The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012253	Cronobacter sakazakii strain NCTC 8155 chromosome, complete genome	4329295	1033211	1075949	4329295	protease,terminase,portal,lysis,head,tail,capsid,holin	Enterobacteria_phage(26.09%)	54	NA	NA
WP_029590700.1|1033211_1034396_-	recombinase	NA	A0A2D1GN00	Marinobacter_phage	31.9	8.3e-36
WP_014728427.1|1034397_1034607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029590699.1|1034644_1035214_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.7e-63
WP_029590698.1|1035247_1035700_-	hypothetical protein	NA	G9L662	Escherichia_phage	55.8	2.7e-11
WP_029590697.1|1035696_1036269_-	hypothetical protein	NA	Q858D1	Salmonella_phage	54.0	4.1e-33
WP_029590696.1|1036349_1037279_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	61.6	7.5e-101
WP_029590694.1|1038077_1038404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007901036.1|1038565_1039444_+	hypothetical protein	NA	U3PB51	Vibrio_phage	33.8	4.2e-37
WP_012124207.1|1039435_1040125_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	42.4	7.2e-40
WP_012124208.1|1040260_1040482_+	chaperone TorD	NA	NA	NA	NA	NA
WP_007901034.1|1040532_1041084_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	67.4	6.7e-65
WP_012124209.1|1041250_1041418_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_029039460.1|1041414_1042311_+	GntR family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	55.8	1.6e-36
WP_012124212.1|1042307_1042544_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_053541496.1|1042543_1043233_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	81.4	8.3e-105
WP_029590685.1|1043229_1043562_+	LexA family transcriptional regulator	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.8	4.9e-10
WP_029590682.1|1043558_1043945_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	82.8	5.0e-59
WP_029590680.1|1043961_1044741_+	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	73.6	6.5e-106
WP_029590678.1|1044750_1045803_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	64.3	6.3e-128
WP_029590676.1|1045821_1046643_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	48.1	1.7e-59
WP_007747946.1|1047122_1047503_+	membrane protein	NA	F1C592	Cronobacter_phage	97.6	4.5e-60
WP_007710540.1|1047489_1047774_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	54.3	3.7e-19
WP_029590671.1|1047770_1048394_+	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	94.7	2.3e-109
WP_032983575.1|1048393_1048858_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	56.4	1.8e-34
WP_071886400.1|1049380_1049731_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	81.7	3.5e-51
WP_029590731.1|1049727_1049946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029590729.1|1050107_1050581_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	91.1	3.1e-79
WP_004384932.1|1050580_1052338_+|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	92.0	0.0e+00
WP_029590894.1|1052337_1053642_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	87.3	1.6e-221
WP_004384934.1|1053650_1054505_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	76.4	6.9e-117
WP_015386557.1|1054518_1055739_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	92.1	1.1e-203
WP_029590761.1|1055790_1056009_+	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	80.9	8.1e-14
WP_029590760.1|1056018_1056345_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	52.8	1.9e-27
WP_029590758.1|1056341_1056683_+|head	phage head closure protein	head	A0A1J0GUY4	Halomonas_phage	43.8	2.6e-06
WP_029590756.1|1056679_1057129_+	HK97 gp10 family phage protein	NA	K7PH04	Enterobacteria_phage	84.6	2.3e-63
WP_029590754.1|1057125_1057455_+	DUF3168 domain-containing protein	NA	A0A1P8DTJ3	Proteus_phage	53.6	1.9e-22
WP_007760125.1|1057501_1057957_+	hypothetical protein	NA	A0A1W6JP06	Morganella_phage	74.3	4.0e-55
WP_015740924.1|1058005_1058401_+|tail	phage tail protein	tail	F1C576	Cronobacter_phage	87.8	3.0e-59
WP_029590747.1|1058424_1058694_+	DUF4035 domain-containing protein	NA	K7PLY6	Enterobacterial_phage	62.1	2.0e-22
WP_029590745.1|1058764_1059106_+	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	65.5	6.5e-34
WP_053541497.1|1059161_1062434_+|tail	phage tail tape measure protein	tail	F1C575	Cronobacter_phage	96.9	0.0e+00
