The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012517	Burkholderia pseudomallei strain vgh16W chromosome 1, complete sequence	4038845	116560	207407	4038845	tail,terminase,capsid,tRNA,head,portal,holin,plate,protease	Burkholderia_phage(80.0%)	100	NA	NA
WP_053565782.1|116560_117652_+|portal	phage portal protein	portal	A4JWQ2	Burkholderia_virus	91.7	4.9e-192
WP_004523107.1|117724_118009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038759021.1|118005_118488_-	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_004553744.1|119025_120030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154218334.1|120131_120500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004200732.1|120908_121313_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_004189208.1|121350_122220_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_004525849.1|122340_123357_-	D-2-hydroxyacid dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004189230.1|123795_124851_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004537740.1|125072_127682_-	DNA topoisomerase III	NA	A0A2P1ELA0	Moumouvirus	25.6	2.2e-17
WP_004190199.1|127892_128264_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_004553745.1|128323_129514_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	39.2	2.0e-21
WP_004525852.1|129742_130246_+	peptide deformylase	NA	A0A067XQZ3	Caulobacter_phage	34.3	2.1e-12
WP_004525853.1|130277_131261_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	38.0	1.3e-07
WP_004525854.1|131381_132017_+	LysE family translocator	NA	NA	NA	NA	NA
WP_004189409.1|132126_132984_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_158510478.1|133148_133385_+	acetate permease	NA	NA	NA	NA	NA
WP_004523097.1|133497_134907_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_004553747.1|134903_135494_+	DUF4390 domain-containing protein	NA	NA	NA	NA	NA
WP_004523096.1|135495_137904_+	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_004189647.1|137904_138588_+	response regulator	NA	NA	NA	NA	NA
WP_076836148.1|139615_139957_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014696807.1|140657_143450_-	hypothetical protein	NA	K4NXL6	Burkholderia_phage	100.0	0.0e+00
WP_004524471.1|143461_143716_-	hypothetical protein	NA	K4NZY7	Burkholderia_phage	100.0	4.5e-40
WP_004531070.1|143712_144072_-	hypothetical protein	NA	K4NXB4	Burkholderia_phage	100.0	1.1e-60
WP_004524469.1|144074_144281_-	hypothetical protein	NA	K4NZT3	Burkholderia_phage	100.0	2.7e-35
WP_004531069.1|144449_144689_-	hypothetical protein	NA	K4PAZ5	Burkholderia_phage	100.0	1.4e-35
WP_004524467.1|144692_144887_-	hypothetical protein	NA	K4NXL1	Burkholderia_phage	100.0	1.6e-26
WP_004524466.1|144930_145128_-	hypothetical protein	NA	K4NZY3	Burkholderia_phage	100.0	1.6e-29
WP_004549898.1|145133_145352_-	hypothetical protein	NA	K4NXB1	Burkholderia_phage	100.0	1.1e-34
WP_004524465.1|145367_145913_-	Bro-N domain-containing protein	NA	K4NZS9	Burkholderia_phage	100.0	7.8e-98
WP_004549899.1|145998_146247_-	ogr/Delta-like zinc finger family protein	NA	K4PAZ0	Burkholderia_phage	100.0	3.0e-41
WP_004549900.1|146234_146531_-	phage DNA-binding protein	NA	E5E3P2	Burkholderia_phage	84.3	5.4e-37
WP_004531068.1|146534_146771_-	hypothetical protein	NA	K4NZX7	Burkholderia_phage	100.0	2.4e-35
WP_004549901.1|146854_147313_+	helix-turn-helix transcriptional regulator	NA	K4NXA8	Burkholderia_phage	100.0	5.2e-79
WP_004549902.1|147365_148088_+	hypothetical protein	NA	K4NZS4	Burkholderia_phage	100.0	1.1e-126
WP_004549903.1|148522_148954_+	hypothetical protein	NA	A0A089FKT7	Burkholderia_phage	100.0	8.6e-76
WP_004552642.1|148967_150068_-	phage late control D family protein	NA	K4PAY4	Burkholderia_phage	100.0	3.6e-203
WP_004524457.1|150067_150493_-|tail	phage tail protein	tail	K4NXK5	Burkholderia_phage	100.0	1.2e-72
WP_004555835.1|150510_153471_-	hypothetical protein	NA	K4NZX3	Burkholderia_phage	100.0	0.0e+00
WP_004552648.1|153473_153587_-|tail	GpE family phage tail protein	tail	A0A089FGX3	Burkholderia_phage	100.0	5.4e-14
WP_004531064.1|153595_153940_-|tail	phage tail assembly protein	tail	K4NXA3	Burkholderia_phage	100.0	1.0e-55
WP_004524455.1|153997_154507_-|tail	phage major tail tube protein	tail	K4NZR9	Burkholderia_phage	100.0	4.9e-94
WP_014696808.1|154522_155695_-|tail	phage tail sheath protein	tail	K4PAY0	Burkholderia_phage	100.0	1.5e-223
WP_004531062.1|155750_156422_-|tail	phage tail fiber assembly protein	tail	K4NXJ9	Burkholderia_phage	100.0	3.0e-115
WP_038803061.1|156438_158802_-	phage Tail collar domain protein	NA	K4NZW8	Burkholderia_phage	100.0	0.0e+00
WP_004531060.1|158812_159367_-|tail	phage tail protein I	tail	K4NXA0	Burkholderia_phage	100.0	2.2e-100
WP_004531059.1|159359_160265_-|plate	baseplate assembly protein	plate	K4NZR5	Burkholderia_phage	100.0	3.0e-163
WP_004531058.1|160261_160624_-|plate	bacteriophage baseplate assembly protein W	plate	K4PAX6	Burkholderia_phage	100.0	1.7e-61
WP_004531057.1|160620_161301_-|plate	phage baseplate assembly protein V	plate	K4NXJ5	Burkholderia_phage	100.0	3.0e-123
WP_004531056.1|161474_162251_+	site-specific DNA-methyltransferase	NA	K4NZW3	Burkholderia_phage	100.0	1.6e-149
WP_009897040.1|162416_162947_-	hypothetical protein	NA	K4NX96	Burkholderia_phage	100.0	3.0e-94
WP_004531055.1|163073_163541_-	phage virion morphogenesis protein	NA	K4NZQ8	Burkholderia_phage	100.0	1.2e-78
WP_004531054.1|163537_163954_-|tail	phage tail protein	tail	A4JWT7	Burkholderia_virus	100.0	3.3e-72
WP_009971799.1|164058_164499_-	bacteriophage protein	NA	K4NXJ2	Burkholderia_phage	100.0	3.8e-71
WP_004531051.1|164495_165308_-	DUF3380 domain-containing protein	NA	K4NZW0	Burkholderia_phage	100.0	1.2e-150
WP_004524440.1|165304_165577_-|holin	phage holin family protein	holin	K4NX91	Burkholderia_phage	100.0	8.8e-42
WP_004524439.1|165578_165923_-	membrane protein	NA	K4NZQ3	Burkholderia_phage	100.0	2.9e-50
