The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012650	Lactiplantibacillus plantarum strain HFC8 isolate Lactobacillus plantarum chromosome, complete genome	3067675	274470	338436	3067675	transposase,integrase	Staphylococcus_prophage(22.22%)	58	335384:335398	336321:336335
WP_016511843.1|274470_275391_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	31.0	1.6e-23
WP_060677009.1|277231_278311_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_046039218.1|278408_278897_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_080376211.1|279044_280388_+	glycosyl hydrolase family 25	NA	A0A2P0ZKX1	Lactobacillus_phage	33.0	3.8e-37
WP_015825567.1|280469_281528_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_046039220.1|281675_282428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060677010.1|282427_283105_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.8	8.4e-09
WP_060677011.1|284348_285143_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_046039231.1|285300_286407_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_003640505.1|286403_286790_-	ribonuclease HI family protein	NA	NA	NA	NA	NA
WP_060677012.1|286824_287211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060677013.1|287304_288960_+	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_003640508.1|289292_289742_+	signal peptidase II	NA	NA	NA	NA	NA
WP_011101547.1|289761_290685_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.1	1.2e-10
WP_046039237.1|290843_291368_+	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_003640511.1|291402_292485_+	carbamoyl phosphate synthase small subunit	NA	NA	NA	NA	NA
WP_060677014.1|292481_295043_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_060677015.1|295221_295821_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	39.8	1.1e-33
WP_060677016.1|295929_296340_-	DUF1801 domain-containing protein	NA	NA	NA	NA	NA
WP_144425335.1|297014_297814_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_060677017.1|298454_298826_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_046039249.1|298829_299555_-	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
WP_046039251.1|299757_300252_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_060677018.1|300637_301537_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	40.1	2.8e-36
WP_060677019.1|301549_302311_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003640521.1|302428_304135_-	NFACT family protein	NA	NA	NA	NA	NA
WP_003640522.1|304620_305043_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011101553.1|305127_305997_+	DegV family protein	NA	NA	NA	NA	NA
WP_003644400.1|305998_306433_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003645051.1|306547_307285_+	DUF975 family protein	NA	NA	NA	NA	NA
WP_060677020.1|307400_308114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003644401.1|308205_308496_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_046039265.1|308577_309366_+	DUF4931 domain-containing protein	NA	NA	NA	NA	NA
WP_060677021.1|309568_310756_-	MFS transporter	NA	NA	NA	NA	NA
WP_003644404.1|311093_311426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003640531.1|311453_311762_+	DUF960 domain-containing protein	NA	NA	NA	NA	NA
WP_003645047.1|311990_312728_+	DUF1003 domain-containing protein	NA	NA	NA	NA	NA
WP_003640533.1|312863_313721_-	DUF368 domain-containing protein	NA	NA	NA	NA	NA
WP_003640535.1|313945_315286_+	amino acid permease	NA	NA	NA	NA	NA
WP_060677022.1|315478_316357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046039338.1|316507_316858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060677023.1|318590_319940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011373852.1|320167_321088_-|transposase	IS30-like element ISLsa1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.2	9.2e-51
WP_003645042.1|321257_321959_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_046039345.1|321960_322986_+	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_060677024.1|322973_324095_+	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_060677025.1|324095_325994_+	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_046039349.1|326092_326620_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003644413.1|326790_327228_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060677026.1|327293_328643_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.7	4.7e-27
WP_013355549.1|328722_329130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060677027.1|329332_330640_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_060677028.1|330651_332154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011373852.1|332359_333280_+|transposase	IS30-like element ISLsa1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.2	9.2e-51
335384:335398	attL	TTTTAGTTAAAGTAA	NA	NA	NA	NA
WP_046039356.1|335431_336286_+|integrase	phage integrase N-terminal SAM-like domain-containing protein	integrase	NA	NA	NA	NA
WP_003640551.1|336498_336699_+	sterile alpha motif-like domain-containing protein	NA	NA	NA	NA	NA
336321:336335	attR	TTTTAGTTAAAGTAA	NA	NA	NA	NA
WP_046039358.1|336865_337378_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_060677029.1|337506_338436_+|transposase	IS30-like element ISLpl1 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP012650	Lactiplantibacillus plantarum strain HFC8 isolate Lactobacillus plantarum chromosome, complete genome	3067675	503970	557738	3067675	transposase,tRNA,protease,integrase	Bodo_saltans_virus(11.11%)	53	529487:529504	560556:560573
WP_080339071.1|503970_504894_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_144425337.1|505025_505220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046039524.1|505389_505911_-	shikimate kinase	NA	NA	NA	NA	NA
WP_060677082.1|505912_507010_-	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_060677083.1|507012_508311_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_060677084.1|508324_508852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046039532.1|508860_510030_-	chorismate synthase	NA	NA	NA	NA	NA
WP_060677085.1|510022_511465_-	MFS transporter	NA	NA	NA	NA	NA
WP_003640723.1|512062_512416_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_046039536.1|512438_515003_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.4	2.1e-20
WP_003640725.1|515017_515323_-	ribosomal L7Ae/L30e/S12e/Gadd45 family protein	NA	NA	NA	NA	NA
WP_003640726.1|515312_515612_-	YlxR family protein	NA	NA	NA	NA	NA
WP_060677086.1|515656_516874_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_046039544.1|516894_517371_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_003640729.1|517666_521980_-	DNA polymerase III subunit alpha	NA	A0A1X9SH08	Bradyrhizobium_phage	34.0	1.0e-14
WP_003640732.1|522473_524183_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003640733.1|524222_525500_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_003640734.1|525537_526323_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_046039550.1|526338_527118_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	42.3	6.9e-23
WP_003640736.1|527237_527801_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_003640737.1|527802_528525_-	UMP kinase	NA	NA	NA	NA	NA
WP_003644498.1|528724_529603_-	elongation factor Ts	NA	NA	NA	NA	NA
529487:529504	attL	GTCAACGGCTTTTTCCAT	NA	NA	NA	NA
WP_060677087.1|529705_530518_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_046039552.1|530742_531465_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003561810.1|532132_533062_+|transposase	IS30-like element ISLpl1 family transposase	transposase	NA	NA	NA	NA
WP_046039554.1|533468_533714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046039557.1|533726_533924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052697201.1|534373_534661_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_157262540.1|536048_536231_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2I6AZV9	Macacine_betaherpesvirus	53.2	2.3e-06
WP_052697202.1|536223_536370_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_003640741.1|536478_537477_-	D-2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	34.9	2.3e-47
WP_046039561.1|537561_537867_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_046039562.1|537850_538609_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_025015626.1|538720_539356_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_003640745.1|539413_539650_-	YneF family protein	NA	NA	NA	NA	NA
WP_011373852.1|539719_540640_-|transposase	IS30-like element ISLsa1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.2	9.2e-51
WP_003644501.1|540784_541024_-	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003640747.1|541175_541808_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	56.2	2.3e-16
WP_144425359.1|541897_542128_-	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_060677088.1|542431_543061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060677089.1|543110_544280_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_046039564.1|544871_545264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046039565.1|545728_546670_+	glycosyltransferase family 2 protein	NA	V9QJB1	Oenococcus_phage	48.7	3.1e-78
WP_160316022.1|547126_548572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135293886.1|548992_549202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046039647.1|549394_549595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160316023.1|551220_551385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003640763.1|552388_552595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060677091.1|552769_553531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003640765.1|553642_553990_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_060677092.1|554084_555296_-	MFS transporter	NA	NA	NA	NA	NA
