The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012576	Burkholderia pseudomallei strain 982 chromosome 1, complete sequence	4028032	202989	279290	4028032	tail,holin,head,terminase,portal,plate,tRNA,capsid,protease	Burkholderia_phage(60.38%)	88	NA	NA
WP_004203414.1|202989_203526_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_004523084.1|203535_204879_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	28.4	5.3e-39
WP_004198315.1|205296_205839_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004525866.1|205858_207139_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_004198312.1|207156_207408_-	cysteine-rich CWC family protein	NA	NA	NA	NA	NA
WP_004200214.1|207732_208632_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_009951681.1|208628_209432_+	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_004525865.1|209398_210091_+	nucleoid occlusion factor SlmA	NA	NA	NA	NA	NA
WP_004545672.1|210439_211585_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_004545692.1|211581_212196_+	methionine biosynthesis protein MetW	NA	NA	NA	NA	NA
WP_004523086.1|212207_213521_+	AmpG family muropeptide MFS transporter	NA	NA	NA	NA	NA
WP_038800902.1|213606_214563_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_004531039.1|214936_215881_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004525861.1|216092_217157_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.8	1.3e-80
WP_004190029.1|217488_218259_-	exodeoxyribonuclease III	NA	R4TWA8	Phaeocystis_globosa_virus	33.8	3.4e-30
WP_004523089.1|218290_219130_-	polyphosphate kinase	NA	NA	NA	NA	NA
WP_004523090.1|219256_220729_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_004525859.1|220731_222222_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_004189769.1|222334_222634_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_004189550.1|222999_224043_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_004189331.1|224162_225236_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_004523092.1|225232_225745_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004525858.1|225928_228340_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_004537749.1|228351_229500_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_004523094.1|229814_230591_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_004189570.1|230587_231373_-	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
WP_009969946.1|231365_231698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189793.1|231794_232247_-	6-carboxytetrahydropterin synthase QueD	NA	A0A088FAL2	Vibrio_phage	30.8	7.6e-14
WP_004534354.1|232266_232899_-	7-carboxy-7-deazaguanine synthase	NA	R4TAH8	Halovirus	31.5	7.3e-07
WP_004190026.1|232992_233727_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A1B0Z0B4	Vibrio_phage	42.5	1.6e-50
WP_009941464.1|233723_234014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052140751.1|234595_235513_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_038726679.1|235506_235803_+	STAS-like domain-containing protein	NA	NA	NA	NA	NA
WP_133670264.1|235912_236197_-	hypothetical protein	NA	A0A1S5NRP7	Burkholderia_phage	67.4	2.3e-32
WP_011852337.1|236777_237050_-	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	98.9	2.4e-47
WP_004524431.1|237009_237282_-	BrnT family toxin	NA	K4NX81	Burkholderia_phage	100.0	1.0e-45
WP_015985030.1|237388_238444_-|portal	phage portal protein	portal	A4JWQ2	Burkholderia_virus	100.0	6.8e-207
WP_053565648.1|238440_240210_-|terminase	terminase ATPase subunit family protein	terminase	A4JWU9	Burkholderia_virus	99.5	0.0e+00
WP_053565564.1|240353_241163_+|capsid	GPO family capsid scaffolding protein	capsid	K4PAW2	Burkholderia_phage	98.1	7.4e-145
WP_004531048.1|241196_242210_+|capsid	phage major capsid protein, P2 family	capsid	K4NZP8	Burkholderia_phage	100.0	7.2e-190
WP_053565565.1|242206_242896_+|terminase	terminase endonuclease subunit	terminase	K4NX86	Burkholderia_phage	99.1	6.1e-116
WP_009979065.1|242995_243475_+|head	head completion/stabilization protein	head	K4NZV5	Burkholderia_phage	99.4	1.3e-80
WP_004552636.1|243474_243726_+	hypothetical protein	NA	K4NXI9	Burkholderia_phage	98.8	8.4e-39