WP_029591094.1|1062479_1062818_+|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	62.5	2.5e-38
WP_029591093.1|1062824_1063577_+|tail	phage minor tail protein L	tail	F1C574	Cronobacter_phage	98.4	9.9e-144
WP_029590736.1|1063579_1064284_+	C40 family peptidase	NA	F1C573	Cronobacter_phage	97.0	1.4e-139
WP_029590734.1|1064280_1064877_+|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	98.5	3.9e-103
WP_053541498.1|1064926_1068088_+	host specificity protein J	NA	F1C571	Cronobacter_phage	98.6	0.0e+00
WP_029464234.1|1068087_1068378_+	hypothetical protein	NA	A0A192Y8D4	Enterobacteria_phage	36.4	9.8e-07
WP_015386571.1|1068470_1069034_+	hypothetical protein	NA	F1C570	Cronobacter_phage	55.9	9.9e-56
WP_053541499.1|1069071_1070529_+|tail	tail fiber domain-containing protein	tail	F1C569	Cronobacter_phage	97.9	3.3e-268
WP_029591065.1|1070666_1071104_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	F1C5A6	Cronobacter_phage	98.6	2.7e-77
WP_029591066.1|1071087_1072353_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	96.9	1.9e-240
WP_004387430.1|1072799_1074563_-	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_004387431.1|1074582_1074810_-	YejL family protein	NA	NA	NA	NA	NA
WP_004387432.1|1074944_1075949_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.3e-85
>prophage 2
NZ_CP012253	Cronobacter sakazakii strain NCTC 8155 chromosome, complete genome	4329295	1208677	1215005	4329295		Enterobacteria_phage(50.0%)	6	NA	NA
WP_029464222.1|1208677_1210096_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.2	1.6e-17
WP_007699430.1|1210267_1211158_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	40.3	5.6e-45
WP_015386515.1|1211549_1212632_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	52.2	4.8e-99
WP_007851126.1|1212634_1213531_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.3	1.7e-28
WP_015386516.1|1213580_1214459_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
WP_015386517.1|1214462_1215005_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	6.4e-52
>prophage 3
NZ_CP012253	Cronobacter sakazakii strain NCTC 8155 chromosome, complete genome	4329295	1261646	1270635	4329295		Burkholderia_phage(33.33%)	9	NA	NA
WP_007794693.1|1261646_1261886_-	DinI family protein	NA	K7PKM2	Enterobacterial_phage	84.8	5.5e-32
WP_007851050.1|1262039_1263164_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.7	2.5e-106
WP_004388128.1|1263808_1264507_+	phosphohydrolase	NA	S4W232	Pandoravirus	26.3	9.6e-08
WP_032804096.1|1264633_1266001_+	DNA (cytosine-5-)-methyltransferase	NA	E5E3X6	Burkholderia_phage	53.2	1.4e-100
WP_007851048.1|1265984_1266482_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	49.0	1.2e-33
WP_004388131.1|1266485_1267397_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_004388132.1|1267575_1268490_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_004388133.1|1268579_1268762_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_015386531.1|1268964_1270635_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	38.6	1.7e-23
>prophage 4
NZ_CP012253	Cronobacter sakazakii strain NCTC 8155 chromosome, complete genome	4329295	1284757	1323472	4329295	integrase,terminase,protease,portal,lysis,head,tail,capsid,holin	Enterobacteria_phage(31.71%)	49	1284703:1284725	1326812:1326834
1284703:1284725	attL	ATATTATGAATATGCAGGTTTGA	NA	NA	NA	NA
WP_015386532.1|1284757_1286047_-|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	66.2	1.9e-171
WP_015386533.1|1286081_1286339_-	excisionase family protein	NA	S4TND0	Salmonella_phage	65.8	1.5e-27
WP_015386534.1|1286663_1287071_-	hypothetical protein	NA	K7P7N0	Enterobacteria_phage	44.5	1.4e-19
WP_015386535.1|1287079_1287712_-	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	80.0	9.0e-98
WP_015386536.1|1287813_1288029_+	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	80.3	1.1e-23
WP_029464227.1|1288170_1288707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015386538.1|1288900_1289068_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_015386539.1|1289064_1289961_+	GntR family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	61.0	3.9e-38
WP_015386540.1|1289957_1290194_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_015386541.1|1290193_1291372_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	81.9	1.2e-103