WP_004524438.1|165937_166144_-|tail	tail protein	tail	K4PAW7	Burkholderia_phage	100.0	2.4e-31
WP_004524437.1|166140_166392_-	hypothetical protein	NA	K4NXI9	Burkholderia_phage	100.0	7.6e-40
WP_004531050.1|166391_166871_-|head	head completion/stabilization protein	head	K4NZV5	Burkholderia_phage	100.0	5.8e-81
WP_004531049.1|166970_167660_-|terminase	terminase endonuclease subunit	terminase	K4NX86	Burkholderia_phage	100.0	2.5e-117
WP_004531048.1|167656_168670_-|capsid	phage major capsid protein, P2 family	capsid	K4NZP8	Burkholderia_phage	100.0	7.2e-190
WP_004552664.1|168703_169513_-|capsid	GPO family capsid scaffolding protein	capsid	K4PAW2	Burkholderia_phage	100.0	4.2e-148
WP_004531046.1|169656_171426_+|terminase	terminase ATPase subunit family protein	terminase	K4NXI4	Burkholderia_phage	100.0	0.0e+00
WP_004531045.1|171422_172478_+|portal	phage portal protein	portal	K4NZV0	Burkholderia_phage	100.0	4.0e-207
WP_004524431.1|172584_172857_+	BrnT family toxin	NA	K4NX81	Burkholderia_phage	100.0	1.0e-45
WP_004524430.1|172816_173089_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	100.0	6.3e-48
WP_004554069.1|173700_174057_-	hypothetical protein	NA	A0A089GLD7	Burkholderia_phage	100.0	1.3e-37
WP_004531044.1|174339_175041_-	hypothetical protein	NA	A0A089FKS8	Burkholderia_phage	100.0	1.0e-134
WP_004554070.1|175286_175760_-	DUF4065 domain-containing protein	NA	K4NZT7	Burkholderia_phage	100.0	2.8e-88
WP_004190026.1|176693_177428_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A1B0Z0B4	Vibrio_phage	42.5	1.6e-50
WP_004189241.1|177521_178154_+	7-carboxy-7-deazaguanine synthase	NA	R4TAH8	Halovirus	30.9	2.1e-06
WP_004189793.1|178173_178626_+	6-carboxytetrahydropterin synthase QueD	NA	A0A088FAL2	Vibrio_phage	30.8	7.6e-14
WP_004523095.1|179047_179833_+	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
WP_004545693.1|179829_180606_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_004525857.1|180899_182048_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_004525858.1|182059_184471_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_004523092.1|184654_185167_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004189331.1|185163_186237_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_004189550.1|186356_187400_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_004189769.1|187765_188065_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_004525859.1|188177_189668_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_004523090.1|189670_191143_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_004523089.1|191269_192109_+	polyphosphate kinase	NA	NA	NA	NA	NA
WP_004190029.1|192140_192911_+	exodeoxyribonuclease III	NA	R4TWA8	Phaeocystis_globosa_virus	33.8	3.4e-30
WP_004523088.1|193228_194293_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.8	1.3e-80
WP_004525862.1|194502_195447_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004535313.1|195820_196873_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_004523086.1|196862_198176_-	AmpG family muropeptide MFS transporter	NA	NA	NA	NA	NA
WP_004198304.1|198187_198802_-	methionine biosynthesis protein MetW	NA	NA	NA	NA	NA
WP_004198305.1|198798_199944_-	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_004525865.1|200296_200989_-	nucleoid occlusion factor SlmA	NA	NA	NA	NA	NA
WP_004198307.1|200955_201759_-	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_004200214.1|201755_202655_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_004198312.1|202979_203231_+	cysteine-rich CWC family protein	NA	NA	NA	NA	NA
WP_004198314.1|203248_204529_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_004198315.1|204548_205091_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004198316.1|205517_206861_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	28.8	3.7e-40
WP_004203414.1|206870_207407_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 2
NZ_CP012517	Burkholderia pseudomallei strain vgh16W chromosome 1, complete sequence	4038845	982329	993284	4038845	protease	Streptococcus_phage(16.67%)	10	NA	NA
WP_004197486.1|982329_984444_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	5.8e-56
WP_004530837.1|984741_985251_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	41.2	5.5e-13
WP_071810810.1|985442_985661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189780.1|985923_986502_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_004189552.1|986769_988029_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	5.2e-12
WP_009929279.1|988001_988184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004536101.1|988196_989807_+	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_004196460.1|989936_990140_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_004194131.1|990672_990987_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	4.4e-13
WP_004196461.1|990983_993284_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	5.1e-167
>prophage 3
NZ_CP012517	Burkholderia pseudomallei strain vgh16W chromosome 1, complete sequence	4038845	1165311	1223107	4038845	tail,terminase,capsid,head,portal,plate,integrase,protease	uncultured_Caudovirales_phage(30.3%)	62	1182705:1182740	1228223:1228258
WP_004522511.1|1165311_1165851_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_004526356.1|1165948_1167085_-	murein-DD-endopeptidase	NA	NA	NA	NA	NA
WP_004200110.1|1167397_1167622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004526357.1|1168078_1168555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053565857.1|1170225_1179549_+	contact-dependent inhibition toxin BcpA	NA	A0A0R6PJK4	Moraxella_phage	33.6	3.6e-33
WP_123850157.1|1179545_1179836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004543927.1|1179937_1180117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020850843.1|1180135_1180360_+	CDI system lipoprotein BcpO	NA	NA	NA	NA	NA
