The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009456	Yersinia enterocolitica strain FORC_002 chromosome, complete genome	4735534	1942734	2025804	4735534	portal,terminase,lysis,capsid,tRNA,tail,plate,transposase,integrase,head	Erwinia_phage(19.18%)	101	1975689:1975748	2025108:2025232
WP_071843381.1|1942734_1942950_-	DNA-binding transcriptional regulator	NA	A0A0F7LDQ9	Escherichia_phage	55.6	4.8e-19
WP_046695149.1|1943041_1944208_-	phage late control D family protein	NA	A0A218M4J7	Erwinia_phage	66.1	6.7e-139
WP_046695148.1|1944204_1944690_-|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	61.0	2.0e-49
WP_046695147.1|1944692_1947101_-|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	41.0	1.5e-132
WP_004875948.1|1947093_1947216_-|tail	GpE family phage tail protein	tail	Q858U8	Yersinia_virus	71.1	2.0e-09
WP_046695146.1|1947248_1947560_-|tail	phage tail assembly protein	tail	F1BUU0	Erwinia_phage	61.1	9.4e-24
WP_019079139.1|1947612_1948128_-|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	71.9	8.8e-67
WP_046695145.1|1948141_1949311_-|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	79.9	1.2e-183
WP_046695144.1|1949436_1949922_-|tail	phage tail protein	tail	F1BUP0	Erwinia_phage	43.7	9.5e-31
WP_046695143.1|1949925_1951089_-|tail	variable tail fiber protein	tail	A0A0M3ULH6	Salmonella_phage	55.2	1.6e-79
WP_046695142.1|1951085_1951694_-|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	79.1	4.6e-91
WP_046695141.1|1951686_1952595_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	79.5	2.1e-124
WP_046695140.1|1952599_1952950_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	67.2	1.2e-38
WP_046695139.1|1952946_1953588_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	64.5	8.6e-72
WP_046695138.1|1953671_1954403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046695137.1|1954465_1954915_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	65.1	2.1e-48
WP_046695136.1|1954911_1955367_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	62.0	2.9e-45
WP_046695135.1|1955462_1955879_-|lysis	LysB family phage lysis regulatory protein	lysis	F1BUQ1	Erwinia_phage	51.8	5.0e-28
WP_046695134.1|1955880_1956387_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	62.5	1.5e-55
WP_046695133.1|1956370_1956580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046695132.1|1956582_1956786_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	64.2	4.5e-19
WP_046695131.1|1956785_1957259_-|head	head completion/stabilization protein	head	M1SNN6	Escherichia_phage	57.4	1.7e-40
WP_046695130.1|1957358_1958018_-|terminase	terminase endonuclease subunit	terminase	F1BUQ7	Erwinia_phage	70.3	2.5e-82
WP_046695129.1|1958021_1959251_-|capsid	phage major capsid protein, P2 family	capsid	F1BUQ8	Erwinia_phage	73.5	8.9e-150
WP_046695128.1|1959327_1960182_-|capsid	GPO family capsid scaffolding protein	capsid	Q01088	Escherichia_phage	61.8	4.5e-92
WP_046695127.1|1960332_1962105_+|terminase	terminase ATPase subunit family protein	terminase	F1BUR2	Erwinia_phage	81.3	4.5e-288
WP_014609181.1|1962101_1963139_+|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	77.8	3.0e-159
WP_046695699.1|1963251_1963530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046695125.1|1963936_1964131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046695124.1|1964268_1964628_-	hypothetical protein	NA	H9C172	Pectobacterium_phage	43.4	1.4e-18
WP_046695123.1|1964647_1966927_-	replication endonuclease	NA	Q858T4	Yersinia_virus	57.1	4.5e-240
WP_020282762.1|1966923_1967187_-	DUF5405 family protein	NA	NA	NA	NA	NA
WP_046695122.1|1967197_1967503_-	DUF5405 family protein	NA	NA	NA	NA	NA
WP_046695121.1|1967502_1967775_-	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	45.8	2.0e-06
WP_046695120.1|1967840_1968152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005163725.1|1968163_1968349_-	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_046695119.1|1968358_1968868_-	hypothetical protein	NA	E5G6L3	Salmonella_phage	52.4	2.1e-44
WP_080343458.1|1968922_1969120_-	DNA-binding protein	NA	Q1I116	Pasteurella_virus	39.3	2.8e-05
