The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009768	Salmonella enterica subsp. enterica serovar Enteritidis strain FORC_007 chromosome, complete genome	4680477	1813737	1821050	4680477	protease,integrase	Dickeya_phage(16.67%)	7	1802475:1802489	1821268:1821282
1802475:1802489	attL	AGCCTGCGAGGAGAC	NA	NA	NA	NA
WP_001201751.1|1813737_1814856_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125875.1|1814852_1816799_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|1816928_1817150_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1817473_1817794_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934064.1|1817824_1820101_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_001117984.1|1820313_1820511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001539594.1|1820672_1821050_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
1821268:1821282	attR	GTCTCCTCGCAGGCT	NA	NA	NA	NA
>prophage 2
NZ_CP009768	Salmonella enterica subsp. enterica serovar Enteritidis strain FORC_007 chromosome, complete genome	4680477	1892871	1903665	4680477	tail	Escherichia_phage(37.5%)	9	NA	NA
WP_000274547.1|1892871_1893501_+	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	65.9	1.6e-75
WP_000729406.1|1893484_1894111_+	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
WP_000583382.1|1894107_1895817_+|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	1.5e-91
WP_000143167.1|1895816_1896398_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001674638.1|1896875_1897844_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_000334547.1|1898491_1899118_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001525490.1|1899477_1900164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|1900434_1900626_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193790.1|1901052_1903665_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
>prophage 3
NZ_CP009768	Salmonella enterica subsp. enterica serovar Enteritidis strain FORC_007 chromosome, complete genome	4680477	2105529	2154779	4680477	protease,tail,integrase,lysis,holin	Salmonella_phage(28.57%)	47	2105365:2105394	2124986:2125015
2105365:2105394	attL	ACAGGAATCGTATTCGGTCTCTTTTTATTT	NA	NA	NA	NA
WP_000087636.1|2105529_2106609_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.0e-101
WP_001575998.1|2106583_2106862_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_001237395.1|2107275_2109255_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
WP_000911593.1|2109943_2110192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000940753.1|2110255_2110855_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
WP_000784710.1|2110851_2111079_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
WP_001097218.1|2111208_2111898_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
WP_001574213.1|2111994_2112519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798708.1|2112892_2113342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001574215.1|2113702_2114389_-	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
WP_001574216.1|2114664_2114994_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984586.1|2114977_2115430_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001541990.1|2115447_2115927_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000877926.1|2116821_2117355_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152416.1|2117444_2118140_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_000161704.1|2122194_2122917_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_001536069.1|2123396_2124197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077681935.1|2126054_2126549_-	RecE	NA	A0A0U2I1R6	Escherichia_phage	70.3	3.7e-22
2124986:2125015	attR	ACAGGAATCGTATTCGGTCTCTTTTTATTT	NA	NA	NA	NA
WP_001013467.1|2126738_2126969_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050883.1|2127022_2127556_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
WP_000789530.1|2127812_2127980_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001576014.1|2128044_2128233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348541.1|2128287_2128779_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	7.1e-42
WP_001687735.1|2130883_2131384_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	77.4	1.5e-63
WP_012543349.1|2131480_2131681_-	phage virulence factor PagK family protein	NA	NA	NA	NA	NA
WP_000457876.1|2132250_2132376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000951652.1|2132876_2133023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000848072.1|2133510_2134125_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_000480735.1|2134134_2134293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001233445.1|2134425_2135340_-	DMT family transporter	NA	NA	NA	NA	NA
WP_001576018.1|2138478_2138619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001576019.1|2138784_2139054_-	hypothetical protein	NA	B6SCX2	Bacteriophage	47.9	3.1e-07
WP_001025515.1|2139426_2139846_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000030934.1|2140218_2140695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000422882.1|2141024_2141420_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	32.8	9.2e-16