WP_003640767.1|555411_555996_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_060677093.1|556061_557738_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	41.3	1.4e-92
560556:560573	attR	GTCAACGGCTTTTTCCAT	NA	NA	NA	NA
>prophage 3
NZ_CP012650	Lactiplantibacillus plantarum strain HFC8 isolate Lactobacillus plantarum chromosome, complete genome	3067675	793968	858704	3067675	transposase,holin,tail	Bacillus_phage(20.0%)	58	NA	NA
WP_016511843.1|793968_794889_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	31.0	1.6e-23
WP_003641465.1|795243_796248_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003644649.1|796488_798744_-	bifunctional glutamate--cysteine ligase GshA/glutathione synthetase GshB	NA	NA	NA	NA	NA
WP_003641463.1|798853_800134_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	47.8	9.7e-99
WP_003641462.1|800764_801049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003644650.1|801115_801598_+	universal stress protein	NA	NA	NA	NA	NA
WP_060677148.1|801686_802817_-	serine hydrolase	NA	NA	NA	NA	NA
WP_003641460.1|802933_803830_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_060677149.1|804279_805839_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_021357478.1|805914_807027_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_060677150.1|807128_808157_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_060677151.1|808178_809153_-	DUF2785 domain-containing protein	NA	NA	NA	NA	NA
WP_003641455.1|809351_810269_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_003645414.1|810511_811336_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_152707287.1|811361_811997_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003641452.1|812046_813078_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.4	1.5e-28
WP_060677152.1|813445_813742_-	glycine cleavage system protein H	NA	NA	NA	NA	NA
WP_060677153.1|813772_814978_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_003641449.1|815125_815353_-	DUF2969 domain-containing protein	NA	NA	NA	NA	NA
WP_003644657.1|815336_815609_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	47.7	9.8e-17
WP_003644658.1|815615_816617_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_003641446.1|816740_817295_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003644659.1|817402_818719_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_060677154.1|819692_820121_-	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_003641443.1|820132_821536_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_003641442.1|821560_822505_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_003641441.1|822534_824055_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_003641440.1|824077_824623_-	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_050339397.1|824612_825128_-	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_003639224.1|825181_825394_-	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_060677155.1|825431_826145_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_003641437.1|826422_827703_-	uracil transporter	NA	Q9KX94	Enterobacteria_phage	37.3	1.8e-65
WP_003639227.1|828855_829485_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003641436.1|829564_830803_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	50.6	1.4e-94
WP_003645419.1|830861_831881_-	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	41.5	9.3e-52
WP_003645420.1|832171_833038_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_003641433.1|833030_834113_-	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_003644660.1|834126_834705_-	thymidine kinase	NA	A0A249XZX5	Enterococcus_phage	49.7	7.3e-46
WP_003641431.1|834966_836313_+	Mur ligase family protein	NA	NA	NA	NA	NA
WP_060677156.1|836315_837038_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_060677157.1|837299_838265_-	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_003644662.1|838341_839361_-	serine hydrolase	NA	A0A249XPW4	Mycobacterium_phage	24.2	1.2e-06
WP_011101727.1|839531_839717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641425.1|839967_840996_-	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_003641424.1|841127_841490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060677158.1|841705_842677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046039829.1|842691_844581_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.1	1.6e-57
WP_060677159.1|844580_846311_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.4	7.6e-46
WP_015825756.1|846533_846926_-	YxeA family protein	NA	NA	NA	NA	NA
WP_011373852.1|847169_848090_+|transposase	IS30-like element ISLsa1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.2	9.2e-51
WP_060677160.1|849463_850603_-	ImmA/IrrE family metallo-endopeptidase	NA	B6SBZ6	Clostridium_virus	28.0	6.1e-28
WP_060677161.1|850608_851289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060677163.1|852738_853116_-|holin	holin	holin	A0A2H4PBB2	Lactobacillus_phage	66.7	8.5e-19
WP_144425340.1|854670_854829_-	XkdX family protein	NA	NA	NA	NA	NA
WP_060677164.1|854825_855242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060677165.1|855329_856505_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_162490430.1|856629_857808_-|tail	phage tail protein	tail	Q9T1A5	Listeria_phage	22.6	1.5e-16
WP_060677167.1|857807_858704_-|tail	phage tail family protein	tail	NA	NA	NA	NA
>prophage 4
NZ_CP012650	Lactiplantibacillus plantarum strain HFC8 isolate Lactobacillus plantarum chromosome, complete genome	3067675	865765	903374	3067675	terminase,capsid,head,portal,tail,transposase,integrase	Lactobacillus_phage(45.16%)	56	880609:880623	914108:914122
WP_060677175.1|865765_866131_-|head,tail	phage head-tail connector protein	head,tail	A0A1W6JNH7	Staphylococcus_phage	39.6	8.0e-06
WP_060677176.1|866145_867195_-	hypothetical protein	NA	A0A0S0N2Q7	Pseudomonas_phage	31.2	5.3e-34
WP_060677177.1|867211_867859_-	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_060677178.1|867956_868901_-|capsid	minor capsid protein	capsid	NA	NA	NA	NA
WP_080376223.1|868903_870571_-|portal	phage portal protein	portal	D2IZF6	Enterococcus_phage	32.8	1.4e-65
WP_060677179.1|870560_871859_-|terminase	PBSX family phage terminase large subunit	terminase	B7T0C6	Staphylococcus_virus	49.4	2.4e-113
WP_060677180.1|872063_872573_-|terminase	terminase small subunit	terminase	O03926	Lactobacillus_phage	63.2	1.0e-46
WP_080376290.1|872613_872883_-	DUF2829 domain-containing protein	NA	A0A0K2FLC4	Brevibacillus_phage	43.2	3.6e-11
WP_060677182.1|873614_874076_-	transcriptional regulator	NA	D6PSV8	Lactobacillus_phage	57.0	1.1e-39
WP_060677183.1|874452_874893_-	hypothetical protein	NA	A0A2K9VD94	Lactobacillus_phage	59.4	6.6e-47
WP_060677184.1|874889_875099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060677185.1|875091_875523_-	hypothetical protein	NA	Q5ULU9	Lactobacillus_virus	62.1	1.3e-44
WP_187329203.1|875506_875683_-	hypothetical protein	NA	E9LUP2	Lactobacillus_phage	81.0	8.8e-19
WP_144425341.1|875685_875844_-	hypothetical protein	NA	A0A2P0ZLB5	Lactobacillus_phage	92.3	6.7e-18
WP_080376291.1|875836_876052_-	helix-turn-helix transcriptional regulator	NA	D2IZX1	Enterococcus_phage	39.1	6.1e-06
WP_064505709.1|876185_876350_+	YjzC family protein	NA	A0A0A7RTS6	Clostridium_phage	66.0	3.0e-13
WP_060677187.1|876662_876860_-	hypothetical protein	NA	O03916	Lactobacillus_phage	56.9	3.9e-15
WP_060677188.1|876856_877276_-	RusA family crossover junction endodeoxyribonuclease	NA	A8YQM5	Lactobacillus_phage	42.3	1.3e-23
WP_060677189.1|877268_877802_-	hypothetical protein	NA	O03915	Lactobacillus_phage	52.3	1.7e-36
WP_060677190.1|877798_878086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060677191.1|878082_879015_-	DUF4373 domain-containing protein	NA	A0A0P0HRQ2	Lactobacillus_phage	44.0	5.1e-57
WP_060677192.1|879097_880063_-	hypothetical protein	NA	A6M982	Geobacillus_virus	54.5	2.6e-64
WP_080376226.1|880074_880605_-	host-nuclease inhibitor Gam family protein	NA	E9LUU0	Lactobacillus_phage	58.6	3.0e-54
880609:880623	attL	TGAAATCCTCCTATT	NA	NA	NA	NA
WP_060677194.1|881106_881619_-	helix-turn-helix transcriptional regulator	NA	D6PST4	Lactobacillus_phage	42.9	4.0e-27
WP_060677195.1|881686_881992_-	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_003642792.1|882003_882174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060677196.1|882198_882495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027821904.1|882494_882701_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003642789.1|882842_883073_+	helix-turn-helix transcriptional regulator	NA	A0A0K2CNE2	Brevibacillus_phage	36.8	8.5e-06
WP_033608056.1|883072_883471_+	DUF2513 domain-containing protein	NA	A0A1P8L6H1	Staphylococcus_phage	38.4	5.1e-14
WP_060677197.1|883467_883650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060677198.1|883726_883954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060677199.1|883950_884178_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011101778.1|884306_884669_+	helix-turn-helix domain-containing protein	NA	A0A2R2ZGJ3	Clostridioides_phage	48.4	1.7e-08
WP_060677200.1|884680_885097_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_060677201.1|885170_885530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022638129.1|885560_885842_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_060677202.1|886129_886525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060677203.1|886620_887304_+	DUF1828 domain-containing protein	NA	Q6SEA4	Lactobacillus_prophage	38.3	1.1e-29
