The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011286	Yersinia enterocolitica strain KNG22703, complete genome	4581645	1370647	1415064	4581645	lysis,tail	uncultured_Caudovirales_phage(30.0%)	46	NA	NA
WP_032904655.1|1370647_1372141_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	27.5	2.2e-09
WP_013649518.1|1372249_1373041_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_005158974.1|1373275_1373416_+	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_013649519.1|1373632_1374409_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013649520.1|1374584_1375778_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	39.7	8.5e-73
WP_013649521.1|1375743_1375944_-	AlpA family phage regulatory protein	NA	A0A0R6PC61	Moraxella_phage	45.3	8.2e-05
WP_032904656.1|1375940_1377341_-	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	70.6	2.2e-197
WP_013649523.1|1377384_1377879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013649524.1|1377880_1378153_-	VRR-NUC domain-containing protein	NA	Q3LZN4	Bacteriophage	74.4	7.0e-31
WP_013649525.1|1378142_1378367_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032904657.1|1378371_1380471_-	DNA polymerase I	NA	Q775A3	Bordetella_phage	65.0	5.4e-264
WP_013649527.1|1380567_1381347_-	DUF2303 family protein	NA	A0A291AUR3	Sinorhizobium_phage	30.8	6.0e-19
WP_013649528.1|1381403_1381781_-	hypothetical protein	NA	A0A142K8T9	Gordonia_phage	45.7	4.4e-07
WP_013649529.1|1381836_1382385_-	DUF2815 family protein	NA	Q3LZQ2	Bacteriophage	59.0	1.4e-54
WP_013649530.1|1382397_1383708_-	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	54.1	1.5e-126
WP_013649531.1|1383710_1384445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013649532.1|1384956_1385634_-	helix-turn-helix transcriptional regulator	NA	B6SCU0	Bacteriophage	47.3	1.9e-53
WP_013649533.1|1385774_1385975_+	transcriptional regulator	NA	K7RWG7	Bacteriophage	62.5	3.4e-11
WP_013649534.1|1385978_1388144_+	replication protein	NA	B6SD37	Bacteriophage	67.4	3.8e-164
WP_050137016.1|1388474_1388711_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_013649536.1|1388983_1389397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013649537.1|1389407_1389626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013649538.1|1389628_1391233_+	hypothetical protein	NA	A0A2H4J3N6	uncultured_Caudovirales_phage	60.9	1.5e-176
WP_144405301.1|1391238_1391469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013649540.1|1391455_1392259_+	hypothetical protein	NA	A0A2H4JEQ5	uncultured_Caudovirales_phage	44.5	8.9e-50
WP_013649541.1|1392472_1393381_+	hypothetical protein	NA	A0A2H4JC66	uncultured_Caudovirales_phage	38.1	8.3e-44
WP_013649542.1|1393435_1393996_+	hypothetical protein	NA	A0A2H4JID6	uncultured_Caudovirales_phage	51.3	4.0e-49
WP_013649543.1|1393995_1395969_+	hypothetical protein	NA	A0A2H4J6H2	uncultured_Caudovirales_phage	48.2	2.8e-182
WP_013649544.1|1395974_1396421_+	GNAT family N-acetyltransferase	NA	A0A2H4J9Z5	uncultured_Caudovirales_phage	41.2	6.7e-23
WP_013649545.1|1396424_1396907_+	hypothetical protein	NA	A0A2H4J679	uncultured_Caudovirales_phage	48.0	2.7e-09
WP_013649546.1|1396903_1399030_+	hypothetical protein	NA	A0A2H4JE92	uncultured_Caudovirales_phage	27.0	1.1e-59
WP_013649547.1|1399035_1400328_+	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	35.8	3.0e-31
WP_013649548.1|1400324_1402850_+	hypothetical protein	NA	A0A193GZ61	Enterobacter_phage	42.7	1.6e-185
WP_032904658.1|1402851_1403259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013649550.1|1403270_1403981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013649551.1|1404022_1404373_+	hypothetical protein	NA	A0A2H4J7H0	uncultured_Caudovirales_phage	47.3	1.6e-19
WP_013649553.1|1405991_1407389_+|tail	tail fiber	tail	T1S9Y2	Salmonella_phage	35.4	3.6e-38
WP_013649554.1|1407399_1407867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032904659.1|1407978_1408284_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	54.5	7.3e-21