WP_000182071.1|2142103_2142826_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
WP_001134856.1|2143110_2143275_+	membrane protein	NA	NA	NA	NA	NA
WP_000986173.1|2143498_2144149_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.9	7.2e-58
WP_000457838.1|2144167_2144359_-	YebW family protein	NA	NA	NA	NA	NA
WP_024131108.1|2144469_2144706_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001531515.1|2144823_2146263_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001529852.1|2146340_2148974_-	PqiB family protein	NA	NA	NA	NA	NA
WP_001207294.1|2148942_2150226_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001518229.1|2150354_2150852_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_000431401.1|2150949_2151636_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001091237.1|2151655_2153704_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
WP_000984498.1|2153897_2154779_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 4
NZ_CP009768	Salmonella enterica subsp. enterica serovar Enteritidis strain FORC_007 chromosome, complete genome	4680477	2346069	2360345	4680477	tRNA,holin	Escherichia_phage(66.67%)	19	NA	NA
WP_000123686.1|2346069_2347443_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.1e-51
WP_001156217.1|2347486_2348422_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	7.2e-144
WP_001676915.1|2348738_2349356_-	exodeoxyribonuclease	NA	A0A088CD28	Shigella_phage	41.9	2.5e-36
WP_000800272.1|2349383_2349701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560208.1|2349785_2350007_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	83.6	7.9e-33
WP_000004762.1|2350444_2350966_+	superinfection exclusion B family protein	NA	NA	NA	NA	NA
WP_085981757.1|2351073_2351229_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	48.9	2.6e-06
WP_001227859.1|2351613_2352081_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	66.9	1.0e-53
WP_001676916.1|2352353_2352683_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.7	6.5e-23
WP_001033796.1|2352844_2353399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000556390.1|2353395_2354328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000882662.1|2354697_2354910_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000734094.1|2355200_2355371_+	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	61.8	8.5e-11
WP_000940751.1|2355433_2356033_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	5.5e-97
WP_000774470.1|2356032_2356323_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	76.0	5.1e-40
WP_000640113.1|2356319_2356856_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.9	1.4e-70
WP_001688615.1|2359343_2359532_+	hypothetical protein	NA	Q8W636	Enterobacteria_phage	57.4	9.4e-11
WP_000445513.1|2359521_2359803_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	49.4	1.3e-16
WP_000802786.1|2359799_2360345_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	83.4	2.3e-89
>prophage 5
NZ_CP009768	Salmonella enterica subsp. enterica serovar Enteritidis strain FORC_007 chromosome, complete genome	4680477	2894200	2947624	4680477	protease,transposase,portal,tail,terminase,capsid,integrase,head,holin,plate	Salmonella_phage(76.36%)	65	2939089:2939103	2945415:2945429
WP_001028172.1|2894200_2895223_-|transposase	IS110-like element ISSaen1 family transposase	transposase	NA	NA	NA	NA
WP_001176778.1|2895684_2896503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526483.1|2897845_2898067_-	helix-turn-helix domain-containing protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
WP_000492926.1|2898279_2899287_+	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
WP_015701331.1|2899571_2900171_-|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	5.9e-107
WP_000554738.1|2900140_2901703_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	99.8	9.8e-287
WP_001207832.1|2901689_2902277_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_001699732.1|2902279_2903359_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.4	5.5e-204
WP_000605050.1|2903351_2903765_-	phage GP46 family protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
WP_001273650.1|2903769_2904303_-|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	99.4	2.1e-95
WP_001066630.1|2904302_2905361_-|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	100.0	1.3e-202
WP_000863817.1|2905357_2906698_-	DNA circularization N-terminal domain-containing protein	NA	A0A192Y5U9	Salmonella_phage	99.1	1.1e-249
WP_000785387.1|2906731_2908660_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.5	0.0e+00
WP_000588852.1|2908744_2909071_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515952.1|2909067_2909424_-|tail	phage tail tube protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007993.1|2909423_2910920_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	Q8HAC5	Salmonella_phage	99.2	3.0e-277
WP_000497739.1|2910909_2911074_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_000779215.1|2911077_2911638_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	99.5	3.0e-105
WP_001135695.1|2911634_2912147_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	93.5	1.4e-85