WP_028359471.1|1180384_1182142_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_071897713.1|1182075_1182480_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	48.2	4.5e-10
1182705:1182740	attL	TGAACTACGGGGAGCGGATAGTTTGAGCGGGATGGA	NA	NA	NA	NA
WP_038717510.1|1182934_1184032_+|integrase	site-specific integrase	integrase	A0A248XD46	Klebsiella_phage	32.2	8.5e-43
WP_100565665.1|1184050_1184593_-	conjugal transfer protein TraN	NA	NA	NA	NA	NA
WP_004552588.1|1185056_1185287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004552589.1|1185283_1186063_-	hypothetical protein	NA	Q6J1P0	Burkholderia_virus	52.3	1.7e-21
WP_004555250.1|1186071_1186401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038717458.1|1186514_1187831_-	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_038717459.1|1187830_1188280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004534172.1|1188276_1188882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004534202.1|1188878_1189214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053567081.1|1189265_1189484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128972304.1|1189611_1190067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009909040.1|1190014_1190500_-	helix-turn-helix transcriptional regulator	NA	A0A193GYL7	Enterobacter_phage	41.2	4.4e-12
WP_038707945.1|1190649_1190877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009927752.1|1190965_1191493_+	hypothetical protein	NA	C7BGG0	Burkholderia_phage	46.5	9.7e-29
WP_024464805.1|1191506_1191860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009936766.1|1192166_1192637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038717465.1|1192756_1195249_+	virulence protein E	NA	A0A2D1GN57	Marinobacter_phage	41.8	4.7e-97
WP_004533678.1|1195466_1196054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154392342.1|1196493_1196973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080378397.1|1197188_1197758_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080378398.1|1197720_1199706_+|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	53.4	7.1e-181
WP_004533700.1|1199716_1199923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053565859.1|1199919_1201413_+|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	51.2	7.5e-135
WP_053565860.1|1201409_1202504_+|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	36.2	3.9e-48
WP_004539732.1|1202530_1202875_+|head	head decoration protein	head	NA	NA	NA	NA
WP_080378399.1|1202909_1203935_+|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	58.8	4.9e-109
WP_004539695.1|1203938_1204229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004539763.1|1204230_1204761_+|tail	phage tail protein	tail	A0A2H4JBV1	uncultured_Caudovirales_phage	28.0	9.2e-11
WP_004533675.1|1204750_1205284_+	hypothetical protein	NA	Q9JML9	Wolbachia_phage	39.5	6.2e-23
WP_004539840.1|1205286_1205967_+|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	34.4	1.2e-18
WP_004547866.1|1206031_1206238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004550221.1|1206234_1206579_+	hypothetical protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004533630.1|1206575_1207469_+|plate	baseplate J protein	plate	D5LGZ3	Escherichia_phage	40.7	1.9e-48
WP_053565862.1|1207461_1208037_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	47.7	2.7e-32
WP_004547845.1|1208024_1209488_+	hypothetical protein	NA	A4JWL8	Burkholderia_virus	77.6	1.1e-212
WP_004547836.1|1209503_1209956_+|tail	tail assembly chaperone	tail	A4JWL9	Burkholderia_virus	77.7	7.0e-44
WP_053565863.1|1210021_1211191_+|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	72.7	3.1e-160
WP_004547888.1|1211201_1211705_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	50.6	2.1e-41
WP_004547863.1|1211774_1212077_+|tail	phage tail assembly protein	tail	V5YST8	Pseudomonas_phage	37.2	1.9e-05
WP_004547855.1|1212164_1214579_+|tail	tail length determination protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	33.1	2.6e-68
WP_053565864.1|1214587_1215469_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	36.6	1.9e-29
WP_004540041.1|1215443_1215650_+|tail	phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	61.2	4.0e-15
WP_004547876.1|1215659_1216712_+	phage late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	44.8	1.2e-78
WP_004533694.1|1216787_1216982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053565865.1|1216974_1217472_+	lysozyme	NA	A4JX20	Burkholderia_virus	78.2	7.6e-68
WP_053565866.1|1217471_1218017_+	lysozyme	NA	Q8W6S5	Burkholderia_virus	95.0	3.2e-83
WP_053565867.1|1218159_1218948_+	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	96.6	2.0e-150
WP_053565868.1|1218983_1219685_-	LysR family transcriptional regulator	NA	A4PE26	Ralstonia_virus	43.3	6.0e-34
WP_080378400.1|1219687_1220290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162491308.1|1220631_1221138_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	39.1	6.7e-19
WP_053565870.1|1221137_1221563_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	50.6	7.6e-16
WP_009941414.1|1222435_1223107_+	DUF159 family protein	NA	Q8W6R8	Burkholderia_virus	83.3	2.6e-111
1228223:1228258	attR	TGAACTACGGGGAGCGGATAGTTTGAGCGGGATGGA	NA	NA	NA	NA
>prophage 4
NZ_CP012517	Burkholderia pseudomallei strain vgh16W chromosome 1, complete sequence	4038845	1630532	1691566	4038845	plate,transposase,coat	Burkholderia_phage(20.0%)	56	NA	NA
WP_038741701.1|1630532_1631753_+|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	99.3	3.9e-238
WP_004526725.1|1631756_1632047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004192837.1|1632289_1632508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162491300.1|1632995_1633502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193316.1|1633507_1633831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004521792.1|1634114_1635539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004526731.1|1635805_1636783_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004542435.1|1637196_1637979_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004192729.1|1638162_1638378_+	DUF3955 domain-containing protein	NA	NA	NA	NA	NA