WP_060677204.1|887411_888587_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_060677205.1|888944_890066_+|integrase	site-specific integrase	integrase	D6PSS4	Lactobacillus_phage	32.4	4.9e-46
WP_060677206.1|890417_890624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046783498.1|891043_891349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060677207.1|892847_893141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097558290.1|893157_893957_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027823052.1|894202_894472_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_060677208.1|894881_896462_-|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	26.8	1.3e-41
WP_060677209.1|896451_897558_-|portal	phage portal protein	portal	A0A2H4J9Q5	uncultured_Caudovirales_phage	33.3	1.0e-48
WP_033611503.1|897558_897759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060677210.1|897712_899416_-|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	40.3	9.2e-121
WP_046947487.1|899412_899886_-|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_060677211.1|900501_900891_-	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	46.1	7.9e-20
WP_054519350.1|900883_901222_-|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	36.6	1.9e-09
WP_046947484.1|901231_901414_-	sporulation protein Cse60	NA	NA	NA	NA	NA
WP_060677212.1|901437_901857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060677213.1|901979_903374_-	virulence protein	NA	Q4ZD27	Staphylococcus_phage	35.7	2.7e-70
914108:914122	attR	TGAAATCCTCCTATT	NA	NA	NA	NA
>prophage 5
NZ_CP012650	Lactiplantibacillus plantarum strain HFC8 isolate Lactobacillus plantarum chromosome, complete genome	3067675	1103385	1111896	3067675		Synechococcus_phage(33.33%)	9	NA	NA
WP_046040135.1|1103385_1103964_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.9	2.1e-21
WP_046040137.1|1103956_1104982_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.0	1.6e-59
WP_003642591.1|1104978_1106433_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.0	2.5e-50
WP_003645864.1|1106417_1108637_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.3	4.5e-144
WP_011101895.1|1108629_1109310_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003642588.1|1109309_1109564_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003642587.1|1109565_1110297_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	37.3	1.6e-37
WP_015380738.1|1110299_1111430_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003645861.1|1111413_1111896_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.0	2.3e-16
>prophage 6
NZ_CP012650	Lactiplantibacillus plantarum strain HFC8 isolate Lactobacillus plantarum chromosome, complete genome	3067675	1248387	1317067	3067675	tRNA,bacteriocin,transposase,protease	Bacillus_phage(27.27%)	51	NA	NA
WP_060677325.1|1248387_1249563_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_024002913.1|1250739_1251333_-	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_046040269.1|1251481_1252654_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_060677326.1|1252643_1253510_-	DUF3737 family protein	NA	NA	NA	NA	NA
WP_060677327.1|1253612_1254641_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_060677328.1|1255278_1257066_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.2	1.9e-44
WP_060677329.1|1257065_1258817_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.8	4.5e-54
WP_060677330.1|1259087_1260482_+	MFS transporter	NA	NA	NA	NA	NA
WP_016511843.1|1260655_1261576_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	31.0	1.6e-23
WP_060677331.1|1262011_1262569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060677332.1|1262720_1266428_-	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_060677333.1|1266452_1267007_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003642181.1|1267104_1267434_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_046040291.1|1267931_1268876_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_046040292.1|1268952_1269498_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012490951.1|1269664_1270663_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	2.5e-49
WP_046040293.1|1270880_1271408_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_046040294.1|1271484_1272315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060677334.1|1272782_1273988_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003644778.1|1274066_1275689_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	26.9	8.4e-47
WP_060677335.1|1276002_1276797_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_052697211.1|1276883_1278809_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_046040314.1|1281674_1282889_-	MFS transporter	NA	NA	NA	NA	NA
WP_060677336.1|1282988_1283900_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_060677337.1|1284334_1285231_+	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_046040321.1|1285376_1286744_+	APC family permease	NA	NA	NA	NA	NA
WP_060677338.1|1286832_1288083_-	MFS transporter	NA	NA	NA	NA	NA
WP_046040325.1|1288190_1289486_-	alkaline phosphatase family protein	NA	A0A1V0QG10	Shearwaterpox_virus	21.3	1.0e-07
WP_060677339.1|1289612_1290443_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003644867.1|1290619_1291339_+	UTRA domain-containing protein	NA	NA	NA	NA	NA
WP_060677340.1|1291721_1294226_-	choice-of-anchor A family protein	NA	NA	NA	NA	NA
WP_003642199.1|1294615_1294858_-	cytochrome b5	NA	NA	NA	NA	NA
WP_003644869.1|1295369_1295903_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_060677341.1|1296347_1297478_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	34.0	7.4e-18
WP_003642202.1|1297493_1298174_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_060677342.1|1298384_1298966_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A0C5K925	Enterococcus_phage	59.7	3.0e-55
WP_046040379.1|1298898_1301121_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	58.9	1.8e-249
WP_060677343.1|1301569_1302043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003644790.1|1302185_1302596_+	peptide deformylase	NA	A0A067XQZ3	Caulobacter_phage	43.8	1.5e-13
WP_011101977.1|1302677_1303679_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_003642208.1|1303867_1304872_-|tRNA	tRNA-dihydrouridine synthase family protein	tRNA	NA	NA	NA	NA
WP_003642209.1|1305047_1305242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060677344.1|1305557_1306817_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_046040343.1|1307257_1308160_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003642213.1|1308222_1309602_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_003644796.1|1309738_1311211_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_060677345.1|1312350_1313799_+	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_015380849.1|1313817_1314789_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_060677346.1|1314785_1316459_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	41.5	4.7e-93
WP_003642218.1|1316660_1316810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642219.1|1316809_1317067_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 7
NZ_CP012650	Lactiplantibacillus plantarum strain HFC8 isolate Lactobacillus plantarum chromosome, complete genome	3067675	1427108	1449643	3067675	transposase	unidentified_phage(50.0%)	16	NA	NA
WP_144425333.1|1427108_1427907_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_060677381.1|1428402_1429032_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_060677382.1|1429163_1431065_-	asparagine synthase (glutamine-hydrolyzing)	NA	R4TIC1	Phaeocystis_globosa_virus	29.6	6.2e-33
WP_003643388.1|1431540_1432287_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_060677383.1|1432291_1433542_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_060677384.1|1433943_1434231_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_060677385.1|1434254_1435133_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	35.7	6.3e-41
WP_003642336.1|1435218_1435800_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046040534.1|1435933_1436848_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_060677386.1|1436887_1438300_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_060677387.1|1438647_1441236_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_054398737.1|1441522_1441807_+	DUF1905 domain-containing protein	NA	NA	NA	NA	NA
WP_144425333.1|1442262_1443061_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_060677388.1|1444257_1444830_-	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_060677389.1|1446117_1447038_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	30.7	3.7e-23
WP_060677390.1|1448722_1449643_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	31.4	5.6e-24
>prophage 8
NZ_CP012650	Lactiplantibacillus plantarum strain HFC8 isolate Lactobacillus plantarum chromosome, complete genome	3067675	1494733	1555902	3067675	bacteriocin,transposase	Staphylococcus_prophage(13.33%)	56	NA	NA
WP_011373852.1|1494733_1495654_-|transposase	IS30-like element ISLsa1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.2	9.2e-51
WP_003642439.1|1495923_1496727_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_046040723.1|1496804_1497503_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003642441.1|1497514_1498276_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.0	3.5e-27
WP_053267529.1|1498749_1499565_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_060677405.1|1499733_1500309_-	zinc ribbon domain-containing protein	NA	D6PSS6	Lactobacillus_phage	38.0	9.6e-22
WP_003642445.1|1500670_1500988_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015826022.1|1500984_1501623_+	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_003645322.1|1501606_1502542_+	DUF4097 domain-containing protein	NA	NA	NA	NA	NA