WP_015386542.1|1291368_1291704_+	hypothetical protein	NA	U5P451	Shigella_phage	50.0	4.4e-19
WP_104677821.1|1291798_1292275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015386544.1|1292356_1292740_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	78.0	9.1e-53
WP_029464228.1|1292755_1293481_+	antirepressor	NA	G0ZND1	Cronobacter_phage	54.4	3.7e-55
WP_044596153.1|1293513_1294527_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	64.7	1.6e-128
WP_015386547.1|1294545_1295304_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	60.3	3.2e-81
WP_007747946.1|1295895_1296276_+	membrane protein	NA	F1C592	Cronobacter_phage	97.6	4.5e-60
WP_015386548.1|1296262_1296547_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	54.3	2.9e-19
WP_015386549.1|1296543_1297167_+	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	98.1	3.4e-113
WP_015386550.1|1297166_1297631_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	57.1	4.7e-35
WP_015386551.1|1298153_1298510_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	79.3	3.6e-51
WP_029464229.1|1298527_1299193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029464230.1|1299391_1299865_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	90.4	7.0e-79
WP_015386554.1|1299864_1301622_+|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	91.6	0.0e+00
WP_015386555.1|1301621_1302926_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	87.8	9.2e-222
WP_015386556.1|1302934_1303789_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	76.4	5.3e-117
WP_015386557.1|1303802_1305023_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	92.1	1.1e-203
WP_015386558.1|1305074_1305257_+	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	89.5	7.4e-13
WP_012124230.1|1305266_1305593_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	51.9	1.1e-25
WP_012124231.1|1305589_1305931_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_015386559.1|1305927_1306377_+	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	86.6	5.0e-66
WP_015386560.1|1306373_1306703_+	DUF3168 domain-containing protein	NA	A0A1P8DTJ3	Proteus_phage	52.7	1.1e-22
WP_015386561.1|1306763_1307219_+	hypothetical protein	NA	A0A1W6JP06	Morganella_phage	75.7	3.6e-56
WP_015386562.1|1307269_1307665_+|tail	phage tail assembly chaperone	tail	F1C576	Cronobacter_phage	87.0	3.7e-57
WP_029464231.1|1307688_1307958_+	DUF4035 domain-containing protein	NA	K7PLY6	Enterobacterial_phage	60.9	1.0e-21
WP_029464232.1|1308047_1308563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015386565.1|1308564_1308882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029464233.1|1308940_1312450_+|tail	phage tail tape measure protein	tail	F1C575	Cronobacter_phage	57.0	1.2e-252
WP_012124240.1|1312495_1312834_+|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	61.6	1.6e-37
WP_015386567.1|1312840_1313593_+|tail	phage minor tail protein L	tail	F1C574	Cronobacter_phage	99.6	8.1e-146
WP_015386568.1|1313595_1314300_+	C40 family peptidase	NA	F1C573	Cronobacter_phage	97.9	9.6e-141
WP_015386569.1|1314296_1314893_+|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	84.6	1.3e-85
WP_015386570.1|1314942_1318104_+	host specificity protein J	NA	F1C571	Cronobacter_phage	98.5	0.0e+00
WP_029464234.1|1318103_1318394_+	hypothetical protein	NA	A0A192Y8D4	Enterobacteria_phage	36.4	9.8e-07
WP_015386571.1|1318486_1319050_+	hypothetical protein	NA	F1C570	Cronobacter_phage	55.9	9.9e-56
WP_015386572.1|1319087_1320542_+|tail	tail fiber domain-containing protein	tail	F1C569	Cronobacter_phage	97.7	3.6e-267
WP_014728470.1|1320683_1321121_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	F1C5A6	Cronobacter_phage	100.0	9.4e-78
WP_015386573.1|1321104_1322367_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	98.3	6.0e-242
WP_015386574.1|1322560_1323472_-	hypothetical protein	NA	Q858R6	Enterobacteria_phage	90.8	2.9e-166
1326812:1326834	attR	ATATTATGAATATGCAGGTTTGA	NA	NA	NA	NA
>prophage 5
NZ_CP012253	Cronobacter sakazakii strain NCTC 8155 chromosome, complete genome	4329295	1602259	1612457	4329295	tRNA	Tupanvirus(14.29%)	12	NA	NA
WP_004387090.1|1602259_1604188_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.6	1.1e-130
WP_012905609.1|1604191_1604734_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.3	1.1e-14