WP_004550623.1|1638388_1638760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196675.1|1638811_1639147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011851445.1|1639226_1639385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196677.1|1639750_1640446_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004550621.1|1640834_1644107_+	hemagglutinin	NA	A0A2C9CZB7	Yersinia_phage	33.0	1.4e-05
WP_004521783.1|1644187_1644898_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004550620.1|1644899_1646429_+	hypothetical protein	NA	D6PFH9	uncultured_phage	25.4	2.7e-15
WP_004526737.1|1646445_1646790_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_004521781.1|1647212_1647446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193698.1|1647491_1648052_-	SCO family protein	NA	NA	NA	NA	NA
WP_004531145.1|1648086_1648575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009954589.1|1648601_1651004_-	DUF1929 domain-containing protein	NA	NA	NA	NA	NA
WP_004521777.1|1651256_1651490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004534664.1|1651534_1652371_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_009966472.1|1652553_1652682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009930813.1|1653676_1655527_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_038789671.1|1655554_1656970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193592.1|1656993_1657260_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004521773.1|1657519_1657747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043291894.1|1657780_1660588_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	25.0	5.7e-27
WP_004535790.1|1660590_1661424_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_053565901.1|1661560_1662124_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_009930792.1|1662120_1662714_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_053565902.1|1662710_1665119_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_041196158.1|1665227_1668563_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_080378412.1|1669348_1669888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004556889.1|1670119_1670362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004521762.1|1670379_1670685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053565904.1|1670697_1673538_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.9	1.4e-20
WP_004526759.1|1673539_1674415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038719431.1|1674411_1677270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038707982.1|1677385_1678306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004552607.1|1678851_1679145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004191144.1|1679777_1680047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193855.1|1680309_1680591_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_004531169.1|1681058_1682042_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_004538381.1|1682086_1683373_-	MFS transporter	NA	NA	NA	NA	NA
WP_004196705.1|1683789_1684683_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_162474212.1|1684877_1685054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076812081.1|1685072_1685252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004534686.1|1685337_1685526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038714058.1|1685512_1686058_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004526782.1|1686110_1686671_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004526783.1|1686747_1687272_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004526784.1|1687289_1688129_+	molecular chaperone	NA	NA	NA	NA	NA
WP_004538377.1|1688173_1690585_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_004521738.1|1690600_1691566_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 5
NZ_CP012517	Burkholderia pseudomallei strain vgh16W chromosome 1, complete sequence	4038845	2463622	2471819	4038845		Burkholderia_virus(50.0%)	14	NA	NA
WP_004192901.1|2463622_2464732_+	class II histone deacetylase	NA	A0A2K9L2T7	Tupanvirus	31.0	7.8e-36
WP_004193371.1|2464926_2465550_+	phospholipase D family protein	NA	NA	NA	NA	NA
WP_004534930.1|2465676_2465859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045586613.1|2465855_2466245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004550288.1|2466798_2467260_+	avidin	NA	NA	NA	NA	NA
WP_004527234.1|2467335_2467569_+	hypothetical protein	NA	A4PE26	Ralstonia_virus	60.6	4.3e-13
WP_004531416.1|2467604_2467832_-	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	75.8	3.8e-22
WP_004557051.1|2468085_2468481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004527236.1|2468761_2469187_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	49.4	3.8e-15
WP_004527237.1|2469183_2469690_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	40.1	5.1e-19
WP_038763587.1|2470031_2470634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009920998.1|2470640_2471366_+	hypothetical protein	NA	A4PE26	Ralstonia_virus	44.0	5.8e-32
WP_076839978.1|2471386_2471572_-	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	83.3	5.8e-21
WP_004527242.1|2471555_2471819_-	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	84.1	8.5e-26
>prophage 6
NZ_CP012517	Burkholderia pseudomallei strain vgh16W chromosome 1, complete sequence	4038845	2976361	2985237	4038845		Tanapox_virus(16.67%)	9	NA	NA
WP_004544106.1|2976361_2977204_+	alpha/beta hydrolase	NA	A7XCB7	Tanapox_virus	27.0	1.2e-17
WP_004522362.1|2977546_2978470_-	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	36.2	2.4e-43
WP_053565981.1|2978648_2979962_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_004532363.1|2980188_2981091_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.9	1.9e-53