WP_046695118.1|1969232_1969802_+	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	38.0	5.4e-25
WP_046695117.1|1970123_1971158_+|integrase	tyrosine-type recombinase/integrase	integrase	Q1I119	Pasteurella_virus	62.0	1.3e-117
WP_046695116.1|1971275_1972268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046695115.1|1972740_1974723_+	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_046695114.1|1974719_1975358_+	hypothetical protein	NA	NA	NA	NA	NA
1975689:1975748	attL	TTTTAAAATCCCTCGGCTTATGGCTGTGCGGGTTCAAGTCCCGCCCCGGGCACCATGGAA	NA	NA	NA	NA
WP_046695113.1|1975883_1976900_-|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	67.5	1.8e-135
WP_046051137.1|1976889_1977126_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	43.5	2.9e-09
WP_019082908.1|1977338_1977521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046051135.1|1977566_1978067_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	74.8	4.5e-60
WP_046695112.1|1978063_1980262_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	38.2	5.9e-128
WP_046051133.1|1980317_1980653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154235942.1|1980963_1981119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046052037.1|1981359_1982010_-	LexA family transcriptional regulator	NA	H9C160	Pectobacterium_phage	71.3	1.5e-87
WP_046051132.1|1982114_1982300_+	regulatory protein	NA	H9C161	Pectobacterium_phage	68.9	2.1e-18
WP_046051131.1|1982360_1982825_+|tRNA	tRNA-(guanine-N1)-methyltransferase	tRNA	H9C162	Pectobacterium_phage	56.1	1.8e-34
WP_046695111.1|1982841_1983066_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	66.2	9.8e-23
WP_046051129.1|1983068_1984043_+	helix-turn-helix domain-containing protein	NA	A0A1W6JP36	Morganella_phage	62.1	4.3e-38
WP_046695110.1|1984039_1985401_+	replicative DNA helicase	NA	K7P852	Enterobacteria_phage	44.4	1.3e-106
WP_046051127.1|1985445_1985826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046051126.1|1985830_1986082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046051125.1|1986078_1986585_+	hypothetical protein	NA	L0ASX3	Klebsiella_phage	37.2	3.2e-05
WP_046051124.1|1986581_1988747_+	DNA methyltransferase	NA	H9C171	Pectobacterium_phage	51.1	4.2e-219
WP_046051123.1|1988743_1989097_+	hypothetical protein	NA	H9C172	Pectobacterium_phage	59.0	9.0e-31
WP_046051122.1|1989139_1989403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046051121.1|1989506_1990100_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	55.8	1.7e-61
WP_046051120.1|1990108_1990393_+	DUF1364 domain-containing protein	NA	H9C174	Pectobacterium_phage	77.7	2.0e-36
WP_046051119.1|1990389_1990962_+	DUF1133 family protein	NA	NA	NA	NA	NA
WP_046051118.1|1991401_1991668_+	hypothetical protein	NA	Q7Y3V4	Yersinia_phage	78.4	7.0e-36
WP_046051117.1|1991667_1992201_+	lysozyme	NA	H6WRZ4	Salmonella_phage	67.8	1.3e-68
WP_046695109.1|1992193_1992526_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_046051115.1|1993229_1993832_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	73.0	7.1e-68
WP_046051114.1|1993831_1995304_+|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	82.9	2.8e-251
WP_046695108.1|1995314_1996772_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	66.7	4.4e-164
WP_080343489.1|1996809_1997691_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	65.1	4.2e-109
WP_046695106.1|1997748_1997940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046695105.1|1998013_1999201_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	48.3	1.3e-94
WP_046695104.1|1999204_1999645_+	hypothetical protein	NA	F1C5E0	Cronobacter_phage	63.0	1.9e-41
WP_046695103.1|1999655_2000732_+	hypothetical protein	NA	F1C5E1	Cronobacter_phage	76.0	2.4e-159
WP_046051109.1|2000741_2001107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046051108.1|2001109_2001481_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	77.5	1.5e-47
WP_154235943.1|2001666_2001861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046051107.1|2001790_2002141_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	50.9	3.3e-25