WP_001124225.1|1604831_1605029_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124849.1|1605076_1605433_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_124752678.1|1605404_1605599_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_007867262.1|1605818_1606802_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	42.6	6.4e-34
WP_004387087.1|1606817_1609205_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	27.1	9.5e-07
WP_004387086.1|1609209_1609509_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_029464079.1|1609586_1610588_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_004387815.1|1610617_1611169_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_085960040.1|1611171_1611915_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.0	4.1e-09
WP_004387814.1|1611992_1612457_+	endopeptidase	NA	S5MM68	Bacillus_phage	36.0	1.0e-10
>prophage 6
NZ_CP012253	Cronobacter sakazakii strain NCTC 8155 chromosome, complete genome	4329295	2002195	2118659	4329295	protease,terminase,portal,transposase,head,tRNA,tail,plate,capsid	Salmonella_phage(32.5%)	109	NA	NA
WP_029591107.1|2002195_2002702_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_029464255.1|2003022_2006928_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.4	6.5e-53
WP_004386715.1|2007132_2007738_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_004388545.1|2007798_2008125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004388544.1|2008203_2008524_-	YdbL family protein	NA	NA	NA	NA	NA
WP_004388543.1|2008535_2008727_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_015386692.1|2008723_2011366_-	YdbH family protein	NA	NA	NA	NA	NA
WP_004388292.1|2011577_2012567_+	2-hydroxyacid dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	43.1	3.1e-68
WP_015386691.1|2012621_2013044_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_015386690.1|2013044_2013311_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_015386689.1|2013589_2017111_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_007850059.1|2017112_2018159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015386688.1|2018328_2019360_-	alcohol dehydrogenase AdhP	NA	A0A2K9L7I1	Tupanvirus	31.6	5.9e-38
WP_007850080.1|2019392_2020913_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_015386687.1|2021184_2022990_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_004387326.1|2022970_2024041_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_015386686.1|2024058_2024916_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	48.6	3.6e-65
WP_004387324.1|2025319_2026432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004387323.1|2026717_2027650_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.8	7.5e-141
WP_004387322.1|2027689_2027839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004387321.1|2028160_2029144_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_004387320.1|2029183_2029387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004387319.1|2029465_2029639_-	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_004387318.1|2029840_2030164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004387317.1|2030237_2030429_+	hypothetical protein	NA	I6S5X8	Salmonella_phage	46.6	2.9e-07
WP_004387316.1|2030630_2032382_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004387315.1|2033104_2033344_+	general stress protein	NA	NA	NA	NA	NA
WP_004387314.1|2033490_2033745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004387313.1|2033985_2034567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004387312.1|2035041_2035389_+	anti-adapter protein IraM	NA	NA	NA	NA	NA
WP_004387311.1|2035506_2035947_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_004387310.1|2036007_2037624_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015386685.1|2037868_2038591_+	murein tripeptide amidase MpaA	NA	NA	NA	NA	NA
WP_004387307.1|2038572_2039571_-	L-Ala-D/L-Glu epimerase	NA	NA	NA	NA	NA
WP_004387306.1|2039707_2040214_+	thiol peroxidase	NA	NA	NA	NA	NA
WP_015386684.1|2040265_2041828_-	transcriptional regulator TyrR	NA	NA	NA	NA	NA
WP_004387304.1|2041976_2043020_-	TIGR01620 family protein	NA	NA	NA	NA	NA
WP_029464254.1|2043016_2044414_-	YcjX family protein	NA	NA	NA	NA	NA
WP_004387302.1|2044579_2045572_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_004387301.1|2045621_2046704_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	28.3	9.9e-12