WP_004524438.1|243722_243929_+|tail	tail protein	tail	K4PAW7	Burkholderia_phage	100.0	2.4e-31
WP_004524439.1|243943_244288_+	membrane protein	NA	K4NZQ3	Burkholderia_phage	100.0	2.9e-50
WP_004524440.1|244289_244562_+|holin	phage holin family protein	holin	K4NX91	Burkholderia_phage	100.0	8.8e-42
WP_009941345.1|244558_245371_+	DUF3380 domain-containing protein	NA	A4JWZ0	Burkholderia_virus	100.0	1.2e-150
WP_009941344.1|245367_245808_+	hypothetical protein	NA	K4NXJ2	Burkholderia_phage	99.3	2.5e-70
WP_004531054.1|245912_246329_+|tail	phage tail protein	tail	A4JWT7	Burkholderia_virus	100.0	3.3e-72
WP_004531055.1|246325_246793_+	phage virion morphogenesis protein	NA	K4NZQ8	Burkholderia_phage	100.0	1.2e-78
WP_009897040.1|246919_247450_+	hypothetical protein	NA	K4NX96	Burkholderia_phage	100.0	3.0e-94
WP_080361222.1|247615_248491_-	site-specific DNA-methyltransferase	NA	A4JWY5	Burkholderia_virus	99.7	2.3e-168
WP_009897036.1|248565_249246_+|plate	phage baseplate assembly protein V	plate	A4JWT3	Burkholderia_virus	100.0	1.8e-123
WP_004531058.1|249242_249605_+|plate	bacteriophage baseplate assembly protein W	plate	K4PAX6	Burkholderia_phage	100.0	1.7e-61
WP_004524450.1|249601_250507_+|plate	phage baseplate assembly protein	plate	A4JWT1	Burkholderia_virus	100.0	3.6e-164
WP_009897027.1|250499_251054_+|tail	phage tail protein I	tail	A4JWT0	Burkholderia_virus	100.0	3.8e-100
WP_076889865.1|251055_253428_+|tail	phage tail protein	tail	Q45YG3	Burkholderia_virus	99.4	0.0e+00
WP_038738771.1|253444_254116_+|tail	tail assembly chaperone	tail	A4JWS8	Burkholderia_virus	96.4	1.8e-112
WP_038734274.1|254171_255344_+|tail	phage tail sheath protein	tail	A4JWS7	Burkholderia_virus	99.7	3.4e-223
WP_014696837.1|255359_255869_+|tail	phage major tail tube protein	tail	K4NZR9	Burkholderia_phage	98.8	3.2e-93
WP_004531064.1|255926_256271_+|tail	phage tail assembly protein	tail	K4NXA3	Burkholderia_phage	100.0	1.0e-55
WP_004552648.1|256279_256393_+|tail	GpE family phage tail protein	tail	A0A089FGX3	Burkholderia_phage	100.0	5.4e-14
WP_076852520.1|256389_259356_+	hypothetical protein	NA	A4JWX4	Burkholderia_virus	99.9	0.0e+00
WP_009935906.1|259373_259799_+|tail	phage tail protein	tail	A4JWS2	Burkholderia_virus	99.3	3.3e-72
WP_053565567.1|259798_260896_+	phage late control D family protein	NA	A4JWS1	Burkholderia_virus	97.8	1.1e-199
WP_004524459.1|260903_261404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004524460.1|261446_262196_-	phage-encoded membrane protein	NA	E5E3P5	Burkholderia_phage	43.1	4.7e-53
WP_076852522.1|262248_262752_-	helix-turn-helix transcriptional regulator	NA	E5E3P4	Burkholderia_phage	79.4	5.4e-61
WP_011204750.1|262832_263027_+	hypothetical protein	NA	K4NZX7	Burkholderia_phage	96.9	1.6e-26
WP_004549900.1|263030_263327_+	phage DNA-binding protein	NA	E5E3P2	Burkholderia_phage	84.3	5.4e-37
WP_004549899.1|263314_263563_+	ogr/Delta-like zinc finger family protein	NA	K4PAZ0	Burkholderia_phage	100.0	3.0e-41
WP_004524465.1|263648_264194_+	Bro-N domain-containing protein	NA	K4NZS9	Burkholderia_phage	100.0	7.8e-98
WP_004549898.1|264209_264428_+	hypothetical protein	NA	K4NXB1	Burkholderia_phage	100.0	1.1e-34
WP_053565568.1|264433_264631_+	hypothetical protein	NA	K4NZY3	Burkholderia_phage	98.5	2.1e-29
WP_009935901.1|264659_264869_+	phage-encoded membrane protein	NA	K4NXL1	Burkholderia_phage	100.0	4.5e-30
WP_004524468.1|264872_265112_+	hypothetical protein	NA	K4PAZ5	Burkholderia_phage	98.7	2.0e-34
WP_004524469.1|265280_265487_+	hypothetical protein	NA	K4NZT3	Burkholderia_phage	100.0	2.7e-35
WP_009935900.1|265480_265849_+	hypothetical protein	NA	K4NXB4	Burkholderia_phage	99.2	2.3e-61
WP_004524471.1|265845_266100_+	hypothetical protein	NA	K4NZY7	Burkholderia_phage	100.0	4.5e-40
WP_004556610.1|266111_268904_+	hypothetical protein	NA	K4NXL6	Burkholderia_phage	99.4	0.0e+00
WP_071810932.1|269595_269946_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004189647.1|270973_271657_-	response regulator	NA	NA	NA	NA	NA
WP_004523096.1|271657_274066_-	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_004188929.1|274067_274658_-	DUF4390 domain-containing protein	NA	NA	NA	NA	NA