WP_060677406.1|1502627_1504553_-	PTS beta-glucoside transporter subunit IIBCA	NA	NA	NA	NA	NA
WP_060677407.1|1504545_1506213_-	alpha-glucosidase	NA	NA	NA	NA	NA
WP_011102083.1|1506266_1507268_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_060677408.1|1507569_1508655_-	YdcF family protein	NA	NA	NA	NA	NA
WP_003643458.1|1508730_1509486_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_003642453.1|1509482_1510133_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	31.5	2.2e-22
WP_003642454.1|1510281_1511727_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	37.7	4.9e-83
WP_003642455.1|1511765_1512209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046040628.1|1512521_1513373_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_060677409.1|1513487_1514312_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_011102089.1|1514401_1514851_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003645311.1|1514944_1515808_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_060677410.1|1516024_1518019_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_060677411.1|1518273_1518942_-	endonuclease III	NA	NA	NA	NA	NA
WP_060677412.1|1519057_1519315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060677413.1|1519349_1519901_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	40.9	4.7e-34
WP_060677414.1|1520283_1521558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060677415.1|1521693_1522293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003643467.1|1522482_1522965_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_003643468.1|1523758_1523986_-	PLDc N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_015826037.1|1524040_1524913_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_003642476.1|1525344_1525887_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_060677416.1|1526259_1527258_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	3.2e-49
WP_003642477.1|1527418_1527838_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_003642478.1|1527857_1528586_-	LrgB family protein	NA	NA	NA	NA	NA
WP_011102096.1|1528760_1529600_-	DegV family protein	NA	NA	NA	NA	NA
WP_003642481.1|1530124_1530292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642482.1|1530459_1531158_+	zinc metallopeptidase	NA	NA	NA	NA	NA
WP_011102097.1|1531764_1533261_+	phytoene desaturase	NA	NA	NA	NA	NA
WP_060677417.1|1533241_1534123_+	phytoene/squalene synthase family protein	NA	NA	NA	NA	NA
WP_003642486.1|1534484_1535426_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_060677418.1|1535491_1536604_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	35.3	2.3e-35
WP_046040654.1|1536739_1538074_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	7.9e-27
WP_003642489.1|1538268_1538598_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003642490.1|1538820_1540119_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.6	3.8e-18
WP_003643473.1|1540435_1541725_+	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	37.0	3.5e-72
WP_024272289.1|1541773_1542745_+	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	71.2	1.4e-137
WP_003645476.1|1543730_1545179_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_003642495.1|1545315_1545465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046040659.1|1545777_1546260_-	membrane protein	NA	NA	NA	NA	NA
WP_060677419.1|1547169_1548594_+	amino acid permease	NA	NA	NA	NA	NA
WP_060677420.1|1548855_1550895_+	KUP/HAK/KT family potassium transporter	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	33.5	1.0e-62
WP_010011610.1|1550880_1551759_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	2.0e-42
WP_003688751.1|1551782_1552070_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_060677421.1|1552292_1553237_-	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_060677422.1|1553565_1554612_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_011373852.1|1554981_1555902_+|transposase	IS30-like element ISLsa1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.2	9.2e-51
>prophage 9
NZ_CP012650	Lactiplantibacillus plantarum strain HFC8 isolate Lactobacillus plantarum chromosome, complete genome	3067675	1753218	1780266	3067675	transposase,protease	Staphylococcus_prophage(20.0%)	25	NA	NA
WP_011373852.1|1753218_1754139_-|transposase	IS30-like element ISLsa1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.2	9.2e-51
WP_060677472.1|1754890_1755580_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_003646217.1|1755718_1756924_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003642922.1|1757391_1757763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060677936.1|1757958_1758465_-	folate family ECF transporter S component	NA	NA	NA	NA	NA
WP_060677473.1|1758489_1759410_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	31.0	1.3e-23
WP_003643582.1|1759892_1760138_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_060677474.1|1760483_1761938_+	catalase	NA	A0A2K9L572	Tupanvirus	45.9	3.3e-103
WP_003642927.1|1762095_1762533_-	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_046040953.1|1762888_1763632_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_060677165.1|1764313_1765489_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_003643585.1|1766256_1766385_-	cyclic lactone autoinducer peptide	NA	NA	NA	NA	NA
WP_003642930.1|1766365_1766962_-	accessory gene regulator AgrB	NA	NA	NA	NA	NA
WP_003642931.1|1767329_1769444_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	38.7	3.1e-118
WP_003642932.1|1769834_1770068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015826155.1|1770704_1771805_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_080339122.1|1771831_1773586_-	pyruvate oxidase	NA	NA	NA	NA	NA
WP_003642935.1|1773667_1774093_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_060677475.1|1774265_1776077_-	pyruvate oxidase	NA	NA	NA	NA	NA
WP_003641596.1|1776447_1776825_-	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_060677476.1|1776852_1777872_-	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_003641598.1|1777895_1778447_-	PTS glucitol/sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_003641599.1|1778451_1778958_-	transcriptional regulator GutM	NA	NA	NA	NA	NA
WP_010011610.1|1779076_1779955_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	2.0e-42
WP_003688751.1|1779978_1780266_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP012650	Lactiplantibacillus plantarum strain HFC8 isolate Lactobacillus plantarum chromosome, complete genome	3067675	2100970	2155393	3067675	transposase,protease	Staphylococcus_phage(20.0%)	57	NA	NA
WP_046038032.1|2100970_2101732_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_021356930.1|2101827_2102547_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_060677586.1|2102668_2103472_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A2K9V574	Lactobacillus_phage	50.8	1.6e-14
WP_012490951.1|2104566_2105565_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	2.5e-49
WP_060677587.1|2105645_2106287_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_060677588.1|2106691_2107069_-	glycine cleavage system protein H	NA	NA	NA	NA	NA
WP_003643727.1|2107075_2107993_-	sce7725 family protein	NA	NA	NA	NA	NA
WP_003641880.1|2107989_2108706_-	hypothetical protein	NA	A0A1I9S5V4	Bacillus_phage	37.1	1.9e-19
WP_060677589.1|2108705_2111075_-	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
WP_015825092.1|2111484_2111847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060677590.1|2112035_2113232_+	acetate kinase	NA	NA	NA	NA	NA
WP_011100961.1|2113358_2113802_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_060677591.1|2113875_2114298_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_060677592.1|2114486_2115689_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_027821528.1|2115820_2116153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641891.1|2116252_2117323_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_060677593.1|2117319_2118135_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_060677594.1|2118134_2118968_-	ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	22.5	3.8e-11
WP_003641894.1|2118979_2120077_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	41.6	1.5e-36
WP_003646424.1|2120147_2120690_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_060677595.1|2120756_2120978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641896.1|2121073_2121541_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_060677596.1|2121727_2122213_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_060677597.1|2122216_2122744_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003641899.1|2122837_2123023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060677598.1|2123283_2123637_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060677599.1|2123636_2124530_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_060677600.1|2124542_2125556_+	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_003641903.1|2125661_2127029_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003641904.1|2127454_2128318_+	class II fructose-1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_080339024.1|2128603_2128798_+	helix-turn-helix transcriptional regulator	NA	A0A142LP09	Marinitoga_camini_virus	46.6	5.9e-08
WP_143142903.1|2128874_2129126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060677601.1|2129280_2130597_-	MFS transporter	NA	NA	NA	NA	NA