WP_015386683.1|2046719_2047397_-	beta-phosphoglucomutase	NA	NA	NA	NA	NA
WP_015386682.1|2047393_2049637_-	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_015386679.1|2051216_2051543_+	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_015386678.1|2051784_2052072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015386677.1|2052248_2052680_-|tail	tail assembly chaperone	tail	A0A1S6KZY8	Salmonella_phage	39.8	3.1e-17
WP_015386676.1|2052685_2053909_-	hypothetical protein	NA	Q8W613	Enterobacteria_phage	33.9	1.0e-28
WP_012124627.1|2053966_2054539_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	60.5	5.2e-60
WP_015386675.1|2054529_2055933_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	60.8	4.4e-121
WP_015386674.1|2055925_2056342_-	phage protein GP46	NA	A0A192Y6D0	Salmonella_phage	62.3	3.8e-44
WP_015386673.1|2056345_2056930_-|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	47.2	3.2e-33
WP_015386672.1|2056929_2057988_-|tail	phage tail protein	tail	A0A192Y7L7	Salmonella_phage	67.3	4.2e-132
WP_015386671.1|2057984_2059304_-|tail	tail/DNA circulation protein	tail	A0A192Y5U9	Salmonella_phage	62.1	1.6e-152
WP_015386670.1|2059339_2061265_-|tail	phage tail tape measure protein	tail	Q8W620	Enterobacteria_phage	56.6	1.4e-202
WP_007793886.1|2061352_2061679_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	63.0	2.9e-31
WP_007668785.1|2061675_2062032_-|tail	phage tail tube protein	tail	A0A192Y8K0	Salmonella_phage	77.1	1.1e-49
WP_015386669.1|2062024_2063866_-|tail	phage tail sheath protein	tail	Q8W623	Enterobacteria_phage	53.6	2.6e-169
WP_015386668.1|2063855_2064020_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	63.5	3.3e-12
WP_007793890.1|2064025_2064586_-	hypothetical protein	NA	Q8HAC7	Salmonella_phage	58.1	3.1e-57
WP_015386667.1|2064582_2065101_-	hypothetical protein	NA	A0A192Y6D2	Salmonella_phage	72.8	1.2e-66
WP_012124624.1|2065093_2065489_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	53.5	1.3e-30
WP_012124623.1|2065485_2065803_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	59.8	3.1e-30
WP_015386666.1|2065837_2066104_-	Ig domain-containing protein	NA	X4YE12	Lactococcus_phage	50.0	8.1e-08
WP_015386665.1|2066109_2067330_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	64.5	2.1e-143
WP_012124620.1|2067399_2068023_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	82.7	9.3e-79
WP_007793902.1|2068015_2069257_-|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	71.5	1.8e-174
WP_015386664.1|2069402_2071130_-|terminase	terminase large subunit	terminase	Q8W631	Enterobacteria_phage	60.3	3.2e-206
WP_015386663.1|2071133_2071562_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	57.5	4.6e-29
WP_015386662.1|2071727_2072087_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	63.5	8.6e-37
WP_015386661.1|2072701_2072959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087451024.1|2074901_2076021_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_015386637.1|2076599_2077271_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_004385373.1|2077289_2078339_-	zinc-binding alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_004385371.1|2078364_2079207_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_007850144.1|2079193_2080075_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_007901555.1|2080098_2081391_-	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015386636.1|2081402_2083118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004385366.1|2083292_2083535_-	phage shock protein PspD	NA	NA	NA	NA	NA
WP_004385365.1|2083580_2083937_-	envelope stress response membrane protein PspC	NA	NA	NA	NA	NA
WP_004385364.1|2083936_2084161_-	envelope stress response membrane protein PspB	NA	NA	NA	NA	NA
WP_004385363.1|2084226_2084898_-	phage shock protein PspA	NA	NA	NA	NA	NA
WP_029464249.1|2085050_2086052_+	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
WP_029590902.1|2086149_2087790_+	peptide ABC transporter substrate-binding protein SapA	NA	NA	NA	NA	NA
WP_004385361.1|2087786_2088752_+	peptide ABC transporter permease SapB	NA	NA	NA	NA	NA
WP_007793970.1|2088738_2089629_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_004385360.1|2089628_2090621_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	25.3	2.1e-08