WP_004523097.1|274654_276064_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_004189409.1|276583_277441_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_004525854.1|277550_278186_-	LysE family translocator	NA	NA	NA	NA	NA
WP_004525853.1|278306_279290_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	38.0	1.3e-07
>prophage 2
NZ_CP012576	Burkholderia pseudomallei strain 982 chromosome 1, complete sequence	4028032	563424	570317	4028032	integrase	Burkholderia_virus(25.0%)	8	551440:551454	572175:572189
551440:551454	attL	CGCGCCCGGCAACGC	NA	NA	NA	NA
WP_044362991.1|563424_564168_+|integrase	site-specific integrase	integrase	A0A0S2SYQ7	Pseudomonas_phage	46.9	1.6e-53
WP_009922658.1|564547_564865_+	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	57.0	6.2e-15
WP_004530410.1|564864_565782_+	hypothetical protein	NA	A4PE40	Ralstonia_virus	40.6	4.0e-46
WP_009932250.1|566035_566578_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	55.8	8.1e-47
WP_009932249.1|566835_567288_+	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	58.8	2.3e-31
WP_004530408.1|567287_568367_+	DUF3396 domain-containing protein	NA	A9YX32	Burkholderia_phage	99.0	2.2e-160
WP_004525721.1|568523_568772_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	97.6	4.0e-41
WP_076859550.1|569615_570317_+	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	30.5	3.7e-07
572175:572189	attR	GCGTTGCCGGGCGCG	NA	NA	NA	NA
>prophage 3
NZ_CP012576	Burkholderia pseudomallei strain 982 chromosome 1, complete sequence	4028032	793145	819268	4028032	tail,plate,integrase,protease	Burkholderia_phage(57.14%)	26	793721:793763	808821:808863
WP_004539219.1|793145_793673_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	51.0	2.0e-21
793721:793763	attL	TTGATTTGTAATCATCAGGTGGCGGGTTCGAGTCCTGCAGCCG	NA	NA	NA	NA
WP_009951133.1|794080_794488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009951134.1|795378_796173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_131201363.1|796227_796407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080003239.1|797043_798063_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_004547573.1|798173_798389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004547588.1|798508_799474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009951137.1|799699_801286_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	28.7	5.5e-43
WP_009951139.1|801275_802589_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_004547610.1|802585_805717_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	30.2	1.9e-71
WP_009951141.1|805801_806386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004547608.1|806470_806827_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024429085.1|806807_807200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004547612.1|807215_808637_-|integrase	integrase family protein	integrase	NA	NA	NA	NA
WP_004527844.1|809472_809799_+|plate	baseplate assembly protein	plate	K4NZR5	Burkholderia_phage	98.1	6.6e-52
808821:808863	attR	TTGATTTGTAATCATCAGGTGGCGGGTTCGAGTCCTGCAGCCG	NA	NA	NA	NA
WP_004527843.1|809791_810205_+|tail	phage tail protein I	tail	K4NXA0	Burkholderia_phage	100.0	8.0e-71
WP_004527842.1|810102_810705_+	site-specific DNA-methyltransferase	NA	K4NZW3	Burkholderia_phage	87.9	1.6e-80
WP_004527840.1|811726_812092_-	phage virion morphogenesis protein	NA	K4NZQ8	Burkholderia_phage	88.4	2.5e-52
WP_004521948.1|812193_812979_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004521949.1|812975_814322_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004521950.1|814430_815045_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004531875.1|815418_816090_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_004521952.1|816126_816645_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004521953.1|816661_818152_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004527837.1|818224_818728_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_011205263.1|818755_819268_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 4
NZ_CP012576	Burkholderia pseudomallei strain 982 chromosome 1, complete sequence	4028032	1149491	1158744	4028032		Hokovirus(16.67%)	7	NA	NA