WP_046051106.1|2002142_2002511_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	68.0	1.2e-41
WP_046051105.1|2002507_2002891_+	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	66.1	9.1e-45
WP_046051104.1|2002915_2003665_+	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	54.0	4.0e-60
WP_046051103.1|2003824_2004172_+	TonB family protein	NA	NA	NA	NA	NA
WP_011816460.1|2004383_2004701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046051102.1|2005110_2005461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046695101.1|2006382_2007072_+	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	46.3	5.3e-51
WP_046695100.1|2007064_2010433_+	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	51.1	4.7e-193
WP_046695099.1|2010445_2010799_+|tail	phage tail protein	tail	I6RSL7	Salmonella_phage	75.2	1.0e-45
WP_046695098.1|2010812_2011367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046695097.1|2011494_2012199_+|tail	phage minor tail protein L	tail	H6WRW1	Salmonella_phage	77.4	1.0e-105
WP_080343457.1|2012198_2012924_+	C40 family peptidase	NA	Q5G8W2	Enterobacteria_phage	67.9	1.3e-100
WP_020424083.1|2012866_2013394_+|tail	tail assembly protein	tail	H6WRW3	Salmonella_phage	56.3	6.3e-44
WP_046695095.1|2013403_2016544_+	host specificity protein J	NA	Q5G8W0	Enterobacteria_phage	67.0	0.0e+00
WP_019079554.1|2016546_2016813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046051099.1|2016812_2017517_+	hypothetical protein	NA	A0A2D2W721	Pectobacterium_phage	25.2	6.9e-06
WP_046051098.1|2017542_2019354_+	hypothetical protein	NA	A0A1L7DQU7	Yersinia_phage	43.8	2.5e-39
WP_072083000.1|2019362_2019803_+|tail	phage tail protein	tail	Q7Y3Y8	Yersinia_phage	53.0	1.1e-20
WP_046695094.1|2019861_2022921_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	48.4	1.2e-105
WP_019082965.1|2023398_2024928_+	recombinase family protein	NA	NA	NA	NA	NA
WP_019083256.1|2025495_2025804_+|transposase	transposase	transposase	Q716C1	Shigella_phage	45.0	3.4e-18
2025108:2025232	attR	TTTTAAAATCCCTCGGCTTATGGCTGTGCGGGTTCAAGTCCCGCCCCGGGCACCATGGAAACAAATCTAAGTAAAACAAAGTAGTATGAGTATGTCGTTAACCGCCGAGAGGCGGTTTTTTTGTG	NA	NA	NA	NA
>prophage 2
NZ_CP009456	Yersinia enterocolitica strain FORC_002 chromosome, complete genome	4735534	2173229	2181061	4735534	tRNA	Tupanvirus(16.67%)	9	NA	NA
WP_005170086.1|2173229_2175158_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	7.4e-127
WP_011816226.1|2175161_2175713_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	3.4e-16
WP_004713020.1|2175809_2176007_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_004393357.1|2176044_2176401_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_152414234.1|2176469_2176517_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_019083037.1|2176865_2177849_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.0	9.9e-35
WP_046695044.1|2177863_2180251_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	27.8	1.1e-07
WP_002211830.1|2180255_2180552_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	4.2e-13
WP_032908420.1|2180764_2181061_-	NINE protein	NA	M4ZS56	Bacillus_phage	68.8	8.1e-17
>prophage 3
NZ_CP009456	Yersinia enterocolitica strain FORC_002 chromosome, complete genome	4735534	2632992	2639116	4735534		uncultured_Caudovirales_phage(16.67%)	8	NA	NA
WP_046050799.1|2632992_2633475_-	lysozyme	NA	A0A2H4JCH1	uncultured_Caudovirales_phage	65.0	3.8e-56
WP_005161370.1|2633476_2633653_-	hypothetical protein	NA	B6SD15	Bacteriophage	60.7	2.2e-14
WP_005170265.1|2633879_2634056_+	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_032901786.1|2634231_2634648_-	antitermination protein Q	NA	K7PGW2	Enterobacterial_phage	63.0	3.1e-38
WP_005161392.1|2635075_2635258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046050798.1|2635401_2636046_-	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	29.5	7.5e-15
WP_026018244.1|2636446_2636866_+	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	32.8	2.8e-15
WP_046050796.1|2637376_2639116_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	25.8	1.3e-37