WP_053565982.1|2981102_2981318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189725.1|2981441_2981759_-	competence protein ComE	NA	NA	NA	NA	NA
WP_004544120.1|2981830_2982823_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	9.1e-28
WP_009921652.1|2982881_2983805_-	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.1	1.3e-15
WP_004522358.1|2983836_2985237_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.5	1.9e-79
>prophage 7
NZ_CP012517	Burkholderia pseudomallei strain vgh16W chromosome 1, complete sequence	4038845	3330623	3339868	4038845		unidentified_phage(16.67%)	7	NA	NA
WP_004522151.1|3330623_3332171_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.2	4.3e-24
WP_004194373.1|3332207_3332735_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_004532195.1|3332731_3333415_+	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	2.0e-05
WP_004194137.1|3333479_3334295_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	8.8e-37
WP_053566013.1|3334478_3336485_-	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	34.8	2.8e-52
WP_004522147.1|3336518_3337649_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.6	1.7e-22
WP_004194034.1|3337915_3339868_-	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.2	2.7e-148
>prophage 8
NZ_CP012517	Burkholderia pseudomallei strain vgh16W chromosome 1, complete sequence	4038845	3622101	3680400	4038845	tail,tRNA,transposase,plate,integrase	Burkholderia_phage(27.27%)	53	3626322:3626339	3683594:3683611
WP_004521984.1|3622101_3623400_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_004527811.1|3623466_3624549_+	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	46.6	6.7e-08
WP_004534980.1|3624592_3625450_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_004186955.1|3625529_3625838_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_004521981.1|3625852_3626449_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
3626322:3626339	attL	CCGCGTTCTACGCGATGC	NA	NA	NA	NA
WP_004542691.1|3626732_3627521_+	dioxygenase	NA	NA	NA	NA	NA
WP_004527813.1|3627987_3629589_-	APC family permease	NA	NA	NA	NA	NA
WP_004196837.1|3630022_3630226_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	73.1	6.3e-21
WP_004198058.1|3630412_3631675_-	Hsp70 family protein	NA	NA	NA	NA	NA
WP_004198059.1|3632297_3632903_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_076811808.1|3632864_3633440_+	restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_004535445.1|3633399_3634683_-	MFS transporter	NA	NA	NA	NA	NA
WP_009974227.1|3634841_3635486_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004527819.1|3635823_3636447_+	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_004198065.1|3636531_3637428_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004535007.1|3637555_3638692_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004539229.1|3638668_3638974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004521968.1|3639048_3640167_-	acyltransferase	NA	NA	NA	NA	NA
WP_004202806.1|3640165_3640645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199982.1|3640604_3641108_-	lipoprotein	NA	NA	NA	NA	NA
WP_004204896.1|3641711_3643877_+	peptidase	NA	A0A0P0IY26	Acinetobacter_phage	27.1	1.9e-46
WP_076830138.1|3644458_3644857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004185238.1|3644932_3645169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004204906.1|3645271_3645502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004521964.1|3645735_3646092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199991.1|3646117_3647386_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_053566026.1|3647400_3649662_+	peptidase domain-containing ABC transporter	NA	A0A2R8FG22	Brazilian_cedratvirus	31.9	2.3e-10
WP_009932031.1|3649658_3651107_+	TolC family protein	NA	NA	NA	NA	NA
WP_053566027.1|3651316_3652303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199998.1|3652428_3653280_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_053566028.1|3653558_3657452_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_004200003.1|3657448_3658438_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_004185296.1|3658442_3659375_+	OmpA family protein	NA	NA	NA	NA	NA
WP_038759070.1|3659580_3660711_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004549921.1|3660800_3663470_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	32.1	1.7e-89
WP_004200010.1|3663503_3664604_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004202808.1|3664567_3666406_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004204912.1|3666485_3666968_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004527837.1|3667025_3667529_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_004521953.1|3667601_3669092_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004521952.1|3669108_3669627_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004531875.1|3669663_3670335_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_004521950.1|3670709_3671324_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004521949.1|3671432_3672779_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004521948.1|3672775_3673561_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_009922432.1|3673662_3674028_+	phage virion morphogenesis protein	NA	K4NZQ8	Burkholderia_phage	89.3	1.1e-52
WP_111952238.1|3674131_3674722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076852297.1|3675115_3675718_-	site-specific DNA-methyltransferase	NA	K4NZW3	Burkholderia_phage	89.1	4.3e-81
WP_004527843.1|3675615_3676029_-|tail	phage tail protein I	tail	K4NXA0	Burkholderia_phage	100.0	8.0e-71
WP_123903074.1|3676116_3676644_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	49.2	5.1e-30
WP_144426493.1|3676568_3676994_+|integrase	tyrosine-type recombinase/integrase	integrase	A5X9F3	Aeromonas_virus	50.4	1.5e-27