WP_000776844.1|2912118_2912523_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	96.3	1.5e-69
WP_000927251.1|2912519_2912843_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	72.0	2.6e-40
WP_000766103.1|2912922_2914152_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	90.9	1.8e-206
WP_000003793.1|2914161_2914764_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	91.5	2.0e-99
WP_077905357.1|2914756_2915851_-|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	82.7	7.3e-180
WP_000838395.1|2915967_2916126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000257219.1|2916122_2917853_-|terminase	terminase large subunit	terminase	Q8W631	Enterobacteria_phage	58.9	3.2e-198
WP_000501481.1|2917852_2918290_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	63.7	1.6e-32
WP_001135228.1|2918436_2918787_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	3.1e-63
WP_000127618.1|2918810_2919350_-	DUF2514 domain-containing protein	NA	A0A0A0P0G7	Enterobacteria_phage	37.2	5.3e-06
WP_001075993.1|2919346_2919964_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	78.9	3.2e-92
WP_000226304.1|2919963_2920245_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.3e-36
WP_001294874.1|2920231_2920621_-|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	71.0	1.8e-40
WP_000765639.1|2920709_2921282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000357930.1|2921294_2922368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047141.1|2922417_2923170_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.0	1.9e-134
WP_012543375.1|2923183_2924173_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.6	1.9e-190
WP_001061459.1|2924180_2925041_-	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	98.3	1.5e-159
WP_000779149.1|2925057_2925447_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	99.2	1.9e-69
WP_000200166.1|2925455_2926337_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	96.2	8.3e-166
WP_000054227.1|2926333_2926807_-	PerC family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	94.6	3.9e-53
WP_000096529.1|2926803_2927778_-	conserved phage C-terminal domain-containing protein	NA	A0A1C9IHW0	Salmonella_phage	97.8	1.2e-165
WP_000620702.1|2927774_2927999_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_001087406.1|2927995_2929153_-	Rha family phage regulatory protein	NA	Q8HA97	Salmonella_phage	98.4	2.8e-214
WP_000509728.1|2929149_2929704_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	98.9	3.4e-101
WP_001191666.1|2929732_2929957_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020644.1|2930054_2930750_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	2.7e-127
WP_001067433.1|2930955_2931141_+	hypothetical protein	NA	A0A1C9II97	Salmonella_phage	73.3	1.2e-13
WP_000078504.1|2931216_2931468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000551790.1|2932037_2932955_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	59.7	1.3e-97
WP_000008351.1|2933049_2933589_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000764235.1|2933659_2933890_+	hypothetical protein	NA	Q8HAA4	Salmonella_phage	100.0	2.0e-34
WP_000071068.1|2933886_2934402_+	DUF262 domain-containing protein	NA	A0A2H4FWH2	Salmonella_phage	96.5	1.3e-94
WP_000065085.1|2934398_2934758_+	Eaf protein	NA	T1SA95	Salmonella_phage	89.9	1.0e-58
WP_000267991.1|2935029_2935323_+	hypothetical protein	NA	A0A1V0E5L2	Salmonella_phage	100.0	1.5e-50
WP_000208076.1|2935319_2936183_+	DUF551 domain-containing protein	NA	S4TSR6	Salmonella_phage	49.2	5.2e-64
WP_001061370.1|2936179_2936749_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	99.5	9.3e-110
WP_001527041.1|2936788_2937016_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	3.2e-37
WP_000532847.1|2937017_2938007_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000598920.1|2938298_2939096_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
2939089:2939103	attL	AACATTAATTCCTCA	NA	NA	NA	NA
WP_001680077.1|2940421_2941696_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	39.9	2.4e-73
WP_000042271.1|2941767_2942019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001084817.1|2942497_2942995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072670.1|2943356_2943920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000028416.1|2944330_2945212_+	toll/interleukin-1 receptor domain-containing protein	NA	A0A097BYB4	Enterococcus_phage	42.0	3.3e-29
WP_001127942.1|2945785_2947624_-|tail	tail fiber protein	tail	I1TR70	Cronobacter_phage	49.0	1.0e-32
2945415:2945429	attR	AACATTAATTCCTCA	NA	NA	NA	NA
>prophage 6
NZ_CP009768	Salmonella enterica subsp. enterica serovar Enteritidis strain FORC_007 chromosome, complete genome	4680477	3054613	3065120	4680477		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|3054613_3055927_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565913.1|3055953_3057033_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000648783.1|3057037_3057811_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018223.1|3057826_3058801_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973709.1|3058806_3059358_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_000857535.1|3059358_3060237_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_001023658.1|3060284_3061184_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000697846.1|3061183_3062269_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_000981469.1|3062645_3063539_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001144948.1|3063716_3065120_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