>prophage 4
NZ_CP009456	Yersinia enterocolitica strain FORC_002 chromosome, complete genome	4735534	2648393	2662007	4735534	tail,transposase,plate	Pectobacterium_phage(71.43%)	16	NA	NA
WP_042562584.1|2648393_2649554_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	7.1e-40
WP_052750730.1|2649862_2651827_+	acyltransferase	NA	A0A193GZ69	Enterobacter_phage	34.1	1.3e-65
WP_019079689.1|2651912_2652383_-|tail	phage tail protein	tail	F1BUP0	Erwinia_phage	48.1	1.4e-39
WP_046694915.1|2652396_2653500_-	hypothetical protein	NA	E5G6P0	Salmonella_phage	54.4	3.1e-08
WP_019079691.1|2653513_2654158_-	DUF2612 domain-containing protein	NA	H9C1B4	Pectobacterium_phage	49.0	5.0e-43
WP_046694914.1|2654150_2655350_-|plate	phage baseplate protein	plate	H9C1B3	Pectobacterium_phage	66.0	7.3e-149
WP_025378609.1|2655349_2655700_-	hypothetical protein	NA	H9C1B2	Pectobacterium_phage	65.5	2.2e-37
WP_046694913.1|2655772_2656450_-	hypothetical protein	NA	H9C1B1	Pectobacterium_phage	57.1	1.8e-67
WP_046694912.1|2656457_2657351_-	hypothetical protein	NA	H9C1B0	Pectobacterium_phage	46.4	6.0e-79
WP_046694911.1|2657343_2657634_-	hypothetical protein	NA	H9C1A9	Pectobacterium_phage	58.3	2.1e-25
WP_019079697.1|2657633_2658302_-	hypothetical protein	NA	H9C1A8	Pectobacterium_phage	48.9	6.7e-35
WP_046694910.1|2658301_2659966_-	glycoside hydrolase family 104 protein	NA	H9C1A7	Pectobacterium_phage	49.7	9.6e-139
WP_102895904.1|2660083_2660380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046694908.1|2660369_2660948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019079702.1|2661210_2661600_-	hypothetical protein	NA	H9C1A4	Pectobacterium_phage	60.5	1.5e-34
WP_019079703.1|2661602_2662007_-	hypothetical protein	NA	H9C1A3	Pectobacterium_phage	80.6	4.6e-55
>prophage 5
NZ_CP009456	Yersinia enterocolitica strain FORC_002 chromosome, complete genome	4735534	2731152	2738270	4735534	holin	Cronobacter_phage(33.33%)	8	NA	NA
WP_046694896.1|2731152_2732430_-	bifunctional O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	A0A0B5JD48	Pandoravirus	29.8	3.4e-19
WP_019083380.1|2732936_2734001_+	linear amide C-N hydrolase	NA	M1HS66	Paramecium_bursaria_Chlorella_virus	27.3	2.6e-20
WP_019083381.1|2734326_2735163_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019079757.1|2735242_2735464_+|holin	holin	holin	M9NZI9	Enterobacteria_phage	66.2	2.3e-16
WP_080343450.1|2735435_2735936_+	lysozyme	NA	A0A2H4JCH1	uncultured_Caudovirales_phage	57.8	1.8e-48
WP_046050765.1|2735911_2736250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046050764.1|2736645_2737002_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	F1C5A6	Cronobacter_phage	44.8	3.8e-21
WP_046050763.1|2737001_2738270_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.5	1.5e-155
>prophage 6
NZ_CP009456	Yersinia enterocolitica strain FORC_002 chromosome, complete genome	4735534	3816704	3828331	4735534	tRNA,integrase	Morganella_phage(25.0%)	16	3823773:3823786	3826992:3827005
WP_046694593.1|3816704_3819479_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.4	1.2e-292
WP_046695654.1|3819471_3819825_-	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	51.4	7.9e-27
WP_046694592.1|3819838_3820369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050322082.1|3820352_3820985_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	41.7	7.5e-36
WP_046694591.1|3820981_3821200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046694590.1|3821189_3821396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046694589.1|3821388_3821589_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	51.7	1.8e-07
WP_046694588.1|3821578_3821764_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_046694587.1|3821972_3822293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046694586.1|3822548_3823391_-	antA/AntB antirepressor family protein	NA	A0A0P0ZCA2	Stx2-converting_phage	42.9	5.9e-20
WP_154237414.1|3823405_3823825_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	54.2	1.0e-25
3823773:3823786	attL	TTGGCGCTAACCTG	NA	NA	NA	NA