WP_004555440.1|3677041_3679339_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_004555439.1|3679395_3680400_-	AAA family ATPase	NA	Q677Q6	Lymphocystis_disease_virus	31.7	2.6e-14
3683594:3683611	attR	GCATCGCGTAGAACGCGG	NA	NA	NA	NA
>prophage 1
NZ_CP012518	Burkholderia pseudomallei strain vgh16W chromosome 2, complete sequence	3227965	76038	142363	3227965	plate,transposase,holin	Ralstonia_phage(28.57%)	50	NA	NA
WP_053566075.1|76038_78234_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_004552613.1|78815_79472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023358215.1|80025_81195_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	30.1	1.9e-32
WP_080002191.1|82557_82812_+	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
WP_009939053.1|82808_83828_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004533753.1|83847_84300_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004552620.1|84789_85704_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004533801.1|85687_86542_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004552621.1|86538_87570_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_004528499.1|88157_88463_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_053566076.1|88782_91548_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	35.1	2.3e-89
WP_053566077.1|91561_93802_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	27.4	6.8e-23
WP_094188797.1|93940_95479_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_004547827.1|95488_95752_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004523721.1|96166_96586_-	YjbQ family protein	NA	NA	NA	NA	NA
WP_004523720.1|96605_96932_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_004531587.1|97403_98096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053566078.1|98681_99431_-	DUF2244 domain-containing protein	NA	NA	NA	NA	NA
WP_053566079.1|99427_101023_-	cytochrome c oxidase subunit I	NA	R9VX24	Flavobacterium_phage	33.3	4.1e-06
WP_162491311.1|101321_101900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053566080.1|102165_103632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153260193.1|103976_104336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158510492.1|104332_104866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080378478.1|105184_107668_+	hypothetical protein	NA	A0A2C9CZG8	Yersinia_phage	46.1	5.8e-07
WP_024429105.1|107734_109186_-	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_004523708.1|109257_109473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076897617.1|109445_110039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004523706.1|110623_111169_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_004523705.1|111248_111971_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_050802624.1|112083_114828_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_004529637.1|114820_115393_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_053566082.1|115424_116114_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004523701.1|116116_117793_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004523700.1|118170_118710_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004523699.1|118743_120243_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004529642.1|120442_120925_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_004529643.1|121052_121595_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004523698.1|121600_122950_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004531577.1|122946_124248_+	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_004537295.1|124262_128171_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_004529647.1|128360_128930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038734611.1|129027_131652_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	9.1e-35
WP_004523693.1|131726_131996_+	PAAR motif protein	NA	NA	NA	NA	NA
WP_053566083.1|132008_135461_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_004553079.1|135353_136712_-	hypothetical protein	NA	A0A292GJ55	Xanthomonas_phage	45.5	1.5e-110
WP_004536657.1|136744_137773_-	fimbrial protein	NA	NA	NA	NA	NA
WP_004529651.1|137827_138898_-	type VI secretion protein ImpA	NA	NA	NA	NA	NA
WP_004523688.1|138916_139966_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004523687.1|139962_141843_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004523686.1|141844_142363_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 2
NZ_CP012518	Burkholderia pseudomallei strain vgh16W chromosome 2, complete sequence	3227965	516260	527392	3227965	transposase,integrase	Burkholderia_virus(55.56%)	12	511191:511207	539256:539272
511191:511207	attL	CGCGGCGAGCGCCTGCA	NA	NA	NA	NA
WP_004188376.1|516260_518243_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	44.8	1.8e-83
WP_004545569.1|518340_518721_+	DUF4212 domain-containing protein	NA	NA	NA	NA	NA
WP_004553173.1|521001_522705_+|integrase	site-specific integrase	integrase	A0A059XK29	uncultured_phage	33.5	2.0e-19
WP_053566115.1|522881_524027_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A4JX31	Burkholderia_virus	99.2	1.8e-213
WP_004537646.1|524023_524173_-	bacteriophage protein Gp44	NA	Q8W6Q6	Burkholderia_virus	100.0	3.3e-19
WP_004542548.1|524431_525013_+	hypothetical protein	NA	A9YX38	Burkholderia_phage	100.0	2.2e-21
WP_160458000.1|525243_525543_-	hypothetical protein	NA	Q6JIH9	Burkholderia_virus	97.2	1.9e-34
WP_004552390.1|525509_525731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009923452.1|525866_525998_-	bacteriophage protein Gp48	NA	Q8W6Q2	Burkholderia_virus	97.7	2.6e-15
WP_009975384.1|526007_526283_-	hypothetical protein	NA	Q6JIH4	Burkholderia_virus	95.6	2.6e-41
WP_009939402.1|526950_527124_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_004525420.1|527107_527392_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	50.0	1.4e-10
