The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012674	Proteus mirabilis strain CYPM1 chromosome, complete genome	3793000	1053380	1061582	3793000		Bacillus_virus(16.67%)	8	NA	NA
WP_004246075.1|1053380_1054580_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.6	3.8e-28
WP_004252248.1|1056181_1058308_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.3	1.5e-205
WP_004246072.1|1058336_1058741_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	38.5	3.7e-12
WP_004246071.1|1058752_1058977_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	47.9	1.4e-13
WP_004246069.1|1059258_1059732_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_004246068.1|1059929_1060139_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	74.2	5.9e-22
WP_162492994.1|1060323_1060464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246058.1|1061207_1061582_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.0	2.7e-25
>prophage 2
NZ_CP012674	Proteus mirabilis strain CYPM1 chromosome, complete genome	3793000	1271448	1350483	3793000	tRNA,plate,protease	Bacillus_phage(17.65%)	58	NA	NA
WP_004244558.1|1271448_1271763_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.1	1.5e-13
WP_004244559.1|1271793_1274088_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.9	1.3e-170
WP_004244560.1|1274207_1274426_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_012367702.1|1274745_1275438_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004244562.1|1275439_1277191_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	31.7	1.4e-18
WP_017628444.1|1277193_1278963_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	23.5	3.0e-21
WP_004244564.1|1279101_1280061_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.8	9.0e-65
WP_004244566.1|1280602_1281097_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_053828337.1|1281224_1285088_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.3	1.7e-90
WP_004244569.1|1285200_1285806_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_012367706.1|1285816_1287166_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	1.8e-79
WP_004244571.1|1287298_1288588_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.2	4.1e-97
WP_053828338.1|1288767_1288974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012367707.1|1289499_1290549_+	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_004244574.1|1290621_1291527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244575.1|1291884_1292625_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	27.0	2.3e-20
WP_004244576.1|1292732_1295015_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.6	1.0e-159
WP_004244577.1|1295069_1295924_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_017628443.1|1296594_1298352_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_004244579.1|1298579_1299617_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_012367709.1|1299691_1300960_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_017628442.1|1301096_1302527_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	25.1	4.4e-07
WP_004244582.1|1302663_1303752_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.0	5.7e-84
WP_017628441.1|1303948_1305235_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_004244585.1|1305523_1306201_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_004244586.1|1306382_1308056_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_004244587.1|1308120_1308408_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.0	8.4e-11
WP_017628440.1|1308844_1311214_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q0H255	Geobacillus_phage	29.3	3.6e-22
WP_004244589.1|1311250_1312996_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.9	8.4e-61
WP_012367713.1|1312992_1313994_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_004247631.1|1314489_1314705_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004244593.1|1315119_1315299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244594.1|1315303_1316065_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_017628439.1|1316188_1317019_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_004244596.1|1317398_1318172_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_004244597.1|1318181_1319504_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_004247634.1|1319484_1320216_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_012367715.1|1320212_1324670_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_053828339.1|1324952_1325606_-	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	80.4	8.2e-102
WP_004247637.1|1326012_1326726_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_049194798.1|1327075_1328791_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_004244605.1|1329122_1329671_+	YcbK family protein	NA	NA	NA	NA	NA
WP_053828340.1|1329720_1330371_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_004244607.1|1330463_1330937_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_004244608.1|1331027_1332764_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_017628437.1|1332756_1334112_-	membrane protein	NA	NA	NA	NA	NA
WP_017628436.1|1334149_1337698_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_012367720.1|1337700_1339164_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004244612.1|1339169_1339820_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_004244614.1|1339821_1340610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049194443.1|1340613_1343325_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.5	1.4e-83
WP_004244617.1|1343333_1344089_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_026164596.1|1344081_1345440_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004244619.1|1345441_1345993_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004247648.1|1345994_1347263_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_049194444.1|1347267_1348305_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_049194445.1|1348268_1350044_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004244624.1|1350051_1350483_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 3
NZ_CP012674	Proteus mirabilis strain CYPM1 chromosome, complete genome	3793000	1769365	1779357	3793000		Escherichia_phage(66.67%)	8	NA	NA
WP_017628120.1|1769365_1771423_-	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	26.1	2.2e-31
WP_004242886.1|1771434_1773135_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_004242887.1|1773470_1774157_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_004242888.1|1774156_1774618_+	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	34.6	7.0e-15
WP_004242890.1|1774670_1775282_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	39.1	7.3e-28
WP_017628119.1|1775421_1776282_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	35.5	1.3e-25
WP_004242892.1|1776283_1776901_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.6	2.2e-72
WP_017628118.1|1776912_1779357_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	50.4	5.6e-220
>prophage 4
NZ_CP012674	Proteus mirabilis strain CYPM1 chromosome, complete genome	3793000	2295102	2310999	3793000		Escherichia_phage(27.27%)	16	NA	NA
WP_012368081.1|2295102_2297541_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	54.5	5.0e-261
WP_004243609.1|2297552_2298170_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	67.8	1.3e-88
WP_004243611.1|2298173_2298950_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	39.8	5.1e-42
WP_004243612.1|2299065_2299608_-	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	34.7	1.9e-19