WP_038400474.1|3823824_3824022_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_046694585.1|3824242_3824698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046694584.1|3824716_3825046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046694583.1|3825190_3826405_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.4	1.6e-143
WP_019078980.1|3826813_3828331_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	37.4	6.6e-86
3826992:3827005	attR	TTGGCGCTAACCTG	NA	NA	NA	NA
>prophage 7
NZ_CP009456	Yersinia enterocolitica strain FORC_002 chromosome, complete genome	4735534	4178261	4295090	4735534	portal,terminase,holin,capsid,tRNA,tail,protease,integrase,head	uncultured_Caudovirales_phage(30.0%)	105	4191983:4192000	4273762:4273779
WP_019080059.1|4178261_4178996_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_019080060.1|4179084_4180746_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_046694481.1|4180844_4182260_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_046050170.1|4182474_4183422_-	HTH-type transcriptional regulator TreR	NA	NA	NA	NA	NA
WP_046694480.1|4183928_4186649_+	magnesium-translocating P-type ATPase	NA	M1HN09	Paramecium_bursaria_Chlorella_virus	24.1	2.0e-40
WP_005162526.1|4186728_4187007_+	plasmid maintenance system killer protein	NA	A0A2L1IV28	Escherichia_phage	77.2	6.0e-38
WP_005162529.1|4187006_4187312_+	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	65.3	3.3e-29
WP_046695642.1|4187384_4189283_-	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_046694479.1|4189384_4190608_-	lactonase family protein	NA	NA	NA	NA	NA
WP_005174290.1|4190717_4191458_-	KDGP aldolase family protein	NA	NA	NA	NA	NA
WP_019080067.1|4191461_4192574_-	DgaE family pyridoxal phosphate-dependent ammonia lyase	NA	NA	NA	NA	NA
4191983:4192000	attL	ACTGCAAATCTTCTTCTG	NA	NA	NA	NA
WP_019080068.1|4192557_4193727_-	amidohydrolase/deacetylase family metallohydrolase	NA	NA	NA	NA	NA
WP_005174295.1|4193927_4194578_-	DUF4310 family protein	NA	NA	NA	NA	NA
WP_004392358.1|4194599_4195376_-	DUF4311 domain-containing protein	NA	NA	NA	NA	NA
WP_019082217.1|4195389_4195686_-	DUF4312 family protein	NA	NA	NA	NA	NA
WP_004392359.1|4195685_4196051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005174305.1|4196074_4196419_-	glycine dehydrogenase	NA	NA	NA	NA	NA
WP_005174306.1|4196824_4197235_+	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_019080071.1|4197283_4197670_-	cytochrome b562	NA	NA	NA	NA	NA
WP_019082216.1|4197847_4199188_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_005174310.1|4199356_4199902_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_019082215.1|4199954_4200221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046050128.1|4200225_4200699_-	ribonuclease	NA	NA	NA	NA	NA
WP_046050127.1|4200796_4202290_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_019082213.1|4202411_4204367_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_005174322.1|4204368_4205304_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_005174323.1|4205311_4205515_-	AaeX family protein	NA	NA	NA	NA	NA
WP_019080077.1|4205827_4206739_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_046694478.1|4206992_4207859_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_052750725.1|4207937_4214444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046694477.1|4214504_4218950_+	toxin	NA	NA	NA	NA	NA
WP_046694476.1|4219027_4219339_+|holin	holin	holin	NA	NA	NA	NA
WP_046694475.1|4219350_4219752_+	M15 family metallopeptidase	NA	A9DET4	Yersinia_phage	58.4	5.4e-40
WP_046694474.1|4219748_4220108_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_046694473.1|4220291_4223429_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_046694472.1|4223499_4224945_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_019080079.1|4224957_4225818_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_060722690.1|4225814_4229690_-	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_005174333.1|4229736_4231206_-	ribonuclease G	NA	NA	NA	NA	NA