WP_004385359.1|2090622_2091429_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	25.2	8.7e-13
WP_004385358.1|2091549_2092338_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_015386632.1|2092527_2093682_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_015386631.1|2093769_2095704_+	exoribonuclease II	NA	NA	NA	NA	NA
WP_015386630.1|2096000_2097995_+	cyclic di-GMP phosphodiesterase	NA	G3MA91	Bacillus_virus	33.5	2.4e-19
WP_004386707.1|2098016_2098886_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_004386706.1|2099097_2099280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004386705.1|2099293_2099956_-	fructose-6-phosphate aldolase	NA	A0A1Z1LWE4	Synechococcus_phage	29.7	1.2e-23
WP_015386629.1|2100092_2100992_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_029590906.1|2100997_2103430_+	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A2K8HAT8	Bacteriophage	45.6	3.0e-08
WP_004386704.1|2103475_2104231_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_004386703.1|2104487_2104703_+	osmotically-inducible lipoprotein OsmB	NA	NA	NA	NA	NA
WP_004386702.1|2104824_2105151_-	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_015386627.1|2105150_2105885_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_004387675.1|2106110_2107280_-	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_004387674.1|2107286_2107595_-	LapA family protein	NA	NA	NA	NA	NA
WP_004387673.1|2107742_2108507_-	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
WP_004387672.1|2108706_2109300_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	6.0e-43
WP_007850490.1|2109363_2112039_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_015386626.1|2112635_2112764_-	YmiA family putative membrane protein	NA	NA	NA	NA	NA
WP_004387670.1|2113120_2114095_-	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_004387669.1|2114281_2116879_-	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.9	1.5e-93
WP_007850502.1|2117279_2117531_+	YciN family protein	NA	NA	NA	NA	NA
WP_004387664.1|2117609_2118659_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	4.8e-19
>prophage 1
NZ_CP012254	Cronobacter sakazakii strain NCTC 8155 plasmid pCS1, complete sequence	110093	0	107936	110093	integrase,transposase,terminase,portal,tail	Salmonella_phage(92.86%)	114	19242:19259	49774:49791
WP_029590309.1|2402_2738_+|tail	tail protein	tail	J9Q6E1	Salmonella_phage	86.4	4.7e-53
WP_029590310.1|2826_3528_+|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	89.2	3.3e-125
WP_029590312.1|3517_4315_+|tail	tail protein	tail	J9Q7R4	Salmonella_phage	89.1	1.5e-145
WP_029463977.1|4302_4914_+|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	73.9	1.1e-81
WP_029590314.1|4934_9092_+	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	84.0	0.0e+00
WP_133051625.1|9203_9491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029590316.1|9875_10523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029463980.1|13212_13536_+	hypothetical protein	NA	J9Q6E7	Salmonella_phage	96.3	2.3e-49
WP_029590318.1|13547_14240_+	membrane protein	NA	J9Q7Y7	Salmonella_phage	88.6	8.1e-116
WP_032803499.1|14241_14493_+	hypothetical protein	NA	J9Q7R6	Salmonella_phage	79.5	1.3e-26
WP_029463983.1|14676_15216_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_029463984.1|15219_15489_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_029590320.1|15891_16557_+	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	94.6	1.2e-111
WP_161576472.1|16562_16916_+	hypothetical protein	NA	J9Q7G3	Salmonella_phage	95.8	9.3e-44
WP_029590324.1|17121_18285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029463882.1|18492_19218_+	hypothetical protein	NA	J9Q7R8	Salmonella_phage	99.2	4.4e-141
19242:19259	attL	TTAGAAAACAAATTGTTT	NA	NA	NA	NA
WP_029463883.1|19278_20619_+	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	98.9	5.5e-246
WP_029463884.1|20769_21885_+	hypothetical protein	NA	J9Q720	Salmonella_phage	92.5	1.3e-208
WP_029463885.1|21917_22334_+	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	50.5	5.9e-21
WP_080326395.1|23031_23256_+	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	85.1	1.2e-31
WP_029463887.1|23556_23802_+	hypothetical protein	NA	J9Q7R9	Salmonella_phage	64.7	3.8e-20