>prophage 7
NZ_CP009768	Salmonella enterica subsp. enterica serovar Enteritidis strain FORC_007 chromosome, complete genome	4680477	3132319	3141490	4680477	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195340.1|3132319_3134353_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
WP_000703145.1|3134593_3135052_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	6.4e-53
WP_001197951.1|3135223_3135754_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950414.1|3135810_3136278_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	4.3e-73
WP_000598637.1|3136324_3137044_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|3137040_3138726_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240420.1|3138948_3139680_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	86.9	2.5e-99
WP_001261696.1|3139739_3139847_+	protein YohO	NA	NA	NA	NA	NA
WP_000824854.1|3139827_3140559_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569168.1|3140542_3141490_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
>prophage 8
NZ_CP009768	Salmonella enterica subsp. enterica serovar Enteritidis strain FORC_007 chromosome, complete genome	4680477	3378303	3384356	4680477		Salmonella_virus(50.0%)	6	NA	NA
WP_000377779.1|3378303_3379245_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	87.8	1.6e-146
WP_001576268.1|3380487_3380877_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	85.6	1.1e-50
WP_000703599.1|3380845_3381100_+	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
WP_000400616.1|3381117_3383040_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.3	5.6e-300
WP_105789228.1|3384029_3384173_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	82.9	1.7e-12
WP_105789229.1|3384188_3384356_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	63.5	1.3e-11
>prophage 1
NZ_CP009767	Salmonella enterica subsp. enterica serovar Enteritidis strain FORC_007 plasmid pFORC7, complete sequence	101428	1883	30543	101428	transposase	Escherichia_phage(50.0%)	32	NA	NA
WP_001067855.1|1883_2588_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_058113817.1|2612_3206_+	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	43.2	1.6e-32
WP_000098781.1|3189_4854_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_077907510.1|4786_5812_+	ExeA family protein	NA	NA	NA	NA	NA
WP_001121400.1|6000_7038_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_000346690.1|7645_8539_+	virulence genes transcriptional activator SpvR	NA	NA	NA	NA	NA
WP_001576629.1|8712_8877_+	glycoside hydrolase family protein	NA	A0A0M4R365	Salmonella_phage	63.0	3.3e-12
WP_001676649.1|9050_9818_+	virulence protein SpvA	NA	NA	NA	NA	NA
WP_001526987.1|9780_9948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676648.1|9999_11775_+	SPI-2 type III secretion system effector NAD(+)--protein-arginine ADP-ribosyltransferase SpvB	NA	NA	NA	NA	NA
WP_001122242.1|12055_12781_+	type III secretion system effector phosphothreonine lyase SpvC	NA	NA	NA	NA	NA
WP_001676646.1|13042_13693_+	SPI-2 type III secretion system effector cysteine hydrolase SpvD	NA	NA	NA	NA	NA
WP_000064919.1|13819_14245_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	50.4	3.4e-24
WP_001541541.1|14301_14652_+	helix-turn-helix domain-containing protein	NA	A0A077SLN2	Escherichia_phage	80.5	1.9e-44
WP_000900095.1|14718_15279_-	inverse autotransporter beta domain-containing protein	NA	NA	NA	NA	NA
WP_000905606.1|15998_16484_-	membrane protein	NA	NA	NA	NA	NA
WP_001541544.1|16477_16987_-	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
WP_023327680.1|17108_17813_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	2.0e-138
WP_001011939.1|17956_18598_-	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	7.3e-55
WP_001239317.1|18747_19248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|19327_20032_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001541566.1|20293_21034_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_001135409.1|21688_22177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001247117.1|22434_23550_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001541564.1|23635_24052_+	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
WP_001527010.1|24235_24571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000176303.1|24627_25233_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_000728919.1|25229_26171_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.7	4.7e-74
WP_000427676.1|26585_27791_+	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_000064277.1|27790_28765_+	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.5	5.1e-84
WP_000457542.1|28846_30121_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.9e-156
WP_000925628.1|30120_30543_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.4	2.0e-29