539256:539272	attR	CGCGGCGAGCGCCTGCA	NA	NA	NA	NA
>prophage 3
NZ_CP012518	Burkholderia pseudomallei strain vgh16W chromosome 2, complete sequence	3227965	680202	751695	3227965	plate,holin	Vibrio_phage(25.0%)	55	NA	NA
WP_053566132.1|680202_680970_-|holin	phosphocholine cytidylyltransferase family protein	holin	NA	NA	NA	NA
WP_004206084.1|681008_682010_-	HpnL family protein	NA	NA	NA	NA	NA
WP_004542606.1|682006_682780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004188272.1|682776_683466_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_004188420.1|683830_685345_+	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
WP_004530037.1|687085_688024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004202234.1|688057_688606_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004190846.1|688608_690114_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004530039.1|690257_690785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190879.1|690864_691296_+	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_004196180.1|691309_693172_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004190851.1|693168_694158_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004525547.1|694160_697031_+	type VI secretion system ATPase TssH	NA	A0A2I7REQ1	Vibrio_phage	27.2	2.4e-60
WP_004536618.1|697021_699313_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_023358637.1|699478_701767_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_004547074.1|701770_703987_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_004525550.1|703986_705057_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_004530790.1|705059_705776_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_004190606.1|705818_706208_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_004202226.1|706213_706807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004525552.1|706803_708165_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004525553.1|708247_709906_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004525554.1|709902_713406_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_004190863.1|713464_713824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004530792.1|713846_714269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004536812.1|714589_714865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004524288.1|715415_716315_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004542286.1|716356_716647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024428512.1|716536_717856_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_004524286.1|717852_719439_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_004530795.1|719667_720663_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_017843707.1|720788_720971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004528656.1|720967_722551_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_004186853.1|723043_724297_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004198244.1|724820_726485_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	31.4	5.4e-57
WP_080378491.1|726617_728183_-	glycoside hydrolase 68 family protein	NA	NA	NA	NA	NA
WP_004530800.1|728371_729388_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004523135.1|729849_731049_+	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	27.2	8.4e-12
WP_004198247.1|731226_732252_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_160457400.1|732265_732550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004530801.1|732685_733960_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.1	5.3e-105
WP_004186989.1|734032_735004_+	membrane dipeptidase	NA	NA	NA	NA	NA
WP_004186987.1|735154_735688_+	4-vinyl reductase	NA	NA	NA	NA	NA
WP_038737322.1|735748_737812_+	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_053566133.1|737814_739740_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_011852808.1|739744_740917_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_004530055.1|740913_741699_+	drug:proton antiporter	NA	NA	NA	NA	NA
WP_004535147.1|741750_742992_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_004530056.1|743012_744158_+	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004523141.1|744267_745131_+	glycine betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_053566134.1|745311_746967_+	APC family permease	NA	NA	NA	NA	NA
WP_004186920.1|747053_747929_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_004554841.1|748072_748945_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004186939.1|749107_750661_+|holin	choline-sulfatase	holin	NA	NA	NA	NA
WP_053566135.1|750657_751695_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
>prophage 4
NZ_CP012518	Burkholderia pseudomallei strain vgh16W chromosome 2, complete sequence	3227965	2307530	2325446	3227965	integrase	Burkholderia_phage(42.86%)	27	2315091:2315106	2326748:2326763
WP_011853565.1|2307530_2307923_-	hypothetical protein	NA	A0AR14	Salmonella_phage	66.4	3.0e-35
WP_009977906.1|2307999_2308494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050883499.1|2308543_2309161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053566256.1|2309141_2310125_-	YdaU family protein	NA	NA	NA	NA	NA
WP_009977910.1|2310121_2310337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009977911.1|2310333_2310570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038746948.1|2310566_2310785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158336013.1|2310910_2311531_+	helix-turn-helix domain-containing protein	NA	A0A0R6PHL1	Moraxella_phage	27.6	2.7e-14
WP_023358832.1|2311527_2311812_+	hypothetical protein	NA	Q76H12	Enterobacteria_phage	45.5	2.2e-11
WP_011853572.1|2311940_2312258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053566257.1|2312531_2313242_+	hypothetical protein	NA	Q3HQX1	Burkholderia_phage	84.9	5.3e-54