WP_004527678.1|1149491_1151444_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.2	2.7e-148
WP_004522147.1|1151710_1152841_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.6	1.7e-22
WP_014917873.1|1152874_1154881_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	34.8	1.6e-52
WP_004194137.1|1155072_1155888_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	8.8e-37
WP_004532195.1|1155952_1156636_-	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	2.0e-05
WP_009971015.1|1156632_1157160_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_014917872.1|1157196_1158744_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.2	4.3e-24
>prophage 5
NZ_CP012576	Burkholderia pseudomallei strain 982 chromosome 1, complete sequence	4028032	1494090	1502898	4028032		Bacillus_phage(16.67%)	8	NA	NA
WP_004537711.1|1494090_1495491_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.5	4.2e-79
WP_009921652.1|1495522_1496446_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.1	1.3e-15
WP_004190173.1|1496504_1497497_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	9.1e-28
WP_004189725.1|1497568_1497886_+	competence protein ComE	NA	NA	NA	NA	NA
WP_004550116.1|1498210_1499113_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.9	3.3e-53
WP_076853526.1|1499339_1500662_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_038715031.1|1500789_1501713_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	36.2	2.4e-43
WP_038715033.1|1502055_1502898_-	alpha/beta hydrolase	NA	A7XCB7	Tanapox_virus	26.6	2.7e-17
>prophage 6
NZ_CP012576	Burkholderia pseudomallei strain 982 chromosome 1, complete sequence	4028032	2017609	2022088	4028032		Burkholderia_virus(50.0%)	8	NA	NA
WP_076811937.1|2017609_2017873_+	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	85.5	5.0e-26
WP_076804729.1|2018057_2018369_-	hypothetical protein	NA	A4PE26	Ralstonia_virus	60.2	4.5e-26
WP_038763587.1|2018789_2019392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004527237.1|2019733_2020240_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	40.1	5.1e-19
WP_004527236.1|2020236_2020662_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	49.4	3.8e-15
WP_009937072.1|2020942_2021338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004531416.1|2021591_2021819_+	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	75.8	3.8e-22
WP_004527234.1|2021854_2022088_-	hypothetical protein	NA	A4PE26	Ralstonia_virus	60.6	4.3e-13
>prophage 7
NZ_CP012576	Burkholderia pseudomallei strain 982 chromosome 1, complete sequence	4028032	2887381	2893355	4028032	integrase	Burkholderia_virus(28.57%)	11	2875092:2875106	2900942:2900956
2875092:2875106	attL	GCGCTTCCAGCCGCA	NA	NA	NA	NA
WP_004526711.1|2887381_2887804_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	47.0	8.3e-15
WP_076849822.1|2887800_2888310_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	39.4	3.9e-19
WP_004531127.1|2888302_2888776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076831547.1|2888810_2889254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076867396.1|2889619_2889958_+	hypothetical protein	NA	A4PE26	Ralstonia_virus	57.1	3.2e-25
WP_009941993.1|2889978_2890185_-	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	86.7	3.7e-16
WP_071810706.1|2890135_2890564_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5NNJ1	Burkholderia_phage	47.4	4.6e-21
WP_038715415.1|2890737_2891757_+|integrase	site-specific integrase	integrase	A0A0A1I5U0	Burkholderia_phage	38.2	2.1e-48
WP_038715417.1|2891791_2892262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076853128.1|2892515_2892737_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_076853114.1|2893085_2893355_-	CopG family transcriptional regulator	NA	A0A0A8JBA5	Ralstonia_phage	58.6	5.3e-23
2900942:2900956	attR	GCGCTTCCAGCCGCA	NA	NA	NA	NA
>prophage 8
NZ_CP012576	Burkholderia pseudomallei strain 982 chromosome 1, complete sequence	4028032	3450071	3461026	4028032	protease	Agrobacterium_phage(16.67%)	10	NA	NA
WP_004196461.1|3450071_3452372_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	5.1e-167
WP_004194131.1|3452368_3452683_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	4.4e-13