WP_046694470.1|4231195_4231789_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_019080082.1|4231802_4232291_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_005163136.1|4232287_4233274_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002228205.1|4233373_4234417_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.0e-06
WP_019082211.1|4234751_4236671_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_019080084.1|4236955_4237933_+	oxidoreductase	NA	NA	NA	NA	NA
WP_019080085.1|4238086_4239121_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_005174342.1|4239120_4239720_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_005174343.1|4239928_4240381_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_005163113.1|4240538_4241003_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_004392390.1|4241014_4242364_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_019080086.1|4242571_4242814_+	YhdT family protein	NA	NA	NA	NA	NA
WP_019080087.1|4242803_4244258_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_046050121.1|4244351_4245233_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_019080089.1|4245692_4246658_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_002210061.1|4246682_4246979_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_046695640.1|4247135_4247384_-	hypothetical protein	NA	A0A1W6JPH4	Morganella_phage	55.7	4.7e-18
WP_046694469.1|4247402_4247972_-|tail	tail assembly protein	tail	A0A1B0VMI5	Pseudomonas_phage	57.6	2.3e-52
WP_046694468.1|4247985_4249647_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	80.7	3.9e-273
WP_046694467.1|4249633_4249987_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	71.8	1.8e-42
WP_154237413.1|4250116_4250284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046694466.1|4250261_4250708_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	63.6	6.5e-50
WP_046694465.1|4250707_4250992_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	77.4	8.0e-38
WP_025376816.1|4250988_4251324_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	59.6	2.6e-27
WP_050078270.1|4251320_4252523_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	73.0	5.4e-176
WP_046694463.1|4252524_4253082_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	73.7	6.3e-71
WP_046694462.1|4253124_4254297_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	73.5	3.4e-159
WP_046694461.1|4254520_4254763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046694460.1|4255199_4257557_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	38.4	1.4e-140
WP_046694459.1|4257553_4257748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046694458.1|4257750_4257921_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_046694457.1|4257901_4258096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046694456.1|4258088_4258280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052750724.1|4258272_4259559_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_050078199.1|4259555_4260074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046694454.1|4260213_4260495_-	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	43.4	2.5e-07
WP_046694453.1|4260597_4261497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046694452.1|4261595_4262825_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	59.2	1.1e-142
WP_046050120.1|4263076_4264636_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.4	2.1e-18
WP_019080091.1|4264921_4265392_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_005163090.1|4265773_4265986_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	80.0	1.7e-24
WP_005163090.1|4266257_4266470_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	80.0	1.7e-24
WP_005163087.1|4266741_4266954_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	80.0	4.4e-25
WP_026017912.1|4267543_4268956_+	anion permease	NA	NA	NA	NA	NA
WP_019080096.1|4269314_4270235_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	53.5	8.0e-79
WP_046694451.1|4270307_4271846_-	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_019080098.1|4272266_4273292_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	36.9	5.6e-65