WP_050450845.1|2313290_2313617_+	hypothetical protein	NA	Q3HQW8	Burkholderia_phage	49.5	7.9e-13
WP_050450846.1|2313616_2313820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009977932.1|2314150_2314432_+	KTSC domain-containing protein	NA	A9YWW2	Burkholderia_phage	73.6	6.1e-30
WP_050450848.1|2314473_2315469_+	phage recombination protein Bet	NA	B5AX97	Iodobacteriophage	55.2	2.8e-53
2315091:2315106	attL	CGCGCGCACCGCGGCG	NA	NA	NA	NA
WP_044491105.1|2315468_2316086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025985042.1|2316042_2316849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011853583.1|2316845_2317091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044491104.1|2317087_2317273_+	hypothetical protein	NA	A9YX20	Burkholderia_phage	38.6	9.0e-06
WP_103852160.1|2317316_2318006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080378558.1|2318476_2318995_+	site-specific DNA-methyltransferase	NA	B4UTY5	Rhizobium_phage	52.8	3.9e-14
WP_053566260.1|2320306_2320807_+	hypothetical protein	NA	A9YWU7	Burkholderia_phage	69.3	7.3e-26
WP_053566261.1|2320796_2321387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080378523.1|2321383_2321719_+	hypothetical protein	NA	A9YWU9	Burkholderia_phage	87.1	8.0e-29
WP_045591785.1|2321718_2321952_+	AlpA family transcriptional regulator	NA	A0A077K9Z8	Ralstonia_phage	66.7	1.6e-15
WP_053566262.1|2321920_2323168_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	61.8	1.7e-140
WP_025988305.1|2323520_2325446_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	30.0	1.8e-16
2326748:2326763	attR	CGCGCGCACCGCGGCG	NA	NA	NA	NA
>prophage 5
NZ_CP012518	Burkholderia pseudomallei strain vgh16W chromosome 2, complete sequence	3227965	2811627	2887443	3227965	transposase	Streptococcus_phage(14.29%)	48	NA	NA
WP_004539275.1|2811627_2812356_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	31.2	1.2e-21
WP_004539274.1|2812575_2814009_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_004552566.1|2814034_2814688_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_004539275.1|2814868_2815597_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	31.2	1.2e-21
WP_004552499.1|2815606_2815864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025991558.1|2816228_2817368_-	DUF746 domain-containing protein	NA	NA	NA	NA	NA
WP_025991559.1|2817367_2819128_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_004555168.1|2819170_2819413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053566300.1|2819667_2828946_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_076891752.1|2829097_2829295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004533385.1|2829295_2829559_-	putative Immunity protein 75	NA	NA	NA	NA	NA
WP_045603739.1|2830151_2834810_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	34.9	8.3e-23
WP_004552171.1|2834796_2836065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004555171.1|2836080_2838285_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	27.2	4.2e-41
WP_004538232.1|2839498_2840719_-|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.5	4.6e-239
WP_154233463.1|2840750_2841017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004548493.1|2841601_2842201_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_004524853.1|2842225_2842636_-	RidA family protein	NA	NA	NA	NA	NA
WP_004555164.1|2842750_2843860_-	asparaginase	NA	NA	NA	NA	NA
WP_004555165.1|2844040_2844673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004524850.1|2845569_2846007_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004555369.1|2847243_2848317_-	porin	NA	NA	NA	NA	NA
WP_038716319.1|2848734_2850159_-	aldehyde dehydrogenase (NADP(+))	NA	NA	NA	NA	NA
WP_017880942.1|2850374_2851559_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_004524845.1|2851569_2852457_-	aldose 1-epimerase	NA	NA	NA	NA	NA
WP_009969404.1|2852459_2853230_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004544686.1|2853244_2854108_-	sugar ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	25.4	1.9e-13
WP_004524842.1|2854104_2855073_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004524841.1|2855093_2856092_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004524840.1|2856129_2857332_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	31.9	6.9e-46
WP_004557914.1|2857342_2858056_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004555371.1|2858187_2859078_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_004540151.1|2859518_2860115_-	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	38.1	6.0e-27
WP_038749709.1|2863608_2863959_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	72.2	2.4e-39
WP_004539264.1|2863955_2864363_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	36.5	2.4e-11
WP_053566301.1|2864795_2866829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004555376.1|2867069_2869241_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_004524829.1|2869245_2870097_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_004524828.1|2870097_2871021_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_004524827.1|2871083_2872325_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_004524825.1|2872360_2873605_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.8	7.1e-22
WP_004557920.1|2873647_2874286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004536893.1|2876058_2877213_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_038719340.1|2878556_2879297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009960547.1|2879725_2879881_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	67.6	2.0e-06
WP_004557924.1|2882557_2883124_-	suppressor of fused domain protein	NA	NA	NA	NA	NA
WP_085965050.1|2883872_2885008_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	28.8	3.1e-16
WP_085965013.1|2886262_2887443_-|transposase	IS3-like element ISBps1 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.9	2.2e-60