WP_003643746.1|2130766_2131669_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_003641907.1|2131681_2131882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060677603.1|2132465_2133854_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003641910.1|2133919_2134165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643749.1|2134293_2134857_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_046038068.1|2134894_2135866_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_046038069.1|2135854_2136130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160316026.1|2136304_2136463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046038071.1|2136579_2137419_+	methionine ABC transporter ATPase	NA	NA	NA	NA	NA
WP_046038074.1|2137431_2138460_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.5	1.9e-28
WP_003643753.1|2138452_2139115_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_046038077.1|2139135_2140119_+	ketopantoate reductase family protein	NA	NA	NA	NA	NA
WP_046038079.1|2140121_2141297_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_060677604.1|2141566_2143219_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	41.5	2.7e-93
WP_046038081.1|2143236_2144403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641920.1|2144987_2145803_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003641921.1|2145815_2146907_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.7	7.2e-18
WP_060677325.1|2147353_2148529_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_060677605.1|2149143_2149686_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_046038088.1|2149682_2151128_+	MFS transporter	NA	NA	NA	NA	NA
WP_046038090.1|2151455_2152772_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	29.6	8.6e-34
WP_024002427.1|2153267_2154227_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_003641927.1|2154329_2154599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060677606.1|2154829_2155393_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
>prophage 11
NZ_CP012650	Lactiplantibacillus plantarum strain HFC8 isolate Lactobacillus plantarum chromosome, complete genome	3067675	2194983	2259859	3067675	tRNA,transposase,protease	Staphylococcus_prophage(22.22%)	59	NA	NA
WP_011373852.1|2194983_2195904_-|transposase	IS30-like element ISLsa1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.2	9.2e-51
WP_060677625.1|2197185_2197875_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_060677626.1|2197942_2198611_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_060677627.1|2198697_2199378_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_046038202.1|2200295_2200499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060677628.1|2200593_2202903_-	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_046038207.1|2203161_2203938_+	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_003643815.1|2204371_2205388_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003641997.1|2205794_2206505_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060677629.1|2206577_2207939_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003641999.1|2207945_2208134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642000.1|2208123_2208546_+	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_003643816.1|2208768_2210124_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_046038215.1|2210141_2211578_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.5	5.7e-31
WP_003642003.1|2211698_2212595_+	ROK family protein	NA	NA	NA	NA	NA
WP_003642004.1|2212744_2213491_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060677630.1|2213603_2214617_+|tRNA	tRNA-dihydrouridine synthase family protein	tRNA	NA	NA	NA	NA
WP_003642008.1|2215058_2215976_+	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_060677631.1|2216021_2217296_+	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_003642010.1|2217288_2218248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060677632.1|2218269_2218974_+	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
WP_003642012.1|2218973_2219816_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_015825136.1|2220412_2220802_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_060677633.1|2221123_2223175_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	35.8	2.7e-90
WP_046038231.1|2223661_2224036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060677634.1|2224316_2225501_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_043992601.1|2225534_2226425_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_046038237.1|2226987_2227476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643825.1|2227722_2228499_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_011101014.1|2228485_2229049_+	ribonuclease M5	NA	NA	NA	NA	NA
WP_003642019.1|2229045_2229936_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003642020.1|2230040_2230292_+	Veg family protein	NA	NA	NA	NA	NA
WP_003643828.1|2230424_2231291_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_060677635.1|2232014_2232713_+	ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	27.8	1.2e-15
WP_003646500.1|2232705_2233503_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_060677636.1|2233859_2234696_+	pur operon repressor	NA	NA	NA	NA	NA
WP_003642031.1|2234764_2236147_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L140	Tupanvirus	33.2	5.7e-28
WP_060677637.1|2236382_2237207_+	serine hydrolase	NA	NA	NA	NA	NA
WP_060677638.1|2237572_2238553_+	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	34.2	1.9e-41
WP_003646506.1|2238841_2239864_+	YdcF family protein	NA	NA	NA	NA	NA
WP_003643831.1|2239946_2240933_+	lipoprotein	NA	NA	NA	NA	NA
WP_015379810.1|2241102_2241912_-	sugar-phosphatase	NA	NA	NA	NA	NA
WP_187329206.1|2241931_2243290_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	33.3	8.1e-27
WP_046038265.1|2243298_2244231_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_003642040.1|2244591_2245032_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_003642041.1|2245076_2245685_+	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_003642042.1|2245857_2247471_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	1.2e-143
WP_060677640.1|2247658_2248579_-|transposase	IS30-like element ISLsa1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.2	1.2e-50
WP_060677642.1|2249365_2250019_+	L-serine ammonia-lyase, iron-sulfur-dependent, subunit beta	NA	NA	NA	NA	NA
WP_060677643.1|2250037_2250937_+	L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	NA	NA	NA	NA	NA
WP_003643839.1|2251087_2251816_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_003643840.1|2252397_2252592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060677644.1|2253132_2254413_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_003642051.1|2254442_2255735_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_003637671.1|2255861_2256107_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_060677645.1|2256239_2257376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642053.1|2257574_2258279_+	class A sortase	NA	NA	NA	NA	NA
WP_003642054.1|2258387_2258948_+	LemA family protein	NA	NA	NA	NA	NA
WP_060677646.1|2258959_2259859_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
>prophage 12
NZ_CP012650	Lactiplantibacillus plantarum strain HFC8 isolate Lactobacillus plantarum chromosome, complete genome	3067675	2384170	2392794	3067675		Streptococcus_phage(66.67%)	11	NA	NA
WP_003644909.1|2384170_2385868_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.0	3.9e-55
WP_003640956.1|2385889_2386198_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_003637790.1|2386213_2386813_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_003640957.1|2386827_2387079_+	YaaL family protein	NA	NA	NA	NA	NA
WP_016510978.1|2387476_2388142_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.7	1.4e-53
WP_003640965.1|2388138_2388468_+	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_003640966.1|2388484_2389504_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	33.5	2.1e-32
WP_003640967.1|2389528_2389876_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	33.3	2.4e-12
WP_060677678.1|2389974_2390871_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	55.3	3.7e-81
WP_003640969.1|2390874_2391660_+	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_016510980.1|2391798_2392794_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	37.9	1.0e-50
>prophage 13
NZ_CP012650	Lactiplantibacillus plantarum strain HFC8 isolate Lactobacillus plantarum chromosome, complete genome	3067675	2520770	2573705	3067675	transposase	Bacillus_phage(27.27%)	49	NA	NA
WP_003592463.1|2520770_2521700_-|transposase	IS30-like element ISLpl1 family transposase	transposase	NA	NA	NA	NA
WP_060677711.1|2521936_2523370_-	MFS transporter	NA	NA	NA	NA	NA
WP_060677712.1|2523539_2524493_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_003641095.1|2524495_2526652_-	RNA degradosome polyphosphate kinase	NA	NA	NA	NA	NA
WP_003641096.1|2526652_2528182_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_003645798.1|2528506_2529316_-	LicD family protein	NA	A0A1V0SD50	Indivirus	32.4	7.2e-07
WP_060677946.1|2529484_2529958_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003641099.1|2530172_2530334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003644001.1|2530613_2531921_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	30.5	3.7e-45
WP_060677713.1|2532538_2534278_+	pyruvate oxidase	NA	NA	NA	NA	NA
WP_003644002.1|2534418_2535267_+	FAD synthetase family protein	NA	NA	NA	NA	NA
WP_060677714.1|2535598_2537359_+	pyruvate oxidase	NA	NA	NA	NA	NA
WP_060677947.1|2537480_2538389_-	proline-specific peptidase family protein	NA	NA	NA	NA	NA
WP_060677948.1|2538843_2539833_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_003644006.1|2540254_2542237_+	acetyltransferase	NA	W6MVL2	Pseudomonas_phage	29.1	3.3e-29