WP_013649556.1|1408270_1408801_+	lysozyme	NA	Q7Y3V3	Yersinia_phage	70.9	4.0e-67
WP_013649557.1|1408793_1409294_+|lysis	lysis protein	lysis	A0A0A0YR13	Escherichia_phage	41.1	1.4e-24
WP_013649558.1|1409433_1410132_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_013649559.1|1410125_1411190_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	33.8	1.2e-20
WP_005158965.1|1411432_1412254_-	pyridoxal phosphatase	NA	NA	NA	NA	NA
WP_013649560.1|1412667_1413669_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_005158960.1|1413786_1415064_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	33.2	4.2e-17
>prophage 2
NZ_CP011286	Yersinia enterocolitica strain KNG22703, complete genome	4581645	1557515	1566771	4581645		Bacillus_phage(42.86%)	7	NA	NA
WP_005162367.1|1557515_1559102_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.1	6.3e-39
WP_013649615.1|1559586_1561002_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.1	7.5e-52
WP_020283357.1|1561015_1562401_+	phosphomannomutase ManB protein	NA	A0A127AWJ1	Bacillus_phage	26.8	1.3e-32
WP_020283356.1|1562564_1563446_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.6	8.3e-57
WP_013649618.1|1563511_1564405_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	42.5	9.9e-50
WP_013649619.1|1564548_1565670_+	GDP-mannose 4,6-dehydratase	NA	M1HAR7	Acanthocystis_turfacea_Chlorella_virus	63.6	1.1e-133
WP_032904843.1|1565688_1566771_+	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A2K9L470	Tupanvirus	39.5	7.3e-47
>prophage 3
NZ_CP011286	Yersinia enterocolitica strain KNG22703, complete genome	4581645	1751843	1764507	4581645		Vaccinia_virus(16.67%)	9	NA	NA
WP_013649690.1|1751843_1754996_-	beta-galactosidase	NA	B9U1H7	Vaccinia_virus	62.8	0.0e+00
WP_013649691.1|1755174_1756209_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	50.3	1.4e-84
WP_002210893.1|1756690_1756903_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	80.0	2.0e-25
WP_071883493.1|1757111_1757348_+	protein DsrB	NA	NA	NA	NA	NA
WP_013649692.1|1757481_1759221_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.4	1.1e-09
WP_005177865.1|1759468_1759840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005177868.1|1760086_1760326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005164505.1|1760877_1761588_+	MgtC family protein	NA	G3MA03	Bacillus_virus	41.0	1.1e-14
WP_005164503.1|1761804_1764507_+	magnesium-translocating P-type ATPase	NA	M1HM40	Paramecium_bursaria_Chlorella_virus	25.2	2.7e-42
>prophage 4
NZ_CP011286	Yersinia enterocolitica strain KNG22703, complete genome	4581645	1813575	1909892	4581645	integrase,transposase,holin,tRNA,lysis,plate,tail	Salmonella_phage(25.81%)	100	1813452:1813470	1816483:1816501
1813452:1813470	attL	ACGTTATGAATATGGGTGT	NA	NA	NA	NA
WP_071822707.1|1813575_1813731_-|integrase	integrase	integrase	Q8W658	Enterobacteria_phage	83.8	1.0e-07
WP_013649707.1|1813783_1813999_+	hypothetical protein	NA	A0A1I9KFG8	Aeromonas_phage	42.2	4.7e-06
WP_013649708.1|1814526_1814922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013649709.1|1815662_1815839_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	53.6	9.7e-10
WP_005160362.1|1815917_1816187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005160360.1|1816501_1817104_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
1816483:1816501	attR	ACGTTATGAATATGGGTGT	NA	NA	NA	NA
WP_005160358.1|1817190_1820151_-	metal-dependent phosphohydrolase	NA	NA	NA	NA	NA
WP_020283291.1|1820481_1821351_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005160355.1|1821624_1821987_-	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_005160351.1|1821998_1822397_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_013649711.1|1822407_1823808_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_054540930.1|1824076_1825186_+	flagellin FliC	NA	NA	NA	NA	NA
WP_013649713.1|1825375_1826485_+	flagellin FliC	NA	NA	NA	NA	NA