WP_020424093.1|4273354_4274533_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
4273762:4273779	attR	ACTGCAAATCTTCTTCTG	NA	NA	NA	NA
WP_032900810.1|4274548_4275652_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005174366.1|4275660_4276422_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.3	2.0e-19
WP_005174368.1|4276492_4277182_-	LrgB family protein	NA	NA	NA	NA	NA
WP_019080101.1|4277174_4277600_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_019080102.1|4277728_4278646_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019080103.1|4278661_4280311_-	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_046694450.1|4280525_4281893_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	73.9	7.1e-164
WP_019080105.1|4282253_4282925_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_019080106.1|4283120_4283672_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	88.5	1.5e-56
WP_019080107.1|4284075_4286907_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.2	1.7e-308
WP_019082203.1|4286965_4287319_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_046694449.1|4287822_4289016_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_046050115.1|4289073_4290153_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	29.3	8.9e-29
WP_005165232.1|4290182_4291589_-	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	75.7	7.4e-193
WP_046050114.1|4291773_4292757_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_046050113.1|4292969_4293296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005165239.1|4293636_4293855_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_046694448.1|4294061_4295090_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP009456	Yersinia enterocolitica strain FORC_002 chromosome, complete genome	4735534	4525691	4531789	4735534		Synechococcus_phage(50.0%)	9	NA	NA
WP_050123130.1|4525691_4526417_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	22.9	4.9e-07
WP_050919803.1|4526413_4527154_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_019081614.1|4527237_4527564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019081615.1|4527565_4528288_-	hypothetical protein	NA	A0A1D8KNV9	Synechococcus_phage	30.0	3.0e-28
WP_032901223.1|4528277_4528931_-	HAD family phosphatase	NA	A0A1D8KNV9	Synechococcus_phage	40.1	1.7e-35
WP_019081617.1|4528939_4529566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019081618.1|4529562_4530324_-	NTP transferase domain-containing protein	NA	A0A1D8KNV9	Synechococcus_phage	50.2	3.4e-59
WP_019081619.1|4530357_4530906_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	52.5	1.2e-50
WP_019081620.1|4530910_4531789_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	38.9	7.0e-40
>prophage 9
NZ_CP009456	Yersinia enterocolitica strain FORC_002 chromosome, complete genome	4735534	4618287	4626609	4735534	integrase	Enterobacteria_phage(66.67%)	11	4615745:4615758	4627525:4627538
4615745:4615758	attL	ATTGATAATGAAGA	NA	NA	NA	NA
WP_046694371.1|4618287_4620621_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	59.7	2.6e-259
WP_046051905.1|4620634_4620976_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_046694370.1|4620972_4621236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046694369.1|4621232_4621778_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	56.8	9.4e-27
WP_046695634.1|4621782_4621971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046694368.1|4622018_4622276_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	57.1	2.7e-16
WP_046694367.1|4622875_4623595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071843340.1|4623596_4623842_+	transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	56.1	2.6e-13
WP_032814188.1|4624223_4624535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046694366.1|4624601_4625417_-	DUF2971 domain-containing protein	NA	J9Q7Y9	Salmonella_phage	25.6	1.2e-09
WP_046694365.1|4625433_4626609_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	80.8	1.6e-185
4627525:4627538	attR	TCTTCATTATCAAT	NA	NA	NA	NA