WP_060677715.1|2542401_2544843_-	Xaa-Pro dipeptidyl-peptidase	NA	NA	NA	NA	NA
WP_060677716.1|2544962_2545382_+	OsmC family protein	NA	NA	NA	NA	NA
WP_003645790.1|2545499_2545802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003644008.1|2545952_2547350_-	amino acid permease	NA	NA	NA	NA	NA
WP_003641111.1|2547855_2548329_+	alcohol dehydrogenase	NA	A0A218KDM1	Bacillus_phage	51.7	2.4e-10
WP_060677717.1|2548692_2549511_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003644009.1|2549564_2549984_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_003641114.1|2550060_2550210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060677718.1|2550360_2550942_+	guanylate kinase	NA	A0A218KC48	Bacillus_phage	27.9	5.0e-10
WP_003641116.1|2551052_2551496_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_060677719.1|2551637_2552147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641118.1|2552150_2552969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060677720.1|2553161_2553788_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_080339030.1|2554193_2555384_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_046038502.1|2555386_2556379_+	D-2-hydroxyacid dehydrogenase	NA	M1HI29	Paramecium_bursaria_Chlorella_virus	34.3	2.9e-42
WP_003641122.1|2556612_2556864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015379917.1|2556921_2557077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_181814074.1|2557399_2558134_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	40.0	2.5e-35
WP_003641126.1|2558154_2558991_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003644017.1|2558990_2559632_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003641128.1|2559648_2560302_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_016511843.1|2560502_2561423_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	31.0	1.6e-23
WP_060677722.1|2561491_2562370_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_003644023.1|2562643_2563084_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046038513.1|2563354_2564686_+	amino acid permease	NA	NA	NA	NA	NA
WP_003688751.1|2565363_2565651_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010011610.1|2565674_2566553_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	2.0e-42
WP_060677723.1|2566907_2568359_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_003644019.1|2568386_2569229_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_060677724.1|2569254_2569746_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_016511843.1|2569929_2570850_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	31.0	1.6e-23
WP_060677725.1|2571024_2571477_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003645778.1|2571476_2572631_+	MFS transporter	NA	NA	NA	NA	NA
WP_016511843.1|2572784_2573705_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	31.0	1.6e-23
>prophage 14
NZ_CP012650	Lactiplantibacillus plantarum strain HFC8 isolate Lactobacillus plantarum chromosome, complete genome	3067675	2594786	2637982	3067675	tRNA,transposase,protease,integrase	Staphylococcus_prophage(25.0%)	36	2602177:2602236	2630389:2631423
WP_060677732.1|2594786_2595707_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	31.0	1.6e-23
WP_060677733.1|2595774_2596167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046040560.1|2596409_2597108_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003645769.1|2597327_2597672_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_060677734.1|2597803_2599102_-	MFS transporter	NA	NA	NA	NA	NA
WP_060677735.1|2599375_2601880_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
2602177:2602236	attL	TGGCAAATTCTATAATTAATCCGAACAGAAATTAAAAAGCCCAAAGCAATCACTTACAAT	NA	NA	NA	NA
WP_011373852.1|2602275_2603196_+|transposase	IS30-like element ISLsa1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.2	9.2e-51
WP_011101208.1|2603401_2603785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060677736.1|2603774_2605622_+	acetyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	23.3	5.8e-20
WP_003641172.1|2605862_2606117_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_003641173.1|2606128_2606674_+	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_003641174.1|2606686_2606869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003644046.1|2606883_2607306_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_003641176.1|2607366_2607807_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_060677737.1|2608010_2608811_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_046038581.1|2608941_2609952_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_060677738.1|2610313_2610646_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_060677739.1|2611504_2614039_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	27.4	1.6e-68
WP_080376267.1|2614266_2617140_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_060677741.1|2617282_2618212_-|transposase	IS30-like element ISLpl1 family transposase	transposase	NA	NA	NA	NA
WP_060677742.1|2619783_2620329_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_060677743.1|2620422_2621352_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_080376302.1|2621387_2621984_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_060677745.1|2622135_2623053_+|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	44.3	1.0e-73
WP_080376269.1|2623063_2623624_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_160316028.1|2623748_2624222_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_060677746.1|2624525_2625056_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_003645748.1|2628746_2628866_+	putative metal homeostasis protein	NA	NA	NA	NA	NA
WP_046038598.1|2628953_2629448_+	kinase	NA	NA	NA	NA	NA
WP_046038599.1|2629516_2630269_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011373852.1|2630487_2631408_+|transposase	IS30-like element ISLsa1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.2	9.2e-51
WP_060677747.1|2631417_2631957_+	helix-turn-helix domain-containing protein	NA	X2CXD8	Lactobacillus_phage	48.3	1.2e-05
2630389:2631423	attR	TGGCAAATTCTATAATTAATCCGAACAGAAATTAAAAAGCCCAAAGCAATCACTTACAATGGTAGTAGCTAATTCCAACCAATATAGGGAGTGATTACTTTGGGTACATCTACTTTATCACGTTTTCAACGTGGCGCACTAGCACAACTGGTCAATGAGGGGAATAAATCTTACCAAGTAATGGCTGACGCCTTAGGCGTCGCCAAAGCTACGATTAGCTATGAGTTGGACCGGGTTAAACCTTATGATCCAGAATTAGCTCAGCAAGATGCAGATCGCAAAAGGCGGAATTGCGGTCGTCGTTCGATGCTGACGGCAGCATTAGCGACTTTAATTACCAATCACTTACGATTAACCTGGTCACCAGAAACCATTGCGGCCGCTTATAACTTGAGCACTGCGTCAATTTATAATTGGCTTAATCGTGGCTGGCTCCCCTTCAAATTGACTGATCTACCCAATCGGAATGTCCGCCAGCACCGAGTGAGCGAAAATCGTGGGAAATTTACAAGTGGGACCTCCATCGAACAACGGCCAACAACTGTTAATCAACGGTTAGCTTTTGGTCATTGGGAAGTAGATACGGTGCTTTCTAGTCGAAGTGAGTCACGATCATGTCTGGTTACATTCGTAGAACGTAAGACCCGACTTCTATGGGCCATCAAAGCCCCTAATAGAACGGCTAAGGCTCTAAACACCGCCTTTGGCAAGTTTATGGGGGCCTTCGGTCCCCAAGTAAAATCCATTACTGTTGATCATGGTAAAGAGTTTGCCAATTATCAGGCCTTAGAACAGGATTATCAGATCAAAGTTTATTTTTGCCATCCATATTCACCATGGGAGCGAGGTTCCAATGAATATTTTAATAGACGGTTACGCTGGTTCTTCCCGAAAAAGACCAATTTTAGCCAAGTAACGACTGATGAGATCCTAGCAGCACTTGAACTAATTAATCAACGACCATTAAAAATACATCATCAACAGACTGCCATTGAAAGATTCCGGGCTTGTTCGGATTAAACTTGTAATTTGCCT	NA	NA	NA	NA
WP_046038600.1|2632027_2632954_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003641193.1|2635304_2635778_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060677748.1|2635886_2636516_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_060677749.1|2636686_2637982_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	31.0	1.2e-56
>prophage 15
NZ_CP012650	Lactiplantibacillus plantarum strain HFC8 isolate Lactobacillus plantarum chromosome, complete genome	3067675	2792293	2829537	3067675	transposase,tRNA	Bacillus_phage(18.18%)	33	NA	NA
WP_003641341.1|2792293_2792614_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_060677790.1|2792613_2794077_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_060677791.1|2794076_2795501_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_003641344.1|2795605_2796628_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	26.5	2.6e-17
WP_011101269.1|2796961_2798335_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	50.0	3.2e-124
WP_003641346.1|2798788_2799367_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011373852.1|2799499_2800420_-|transposase	IS30-like element ISLsa1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.2	9.2e-51
WP_060677792.1|2800670_2803010_+	cation-translocating P-type ATPase	NA	M1HI01	Paramecium_bursaria_Chlorella_virus	24.8	2.1e-38
WP_060677793.1|2803259_2804576_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_060677794.1|2804568_2805453_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003644133.1|2805577_2806456_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003641351.1|2806480_2807257_+	lysozyme	NA	A0A141HSE6	Bacillus_phage	31.1	2.6e-06
WP_060677795.1|2807288_2808977_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	41.5	3.6e-93
WP_003641352.1|2809176_2809542_-	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
WP_003638174.1|2809885_2810086_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.4	3.1e-20
WP_045352531.1|2810272_2811280_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_003643301.1|2812908_2813349_-	universal stress protein	NA	NA	NA	NA	NA
WP_060677796.1|2813482_2814796_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_016511261.1|2814788_2815655_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016511262.1|2815804_2816005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003643305.1|2816204_2816645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003646269.1|2817077_2817641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187329197.1|2817724_2819080_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_060677798.1|2819338_2820466_+	serine hydrolase	NA	NA	NA	NA	NA