WP_032803500.1|23836_25159_+	hypothetical protein	NA	J9Q7G5	Salmonella_phage	91.4	1.9e-238
WP_029463888.1|25318_25534_+	hypothetical protein	NA	J9Q6I3	Salmonella_phage	77.1	1.4e-23
WP_029463889.1|25679_25985_+	hypothetical protein	NA	J9Q7S1	Salmonella_phage	64.4	9.9e-26
WP_131824121.1|27427_28114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088251124.1|28255_29376_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.7	2.3e-51
WP_029590209.1|29814_30114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_131824841.1|30401_30758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000227969.1|32138_33215_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_029590221.1|33851_34955_+|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	32.2	1.2e-25
WP_029590223.1|34949_35336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029463898.1|35593_35806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029590224.1|35912_38243_+	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	77.0	2.9e-282
WP_029463900.1|38337_39573_+	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	91.2	5.5e-224
WP_029590226.1|39753_43272_+	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	96.2	0.0e+00
WP_161576473.1|43286_43712_+	hypothetical protein	NA	J9Q7S4	Salmonella_phage	85.8	1.2e-61
WP_161575382.1|43948_44329_+	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	65.9	5.9e-44
WP_029463904.1|44339_44639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029590230.1|44689_45253_-	hypothetical protein	NA	J9Q7G7	Salmonella_phage	66.1	1.4e-65
WP_029590231.1|45805_46237_+	hypothetical protein	NA	J9Q6I8	Salmonella_phage	94.4	1.6e-69
WP_029590232.1|46356_47367_+	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	95.6	9.8e-155
WP_029463908.1|47427_48372_+	exonuclease	NA	J9Q7S6	Salmonella_phage	95.5	1.5e-176
WP_029590234.1|48371_48638_+	hypothetical protein	NA	J9Q7G8	Salmonella_phage	88.5	5.4e-36
WP_162490467.1|48685_49720_+	recombinase	NA	J9Q736	Salmonella_phage	93.6	3.2e-185
WP_029590237.1|49866_50277_+	hypothetical protein	NA	J9Q7G9	Salmonella_phage	84.4	3.8e-65
49774:49791	attR	AAACAATTTGTTTTCTAA	NA	NA	NA	NA
WP_029590240.1|50343_50619_+	hypothetical protein	NA	J9Q738	Salmonella_phage	79.1	2.4e-39
WP_029590243.1|50835_51174_+	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	78.0	5.8e-43
WP_029463913.1|51173_51386_+	hypothetical protein	NA	J9Q7S8	Salmonella_phage	84.1	7.3e-28
WP_029590245.1|51914_53015_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	45.4	3.8e-75
WP_029590247.1|53337_53982_+	hypothetical protein	NA	J9Q739	Salmonella_phage	92.5	1.5e-116
WP_029590249.1|54057_54543_+	GNAT family N-acetyltransferase	NA	J9Q6J3	Salmonella_phage	63.4	2.4e-58
WP_029590251.1|54717_55803_+	exonuclease SbcCD subunit D	NA	J9Q7S9	Salmonella_phage	94.5	1.2e-198
WP_161575375.1|57442_57949_+	SMC family ATPase	NA	J9Q741	Salmonella_phage	98.2	2.4e-85
WP_108696164.1|57974_58685_+	hypothetical protein	NA	J9Q6J5	Salmonella_phage	64.4	3.5e-82
WP_029463921.1|58694_59264_+	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	93.7	9.6e-99
WP_029463922.1|59340_61689_+	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	92.2	0.0e+00
WP_029463923.1|61820_62963_+	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	93.2	2.7e-209
WP_029590255.1|63044_63920_+	hypothetical protein	NA	J9Q742	Salmonella_phage	86.8	4.9e-142
WP_029590257.1|64101_65205_+	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	90.2	3.1e-202
WP_032803470.1|65206_65620_+	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	88.3	2.5e-64
WP_162490468.1|65622_66093_+	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	90.4	9.7e-81
WP_029590261.1|66092_66737_+	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	82.2	6.4e-99
WP_029590263.1|66800_67220_+	hypothetical protein	NA	J9Q743	Salmonella_phage	85.6	2.2e-60
WP_029590265.1|67229_67787_+	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	89.1	5.0e-92
WP_029590267.1|67908_68712_+	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	60.4	7.5e-81
WP_069682836.1|69046_69682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029463933.1|69966_70560_+	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	90.9	2.7e-104
WP_000262979.1|70759_70990_+	hypothetical protein	NA	J9Q7H5	Salmonella_phage	100.0	2.1e-36