WP_004196460.1|3453215_3453419_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_004536101.1|3453548_3455159_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_004189626.1|3455171_3455354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189552.1|3455326_3456586_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	5.2e-12
WP_004189780.1|3456853_3457432_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_071810810.1|3457694_3457913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004526282.1|3458104_3458614_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	4.2e-13
WP_004197486.1|3458911_3461026_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	5.8e-56
>prophage 1
NZ_CP012577	Burkholderia pseudomallei strain 982 chromosome 2, complete sequence	3156645	54163	121620	3156645	plate,holin	Aeromonas_phage(25.0%)	52	NA	NA
WP_004530063.1|54163_55114_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_004523149.1|55381_56326_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_004530060.1|56797_58501_+	thermolysin metallopeptidase	NA	NA	NA	NA	NA
WP_004545903.1|58618_59845_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_004200640.1|59899_61042_-	porin	NA	NA	NA	NA	NA
WP_004198249.1|61150_61273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004535106.1|61269_62268_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_004554842.1|62303_63857_-|holin	choline-sulfatase	holin	NA	NA	NA	NA
WP_004523143.1|63992_64892_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004186920.1|65035_65911_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_004530057.1|65997_67653_-	APC family permease	NA	NA	NA	NA	NA
WP_004523141.1|67833_68697_-	glycine betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004530056.1|68806_69952_-	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004523139.1|69972_71241_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_004530055.1|71265_72051_-	drug:proton antiporter	NA	NA	NA	NA	NA
WP_004523138.1|72047_73220_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_004186901.1|73224_75150_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_004523137.1|75152_77216_-	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_004186987.1|77276_77810_-	4-vinyl reductase	NA	NA	NA	NA	NA
WP_004535113.1|77960_78932_-	membrane dipeptidase	NA	NA	NA	NA	NA
WP_004523136.1|79004_80279_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.1	5.3e-105
WP_009923708.1|80290_80554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004198247.1|80712_81738_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_004523135.1|81915_83115_-	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	27.2	8.4e-12
WP_004530052.1|83561_84578_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004530051.1|84766_86332_+	glycoside hydrolase 68 family protein	NA	NA	NA	NA	NA
WP_004530050.1|86464_88129_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	31.6	4.1e-57
WP_053565654.1|88641_89895_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004528656.1|90375_91959_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_004532079.1|91955_92138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038715302.1|92263_93259_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_004524286.1|93487_95074_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_011857650.1|95070_96390_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_076854645.1|96397_96526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004524288.1|96611_97511_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_009923697.1|97790_97964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004530793.1|98061_98433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190471.1|98657_99083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190863.1|99105_99465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004525554.1|99523_103027_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_004530043.1|103023_104739_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004525552.1|104764_106126_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004530042.1|106122_106716_-	lipoprotein	NA	NA	NA	NA	NA
