042_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	78.3	2.0e-178
WP_050555390.1|119855_120911_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	77.2	1.2e-139
WP_007733240.1|121520_123185_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_050569295.1|123198_135534_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	34.6	1.7e-27
>prophage 11
NZ_CP012267	Cronobacter dublinensis subsp. dublinensis LMG 23823 plasmid pCDU1, complete sequence	197338	158824	160710	197338		Bacillus_phage(100.0%)	2	NA	NA
WP_007727727.1|158824_159517_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.6	1.3e-25
WP_038885090.1|159513_160710_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.1	1.5e-16
>prophage 12
NZ_CP012267	Cronobacter dublinensis subsp. dublinensis LMG 23823 plasmid pCDU1, complete sequence	197338	173733	176534	197338		Moraxella_phage(50.0%)	2	NA	NA
WP_038885094.1|173733_174675_-	WYL domain-containing protein	NA	A0A0R6PH67	Moraxella_phage	27.0	8.1e-26
WP_053532932.1|175238_176534_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	35.9	1.5e-62
>prophage 13
NZ_CP012267	Cronobacter dublinensis subsp. dublinensis LMG 23823 plasmid pCDU1, complete sequence	197338	185596	190878	197338		Enterobacteria_phage(50.0%)	4	NA	NA
WP_007734014.1|185596_186340_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	48.7	1.1e-46
WP_032967680.1|186519_187527_+	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_007734009.1|187693_188890_+	MFS transporter	NA	NA	NA	NA	NA
WP_007734007.1|188958_190878_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	35.3	4.6e-20