WP_029463934.1|71583_72183_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	85.6	1.4e-100
WP_029590275.1|72326_72803_+	hypothetical protein	NA	J9Q6J9	Salmonella_phage	60.4	5.6e-44
WP_029463936.1|72812_73001_+	hypothetical protein	NA	J9Q800	Salmonella_phage	66.1	7.4e-16
WP_029590277.1|73066_73492_+	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	81.6	2.6e-56
WP_014342167.1|73491_73647_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	61.2	1.7e-05
WP_029463938.1|73773_74352_+	hypothetical protein	NA	J9Q7H6	Salmonella_phage	56.5	1.9e-54
WP_029590279.1|74480_74696_+	restriction endonuclease subunit M	NA	J9Q747	Salmonella_phage	69.8	1.2e-14
WP_029590280.1|74757_77874_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	23.8	6.0e-25
WP_029590281.1|77990_79202_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_029590282.1|79198_80755_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.5	1.6e-103
WP_029590283.1|80976_82665_+	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	98.8	0.0e+00
WP_162490465.1|83151_83307_+	hypothetical protein	NA	J9Q750	Salmonella_phage	100.0	1.1e-25
WP_029590285.1|83539_84739_+	hypothetical protein	NA	J9Q803	Salmonella_phage	98.5	1.1e-208
WP_016051703.1|86156_86399_-	hypothetical protein	NA	J9Q751	Salmonella_phage	100.0	5.6e-40
WP_016051704.1|86544_86760_+	hypothetical protein	NA	J9Q6K7	Salmonella_phage	100.0	6.3e-35
WP_160859106.1|86773_86989_+	hypothetical protein	NA	J9Q804	Salmonella_phage	97.2	4.1e-34
WP_016051706.1|87129_87441_+	hypothetical protein	NA	J9Q7T7	Salmonella_phage	100.0	6.5e-49
WP_029590286.1|87568_87964_+	hypothetical protein	NA	J9Q7I1	Salmonella_phage	99.2	8.8e-67
WP_021313142.1|88093_88468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162490466.1|88554_88752_+	hypothetical protein	NA	J9Q753	Salmonella_phage	80.0	1.8e-25
WP_029590288.1|88956_89439_+	hypothetical protein	NA	J9Q805	Salmonella_phage	69.4	9.4e-63
WP_029463950.1|90096_90747_-	hypothetical protein	NA	J9Q754	Salmonella_phage	94.0	2.4e-109
WP_032803492.1|91063_91363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029590290.1|91372_91894_-	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	93.9	2.5e-77
WP_029590291.1|92036_92816_+	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	39.2	1.8e-07
WP_029590292.1|92901_93180_-	hypothetical protein	NA	J9Q7T9	Salmonella_phage	90.1	1.3e-37
WP_029590293.1|93182_94742_-	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	95.2	5.9e-284
WP_029590294.1|94806_95505_+	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	98.3	6.2e-124
WP_029590295.1|95504_96173_+	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	98.6	9.5e-114
WP_006812519.1|96169_96808_+	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	99.5	1.1e-111
WP_001113021.1|96800_97055_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	98.8	4.1e-41
WP_032803507.1|97060_97951_+	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.3	3.1e-168
WP_000176291.1|97960_98227_+	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
WP_029590299.1|98422_99064_+	hypothetical protein	NA	J9Q6D4	Salmonella_phage	95.3	2.7e-105
WP_029463961.1|99066_100323_+|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	98.1	3.6e-247
WP_029590300.1|100355_101930_+|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	93.5	1.9e-285
WP_029590301.1|101952_102846_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	74.8	5.4e-104
WP_029590302.1|102871_103753_+	hypothetical protein	NA	J9Q710	Salmonella_phage	94.2	6.2e-153
WP_029590303.1|103828_104263_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	79.2	1.4e-57
WP_029590304.1|104262_105096_+	hypothetical protein	NA	J9Q7R2	Salmonella_phage	89.5	3.7e-139
WP_029590305.1|105193_105538_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	95.6	2.3e-55
WP_029463968.1|105528_106002_+	hypothetical protein	NA	J9Q711	Salmonella_phage	94.3	7.8e-78
WP_029463969.1|106003_106387_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	81.9	8.0e-57
WP_029463970.1|106461_107208_+	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	89.1	3.5e-117
WP_029590306.1|107268_107586_+	hypothetical protein	NA	J9Q7R3	Salmonella_phage	97.1	1.0e-49
WP_161574044.1|107711_107936_+	hypothetical protein	NA	J9Q7F7	Salmonella_phage	98.6	5.5e-34