WP_004190606.1|106721_107111_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_004525551.1|107153_107870_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_004525550.1|107872_108943_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_004530041.1|108942_111159_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_004190563.1|111162_113451_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_004525548.1|113616_115908_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_004530040.1|115898_118769_-	type VI secretion system ATPase TssH	NA	A0A2I7REQ1	Vibrio_phage	27.2	2.4e-60
WP_004190851.1|118771_119761_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004196180.1|119757_121620_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 2
NZ_CP012577	Burkholderia pseudomallei strain 982 chromosome 2, complete sequence	3156645	285528	295032	3156645	integrase,transposase	Burkholderia_virus(62.5%)	12	273705:273721	300087:300103
273705:273721	attL	TGCAGGCGCTCGCCGCG	NA	NA	NA	NA
WP_004525420.1|285528_285813_-	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	50.0	1.4e-10
WP_004549731.1|285796_286066_-	BrnT family toxin	NA	NA	NA	NA	NA
WP_038716556.1|286636_286912_+	hypothetical protein	NA	Q8W6Q1	Burkholderia_virus	97.8	1.4e-42
WP_009923452.1|286921_287053_+	bacteriophage protein Gp48	NA	Q8W6Q2	Burkholderia_virus	97.7	2.6e-15
WP_038716558.1|287054_287162_+	hypothetical protein	NA	Q6JIH6	Burkholderia_virus	88.6	3.4e-10
WP_004545584.1|287190_287433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004542548.1|288084_288666_-	hypothetical protein	NA	A9YX38	Burkholderia_phage	100.0	2.2e-21
WP_004542626.1|288921_289071_+	bacteriophage protein Gp44	NA	Q8W6Q6	Burkholderia_virus	98.0	7.4e-19
WP_045243524.1|289067_290267_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A4JX31	Burkholderia_virus	99.2	6.9e-224
WP_004530731.1|290562_292578_-	cation acetate symporter	NA	NA	NA	NA	NA
WP_004545569.1|292571_292952_-	DUF4212 domain-containing protein	NA	NA	NA	NA	NA
WP_024431204.1|293049_295032_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	44.8	4.0e-83
300087:300103	attR	TGCAGGCGCTCGCCGCG	NA	NA	NA	NA
>prophage 3
NZ_CP012577	Burkholderia pseudomallei strain 982 chromosome 2, complete sequence	3156645	1128646	1194470	3156645	plate,transposase	Stx2-converting_phage(28.57%)	36	NA	NA
WP_004190585.1|1128646_1130050_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004190689.1|1130065_1131382_+	DotU family type VI secretion system protein	NA	NA	NA	NA	NA
WP_004524806.1|1131384_1135014_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_080378993.1|1135019_1136015_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_004529325.1|1135999_1136227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053565676.1|1136225_1138823_+	serine/threonine protein kinase	NA	M1I231	Acanthocystis_turfacea_Chlorella_virus	26.2	2.5e-08
WP_004529323.1|1138875_1139955_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004524810.1|1140017_1140596_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004190849.1|1140588_1142097_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004190698.1|1142156_1142648_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_050376259.1|1142666_1143227_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_050376258.1|1143231_1145103_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004537556.1|1145099_1146545_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004533146.1|1146557_1149224_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.6	5.2e-78
WP_004203275.1|1149220_1151425_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.9	9.6e-46
WP_004196151.1|1151499_1152153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050773484.1|1152112_1153372_+	DUF746 domain-containing protein	NA	NA	NA	NA	NA