WP_017628013.1|2300176_2300356_+	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_017628011.1|2301670_2302327_-	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	39.4	6.6e-35
WP_017628010.1|2302323_2303511_-	hypothetical protein	NA	A0A2H5BG53	Pseudoalteromonas_phage	37.7	1.9e-72
WP_004243617.1|2303503_2303848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243621.1|2303844_2304537_-	hypothetical protein	NA	A0A2H4P6V3	Pseudomonas_phage	35.7	1.2e-29
WP_004243622.1|2304539_2305352_-	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	39.2	9.0e-42
WP_004243623.1|2305320_2305641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004250719.1|2305653_2306142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628009.1|2306144_2308448_-	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	23.1	1.6e-14
WP_004243627.1|2308530_2308989_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	1.9e-25
WP_012368088.1|2309048_2309501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628008.1|2309511_2310999_-	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	35.7	1.4e-77
>prophage 5
NZ_CP012674	Proteus mirabilis strain CYPM1 chromosome, complete genome	3793000	2785767	2803089	3793000	integrase	Morganella_phage(53.85%)	22	2780944:2780963	2801816:2801835
2780944:2780963	attL	ATGCCCCCAATTATGCCCCC	NA	NA	NA	NA
WP_053828371.1|2785767_2789001_-	hypothetical protein	NA	A0A1W6JNU2	Morganella_phage	40.5	6.9e-101
WP_036900256.1|2789017_2789359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072156938.1|2789358_2789532_-	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_053828372.1|2789713_2790223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053828373.1|2790297_2790750_-	ProQ/FinO family protein	NA	A0A1W6JPI6	Morganella_phage	57.4	1.5e-14
WP_053828374.1|2791208_2793929_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	65.4	0.0e+00
WP_036900269.1|2793925_2794270_-	hypothetical protein	NA	A0A1W6JPD8	Morganella_phage	71.9	2.8e-45
WP_053828375.1|2794284_2794881_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	38.8	1.1e-28
WP_036900272.1|2794880_2795075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162837557.1|2795074_2795248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052174189.1|2795244_2795856_-	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	46.3	3.3e-20
WP_036900274.1|2795852_2796062_-	hypothetical protein	NA	A0A1W6JPF1	Morganella_phage	52.2	4.7e-11
WP_053828376.1|2796058_2796238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053828377.1|2796234_2796492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071843629.1|2796494_2796668_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_081000328.1|2796660_2797665_-	ash family protein	NA	A0A1W6JPK3	Morganella_phage	50.1	1.2e-67
WP_053828378.1|2797685_2798480_-	anti-repressor protein	NA	A0A0R6PJV6	Moraxella_phage	50.9	2.6e-25
WP_053828379.1|2798492_2798912_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	57.3	1.4e-38
WP_053828380.1|2798911_2799133_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	43.4	5.7e-07
WP_053828381.1|2799283_2800360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036900290.1|2800571_2801783_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	55.7	3.8e-129
WP_017627899.1|2802216_2803089_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.8	9.7e-34
2801816:2801835	attR	ATGCCCCCAATTATGCCCCC	NA	NA	NA	NA
>prophage 6
NZ_CP012674	Proteus mirabilis strain CYPM1 chromosome, complete genome	3793000	3074182	3083026	3793000		Caulobacter_phage(50.0%)	9	NA	NA
WP_004245601.1|3074182_3075751_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	7.2e-11
WP_012368337.1|3076151_3076832_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_004245603.1|3076928_3077504_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.3	1.2e-27
WP_004249446.1|3077580_3078159_-	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	41.5	2.4e-33
WP_004245605.1|3078226_3079252_-	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	47.9	1.3e-74
WP_004245607.1|3079286_3079742_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_017628547.1|3079766_3080903_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_004250201.1|3080903_3081488_-	tellurium resistance-associated protein TerZ	NA	K4JRX3	Caulobacter_phage	30.2	4.2e-17
WP_017628546.1|3081880_3083026_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	27.2	4.5e-31
>prophage 7
NZ_CP012674	Proteus mirabilis strain CYPM1 chromosome, complete genome	3793000	3585771	3635240	3793000	transposase	Escherichia_phage(25.0%)	37	NA	NA
WP_053867605.1|3585771_3586950_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	79.3	1.0e-182
WP_053867606.1|3586972_3587389_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.8	2.6e-45
WP_004249011.1|3588208_3588727_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_017628614.1|3588799_3590971_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_017628612.1|3595285_3596224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004249835.1|3596216_3596486_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_017628611.1|3596677_3597601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012368584.1|3597690_3598368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246670.1|3602597_3603281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246669.1|3603370_3603994_-	fimbrillin MatB	NA	NA	NA	NA	NA
WP_004246668.1|3604133_3604454_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017628609.1|3605500_3606535_-	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	41.3	7.4e-65
WP_001274561.1|3607077_3607923_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_060589331.1|3608007_3608295_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000761716.1|3608224_3608713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001094437.1|3608709_3609087_-	toxin	NA	NA	NA	NA	NA
WP_001390338.1|3609133_3609511_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000692345.1|3609673_3609895_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001535682.1|3609957_3610434_-	RadC family protein	NA	NA	NA	NA	NA
WP_000855064.1|3610449_3610923_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	29.6	3.3e-12
WP_001535681.1|3611264_3612083_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.7	3.6e-46
WP_001323397.1|3612237_3612396_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_053828397.1|3612466_3615313_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001069760.1|3615685_3616558_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000241617.1|3616656_3617529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001387788.1|3621430_3622033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072153745.1|3622127_3622406_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000148641.1|3623996_3624566_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000271020.1|3624731_3625115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032181455.1|3625111_3625537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080195.1|3626016_3627630_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624711.1|3627660_3628011_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	4.0e-39
WP_000981822.1|3628007_3628412_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	84.3	1.4e-30
WP_096043063.1|3628374_3629391_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.1	7.0e-185
WP_000412211.1|3630510_3631170_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_000656305.1|3631370_3631748_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001067834.1|3634535_3635240_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