WP_003646267.1|2820702_2821821_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	31.2	2.7e-20
WP_060677799.1|2822179_2823109_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_003643315.1|2823298_2824015_+	aquaporin family protein	NA	A0A1J0F964	Only_Syngen_Nebraska_virus	32.7	5.6e-19
WP_060677801.1|2825010_2825706_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_003688751.1|2825753_2826041_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_060677802.1|2826064_2826943_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	4.4e-42
WP_060677803.1|2826995_2827538_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_060677389.1|2828205_2829126_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	30.7	3.7e-23
WP_080376275.1|2829327_2829537_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP012650	Lactiplantibacillus plantarum strain HFC8 isolate Lactobacillus plantarum chromosome, complete genome	3067675	2950225	3061944	3067675	tRNA,terminase,capsid,head,holin,portal,tail,protease,transposase,integrase	Lactobacillus_phage(77.05%)	109	2954971:2954989	2998645:2998663
WP_015473476.1|2950225_2951155_+|transposase	IS30-like element ISLpl1 family transposase	transposase	NA	NA	NA	NA
WP_060677844.1|2951212_2951725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003643147.1|2951839_2952127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060677845.1|2952191_2954459_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	31.4	2.0e-118
2954971:2954989	attL	CTAATTATGCCCCAGGCAG	NA	NA	NA	NA
WP_060677846.1|2955105_2956242_-|integrase	site-specific integrase	integrase	E9LUS1	Lactobacillus_phage	97.4	2.7e-209
WP_144425354.1|2956645_2957140_-	hypothetical protein	NA	U5U717	Lactobacillus_phage	41.7	1.8e-24
WP_056988408.1|2957163_2957394_+	hypothetical protein	NA	U5U783	Lactobacillus_phage	47.5	5.4e-08
WP_060677849.1|2957465_2957780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060677850.1|2957943_2958258_-	hypothetical protein	NA	E9LUS3	Lactobacillus_phage	98.1	2.3e-49
WP_060677851.1|2958250_2958664_-	hypothetical protein	NA	E9LUS4	Lactobacillus_phage	98.5	5.6e-72
WP_063489717.1|2958787_2959453_-	LexA family transcriptional regulator	NA	D7RWF2	Brochothrix_phage	48.2	9.3e-53
WP_045351970.1|2959608_2959833_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_060677852.1|2959847_2960618_+	phage antirepressor KilAC domain-containing protein	NA	E9LUT0	Lactobacillus_phage	96.5	2.2e-58
WP_060677853.1|2960755_2961040_-	hypothetical protein	NA	A0A2H4JEH2	uncultured_Caudovirales_phage	54.9	3.9e-24
WP_060677854.1|2961783_2962113_+	DUF771 domain-containing protein	NA	E9LUT3	Lactobacillus_phage	80.7	2.9e-47
WP_060677855.1|2962201_2962441_+	hypothetical protein	NA	E9LUT6	Lactobacillus_phage	84.7	5.3e-35
WP_187329198.1|2962452_2962617_+	hypothetical protein	NA	E9LUT8	Lactobacillus_phage	75.0	3.6e-14
WP_167803054.1|2962619_2962790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060677856.1|2962790_2963096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003638309.1|2963115_2963808_+	hypothetical protein	NA	E9LUU3	Lactobacillus_phage	89.1	5.0e-118
WP_060677857.1|2963857_2964664_+	hypothetical protein	NA	A0A0S2MYA8	Enterococcus_phage	37.9	8.4e-48
WP_044431016.1|2964663_2965449_+	ATP-binding protein	NA	E9LUN6	Lactobacillus_phage	91.6	1.4e-132
WP_160316029.1|2965683_2966331_+	hypothetical protein	NA	B3FK10	Pseudomonas_phage	37.4	1.2e-17
WP_060677859.1|2966478_2966787_+	hypothetical protein	NA	E9LUN7	Lactobacillus_phage	91.2	2.7e-47
WP_144425355.1|2966779_2966929_+	hypothetical protein	NA	A0A2P0ZLB5	Lactobacillus_phage	84.8	3.9e-12
WP_144425356.1|2966932_2967253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080376283.1|2967313_2968432_+	DNA cytosine methyltransferase	NA	A0A1I9KKE7	Lactobacillus_phage	63.3	1.2e-129
WP_060677861.1|2968492_2968870_+	hypothetical protein	NA	A0A2P0ZKS9	Lactobacillus_phage	35.0	1.1e-10
WP_033609727.1|2969161_2969632_+	hypothetical protein	NA	B4XYT9	Lactobacillus_phage	40.0	1.9e-15
WP_060677862.1|2970225_2970498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144425357.1|2970920_2971103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060677865.1|2971086_2971233_+	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	76.8	8.3e-15
WP_187329208.1|2971243_2971723_+	HNH endonuclease	NA	E9LUP7	Lactobacillus_phage	91.7	3.4e-81
WP_060677954.1|2971869_2972121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060677867.1|2972310_2972769_+|terminase	phage terminase small subunit P27 family	terminase	E9LUP8	Lactobacillus_phage	97.4	6.1e-80
WP_060677868.1|2972771_2974670_+|terminase	terminase large subunit	terminase	E9LUP9	Lactobacillus_phage	96.0	0.0e+00
WP_060677869.1|2974659_2974854_+	DUF1056 family protein	NA	E9LUQ0	Lactobacillus_phage	95.3	2.2e-26
WP_060677870.1|2974856_2976050_+|portal	phage portal protein	portal	E9LUQ1	Lactobacillus_phage	98.5	5.8e-223
WP_060677871.1|2976027_2976786_+|protease	Clp protease ClpP	protease	E9LUQ2	Lactobacillus_phage	91.3	2.4e-121
WP_060677872.1|2976785_2978006_+|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	90.1	1.1e-203
WP_060677873.1|2978078_2978411_+|head,tail	phage gp6-like head-tail connector protein	head,tail	E9LUQ4	Lactobacillus_phage	84.5	6.1e-45
WP_060677874.1|2978400_2978748_+|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	72.8	2.7e-43
WP_060677875.1|2978750_2979158_+	HK97 gp10 family phage protein	NA	A0A2P0ZLE6	Lactobacillus_phage	91.7	5.0e-65
WP_060677876.1|2979157_2979538_+	DUF806 family protein	NA	A0A2P0ZLF4	Lactobacillus_phage	87.3	1.8e-56
WP_060677877.1|2979551_2980208_+|tail	phage tail protein	tail	A0A2P0ZLH1	Lactobacillus_phage	88.9	1.1e-101
WP_060677878.1|2980283_2980658_+|tail	phage tail assembly chaperone	tail	A0A2P0ZLH4	Lactobacillus_phage	95.2	9.2e-58
WP_015640500.1|2980702_2980888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060677879.1|2980919_2985629_+	C40 family peptidase	NA	A0A2P0ZLG0	Lactobacillus_phage	73.9	0.0e+00
WP_060677880.1|2985705_2987475_+|tail	phage tail family protein	tail	E9LUR2	Lactobacillus_phage	88.2	0.0e+00
WP_060677881.1|2987540_2989898_+|tail	phage tail protein	tail	E9LUR3	Lactobacillus_phage	92.5	0.0e+00
WP_060677883.1|2994643_2994886_+	hypothetical protein	NA	A0A1S5RCP9	Lactobacillus_phage	85.0	2.8e-31
WP_187329199.1|2994900_2995062_+	hypothetical protein	NA	A0A2P0ZLG1	Lactobacillus_phage	96.2	2.1e-19
WP_060677884.1|2995045_2996041_+	hypothetical protein	NA	A0A2P0ZLF6	Lactobacillus_phage	85.0	1.4e-60
WP_060677885.1|2996037_2996250_+	hypothetical protein	NA	A0A0A1ENR9	Lactobacillus_phage	85.2	9.6e-20
WP_060677886.1|2996261_2997419_+	LysM peptidoglycan-binding domain-containing protein	NA	E9LUR8	Lactobacillus_phage	86.4	3.7e-190
WP_015825361.1|2997418_2997682_+	hemolysin XhlA family protein	NA	E9LUR9	Lactobacillus_phage	98.9	7.4e-38
WP_060677887.1|2997693_2998074_+|holin	holin	holin	A0A2H4PBB2	Lactobacillus_phage	83.3	6.3e-14
WP_011101374.1|2998983_2999409_-	lipoprotein	NA	NA	NA	NA	NA
2998645:2998663	attR	CTAATTATGCCCCAGGCAG	NA	NA	NA	NA
WP_060677888.1|2999573_3000587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060677889.1|3000692_3001214_+	GtrA family protein	NA	NA	NA	NA	NA
WP_080376285.1|3001313_3001673_-	YisL family protein	NA	NA	NA	NA	NA
WP_011101376.1|3001745_3003602_-	bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_060677891.1|3003615_3005922_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_060677892.1|3006810_3008448_+	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_060677893.1|3008425_3009601_+	sulfate adenylyltransferase	NA	A0A2P1ELS9	Moumouvirus	31.7	5.0e-49
WP_003645243.1|3009603_3010227_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	40.6	4.8e-27
WP_060677894.1|3010216_3011173_+	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_060677895.1|3011394_3013134_+	aryl-sulfate sulfotransferase	NA	NA	NA	NA	NA
WP_060677896.1|3013642_3015418_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_003643131.1|3015692_3017084_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_003643130.1|3017210_3017456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060677897.1|3017844_3018291_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003643128.1|3018562_3020251_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.9	1.2e-75
WP_003643127.1|3020456_3020933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060677898.1|3021202_3023197_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	40.2	3.1e-35
WP_003643125.1|3023880_3024537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060677899.1|3024671_3027227_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_003643123.1|3027439_3027910_-	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_003643122.1|3028068_3028407_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_060677900.1|3028403_3028703_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_060677901.1|3028736_3030065_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_060677902.1|3030067_3031540_+	family 1 glycosylhydrolase	NA	NA	NA	NA	NA
WP_033608579.1|3031551_3032736_-	MFS transporter	NA	NA	NA	NA	NA
WP_011101393.1|3032735_3033347_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_003644263.1|3033617_3033860_-	D-alanine--poly(phosphoribitol) ligase subunit DltC	NA	NA	NA	NA	NA
WP_060677903.1|3033962_3035414_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_060677904.1|3035648_3036257_+	LysE family transporter	NA	NA	NA	NA	NA
WP_013355465.1|3036322_3037444_+	aminotransferase	NA	NA	NA	NA	NA
WP_011373852.1|3037544_3038465_+|transposase	IS30-like element ISLsa1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.2	9.2e-51