WP_004552182.1|1154103_1154889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076808573.1|1156282_1157341_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_075019267.1|1157691_1159752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004536997.1|1161073_1162315_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_004544732.1|1162347_1163301_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_004533190.1|1163301_1164153_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_031313668.1|1164157_1166329_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_004533113.1|1166569_1168603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004533334.1|1169035_1169443_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	34.9	4.6e-10
WP_004524834.1|1169439_1169787_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	72.9	1.6e-40
WP_009935223.1|1170898_1171345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004530178.1|1173980_1175249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080378976.1|1175262_1179894_+	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	34.9	8.3e-23
WP_004533385.1|1180485_1180749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071811406.1|1180749_1180947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053565678.1|1181098_1190524_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004533256.1|1190966_1192727_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_004533207.1|1192945_1193320_+	DUF746 domain-containing protein	NA	NA	NA	NA	NA
WP_101662898.1|1193350_1194470_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.1	1.8e-48
>prophage 4
NZ_CP012577	Burkholderia pseudomallei strain 982 chromosome 2, complete sequence	3156645	1679753	1689530	3156645	integrase	Ralstonia_phage(25.0%)	15	1679998:1680012	1694162:1694176
WP_053565729.1|1679753_1681679_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	29.4	2.4e-16
1679998:1680012	attL	TCGCGGCCGACGACG	NA	NA	NA	NA
WP_050858262.1|1682030_1683257_+|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	61.8	9.8e-141
WP_080366004.1|1683246_1683486_-	AlpA family transcriptional regulator	NA	A0A077K9Z8	Ralstonia_phage	66.7	2.1e-15
WP_080366005.1|1683526_1683781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154394634.1|1683777_1684092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143292323.1|1684088_1684457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053565686.1|1684453_1684666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080378982.1|1684665_1685241_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	27.5	6.2e-05
WP_080378983.1|1685430_1685691_-	hypothetical protein	NA	C5IHM5	Burkholderia_virus	44.8	6.1e-08
WP_053565688.1|1685684_1687040_-	hypothetical protein	NA	Q8W6Q9	Burkholderia_virus	38.1	7.3e-28
WP_038720344.1|1687060_1687345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038720343.1|1687341_1688010_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_063921002.1|1688175_1688835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038720341.1|1688865_1689060_-	hypothetical protein	NA	A9YX20	Burkholderia_phage	83.1	3.0e-20
WP_050858082.1|1689056_1689530_-	hypothetical protein	NA	A9YX19	Burkholderia_phage	67.4	3.1e-50
1694162:1694176	attR	CGTCGTCGGCCGCGA	NA	NA	NA	NA
>prophage 5
NZ_CP012577	Burkholderia pseudomallei strain 982 chromosome 2, complete sequence	3156645	1703116	1710212	3156645	transposase	Mycobacterium_phage(16.67%)	11	NA	NA
WP_080378986.1|1703116_1703896_+	site-specific DNA-methyltransferase	NA	S5YD89	Mycobacterium_phage	61.0	1.4e-84
WP_053565697.1|1703867_1705316_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	92.9	2.7e-275
WP_080378987.1|1705312_1706002_-	DNA cytosine methyltransferase	NA	A0A0H5AU88	Pseudomonas_phage	51.6	3.4e-58
WP_053565698.1|1706104_1707499_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	48.1	1.6e-94
WP_038720276.1|1707491_1708025_+	polynucleotidyl transferase	NA	NA	NA	NA	NA
WP_050863552.1|1708024_1708591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038720272.1|1708590_1708881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143293768.1|1708877_1709120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038720302.1|1709140_1709443_+	DUF968 domain-containing protein	NA	A0A0R6PD09	Moraxella_phage	46.0	4.1e-08
WP_038720269.1|1709439_1709679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038720266.1|1709675_1710212_+	hypothetical protein	NA	A0A0H3UZE4	Geobacillus_virus	38.9	4.3e-32