WP_060677905.1|3038657_3039119_+	arginine repressor	NA	NA	NA	NA	NA
WP_060677906.1|3039612_3041742_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_003643106.1|3041832_3042177_+	YlbF family regulator	NA	NA	NA	NA	NA
WP_060677907.1|3042246_3043467_+	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_060677908.1|3043453_3045934_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_060677909.1|3045944_3046925_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_060677910.1|3047080_3048001_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	30.7	4.8e-23
WP_003644269.1|3048282_3049521_+	hypothetical protein	NA	A0A2P0ZL72	Lactobacillus_phage	99.7	5.7e-221
WP_060677911.1|3049611_3050583_-	peptidase S41	NA	A0A2P0ZL68	Lactobacillus_phage	97.5	6.5e-180
WP_003643099.1|3050768_3051716_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	100.0	2.7e-178
WP_003643097.1|3052059_3052674_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	100.0	6.3e-112
WP_060677912.1|3052676_3055115_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	99.8	0.0e+00
WP_021356349.1|3055202_3055763_+	hypothetical protein	NA	A0A2P0ZL75	Lactobacillus_phage	99.5	1.0e-100
WP_060677913.1|3055833_3056274_-	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	95.2	9.8e-75
WP_022638020.1|3056369_3056507_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_060677914.1|3056664_3058032_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	31.4	2.6e-25
WP_144425333.1|3058261_3059061_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_060676905.1|3059090_3059600_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.0	5.7e-18
WP_013355473.1|3060309_3060975_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_021356804.1|3060999_3061944_+	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	45.8	6.7e-73
>prophage 1
NZ_CP012657	Lactiplantibacillus plantarum strain HFC8 isolate Lactobacillus plantarum plasmid pMK01, complete sequence	84759	0	52458	84759	holin,protease,transposase	Streptococcus_phage(25.0%)	50	NA	NA
WP_060678033.1|647_1001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046038930.1|1800_3192_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_046041507.1|4581_5946_-	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	22.9	5.3e-10
WP_035454452.1|6077_6464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046041504.1|7123_7378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052697228.1|7499_7781_+	BRCT domain-containing protein	NA	NA	NA	NA	NA
WP_060678035.1|7963_10678_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_016526621.1|10804_11023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080339152.1|11023_12835_+	LtrC	NA	NA	NA	NA	NA
WP_027822898.1|12901_13225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046041500.1|13297_13696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046041498.1|13688_14009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060678036.1|14001_15303_-	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	39.7	8.4e-82
WP_027822894.1|15416_15728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016526748.1|15997_16267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046041494.1|16253_17156_-	AAA family ATPase	NA	F0PIG8	Enterococcus_phage	32.1	4.1e-27
WP_060678037.1|17997_19536_+	primase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_060678038.1|19845_22482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060678039.1|22753_23137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060678040.1|23108_23768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060678041.1|23783_25736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046041473.1|25738_25945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046041471.1|25945_27109_+	CHAP domain-containing protein	NA	A0A0A0RSI6	Bacillus_phage	34.8	1.7e-09
WP_046041470.1|27121_27751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060678042.1|28568_29531_+	hypothetical protein	NA	A0A2H4JAH5	uncultured_Caudovirales_phage	49.2	1.4e-36
WP_060678043.1|29527_29743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016526759.1|29744_29963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046041464.1|29959_30259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060678044.1|30255_30681_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_080376324.1|30699_31608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016526763.1|31893_32190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016526764.1|32191_32692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056988523.1|32709_33177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060678046.1|33148_35338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060678047.1|35339_35975_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_006293514.1|36255_36360_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_060678048.1|36800_36938_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_060678049.1|37469_39632_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	47.3	1.5e-104
WP_060678050.1|39789_40056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060678051.1|40086_40725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060678052.1|40800_41766_+	DUF3991 and TOPRIM domain-containing protein	NA	NA	NA	NA	NA
WP_060678053.1|41762_41957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060678054.1|41959_42592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060678055.1|42594_44379_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2C9CXH0	Yersinia_phage	35.7	2.0e-81
WP_016526775.1|44445_44760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060678056.1|44855_46976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060678057.1|46985_47774_+	class A sortase	NA	NA	NA	NA	NA
WP_060678058.1|47802_50742_+	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_046041437.1|50818_51115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003645717.1|51615_52458_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.6	1.7e-155
>prophage 2
NZ_CP012657	Lactiplantibacillus plantarum strain HFC8 isolate Lactobacillus plantarum plasmid pMK01, complete sequence	84759	58416	63557	84759	transposase	Escherichia_phage(40.0%)	6	NA	NA
WP_060678065.1|58416_59286_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	60.5	1.0e-99
WP_060678066.1|59289_59871_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	45.3	1.3e-37
WP_027822971.1|59880_60909_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	45.1	4.0e-71
WP_060678067.1|60941_61778_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.4	4.6e-33
WP_060678068.1|61793_62459_+	sugar transferase	NA	NA	NA	NA	NA
WP_080376325.1|62636_63557_+|transposase	IS30-like element ISLsa1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.6	8.4e-52
>prophage 3
NZ_CP012657	Lactiplantibacillus plantarum strain HFC8 isolate Lactobacillus plantarum plasmid pMK01, complete sequence	84759	67550	68480	84759	transposase	unidentified_phage(100.0%)	1	NA	NA
WP_003561810.1|67550_68480_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW47	unidentified_phage	34.4	3.0e-25
>prophage 4
NZ_CP012657	Lactiplantibacillus plantarum strain HFC8 isolate Lactobacillus plantarum plasmid pMK01, complete sequence	84759	71684	76919	84759		Indivirus(66.67%)	5	NA	NA
WP_060678077.1|71684_72617_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SKV4	Klosneuvirus	29.6	4.0e-25
WP_060678078.1|72613_73762_+	glycoside hydrolase family 99-like domain-containing protein	NA	A0A1V0SDW6	Indivirus	27.0	7.3e-29
WP_060678079.1|73758_75009_+	oligosaccharide repeat unit polymerase	NA	NA	NA	NA	NA
WP_144425367.1|74981_75932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060678081.1|75932_76919_+	glycosyltransferase family 92 protein	NA	A0A1V0SD50	Indivirus	26.9	6.5e-18
>prophage 5
NZ_CP012657	Lactiplantibacillus plantarum strain HFC8 isolate Lactobacillus plantarum plasmid pMK01, complete sequence	84759	82370	83735	84759		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_046041507.1|82370_83735_-	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	22.9	5.3e-10
>prophage 1
NZ_CP012653	Lactiplantibacillus plantarum strain HFC8 isolate Lactobacillus plantarum plasmid pMK07, complete sequence	11851	1941	10728	11851	holin,integrase	Lactobacillus_phage(100.0%)	13	3280:3292	6741:6753
WP_060677999.1|1941_2229_+	hypothetical protein	NA	E9LUS4	Lactobacillus_phage	91.8	2.7e-33
WP_060677850.1|2346_2661_+	hypothetical protein	NA	E9LUS3	Lactobacillus_phage	98.1	2.3e-49
WP_060677849.1|2824_3139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056988408.1|3210_3441_-	hypothetical protein	NA	U5U783	Lactobacillus_phage	47.5	5.4e-08
3280:3292	attL	ATCGCCAATATCA	NA	NA	NA	NA
WP_144425354.1|3464_3959_+	hypothetical protein	NA	U5U717	Lactobacillus_phage	41.7	1.8e-24
WP_060677846.1|4362_5499_+|integrase	site-specific integrase	integrase	E9LUS1	Lactobacillus_phage	97.4	2.7e-209
WP_060677887.1|6204_6585_-|holin	holin	holin	A0A2H4PBB2	Lactobacillus_phage	83.3	6.3e-14
WP_015825361.1|6596_6860_-	hemolysin XhlA family protein	NA	E9LUR9	Lactobacillus_phage	98.9	7.4e-38
6741:6753	attR	ATCGCCAATATCA	NA	NA	NA	NA
WP_060677886.1|6859_8017_-	LysM peptidoglycan-binding domain-containing protein	NA	E9LUR8	Lactobacillus_phage	86.4	3.7e-190
WP_060677885.1|8028_8241_-	hypothetical protein	NA	A0A0A1ENR9	Lactobacillus_phage	85.2	9.6e-20
WP_144425363.1|8357_8792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162490437.1|9233_9377_-	hypothetical protein	NA	E9LUR6	Lactobacillus_phage	95.6	1.1e-14
WP_160316031.1|10569_10728_-	hypothetical protein	NA	A0A2P0ZLG5	Lactobacillus_phage	74.3	4.0e-07