WP_005160345.1|1826632_1827838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005160341.1|1828028_1828751_+	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_005160338.1|1828806_1829316_+	flagella biosynthesis regulatory protein FliZ	NA	NA	NA	NA	NA
WP_013649714.1|1829694_1830687_+	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
WP_005160322.1|1830805_1831606_+	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013649716.1|1831605_1832268_+	cystine ABC transporter permease	NA	NA	NA	NA	NA
WP_005160316.1|1832270_1833026_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G9BWD6	Planktothrix_phage	41.4	7.1e-33
WP_005160301.1|1833097_1833469_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013649717.1|1833468_1833762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013649718.1|1834061_1838051_-	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_013649719.1|1838576_1840061_+	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_005160269.1|1840225_1840555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005160265.1|1840558_1841626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005177992.1|1842416_1843277_+	iron permease	NA	NA	NA	NA	NA
WP_032904699.1|1843293_1844424_+	iron uptake system protein EfeO	NA	NA	NA	NA	NA
WP_013649721.1|1844432_1845734_+	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_005160258.1|1845935_1846535_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_013649722.1|1846704_1847187_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005160254.1|1847520_1848699_+	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
WP_005177999.1|1848709_1848850_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005178006.1|1850316_1850865_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	64.5	1.9e-27
WP_013649723.1|1850914_1851505_-	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_013649724.1|1851516_1852353_-	pyrimidine utilization protein D	NA	NA	NA	NA	NA
WP_072075717.1|1852385_1852775_-	pyrimidine utilization protein C	NA	NA	NA	NA	NA
WP_072077028.1|1852821_1853514_-	pyrimidine utilization protein B	NA	NA	NA	NA	NA
WP_042663910.1|1854164_1854833_+	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
WP_005160227.1|1854890_1856321_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_032904704.1|1858394_1859129_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	40.3	1.8e-49
WP_005160202.1|1859532_1860030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005160200.1|1860111_1860441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013649731.1|1860585_1862085_+	alpha-amylase	NA	NA	NA	NA	NA
WP_013649732.1|1862336_1862591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005160193.1|1862621_1862960_-	GlpM family protein	NA	NA	NA	NA	NA
WP_005160184.1|1863070_1863295_-	DUF2594 family protein	NA	NA	NA	NA	NA
WP_054540931.1|1863988_1864645_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_032904707.1|1864637_1866470_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_005160174.1|1866528_1867077_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_013649733.1|1867741_1867957_-	phage transcriptional activator, Ogr/Delta	NA	S4TNZ3	Salmonella_phage	60.6	1.1e-18
WP_020282800.1|1868266_1869286_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_042663916.1|1869617_1870685_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	66.6	7.8e-118
WP_004705491.1|1873280_1873400_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_080366163.1|1873414_1873693_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	53.6	5.3e-18
WP_013649736.1|1873838_1874354_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	68.0	2.5e-61
WP_013649737.1|1874365_1875541_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	79.6	5.1e-179
WP_020283266.1|1875850_1876090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072077075.1|1876599_1877484_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	46.3	5.7e-74
WP_013649741.1|1878307_1878628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020283264.1|1878617_1878878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023161045.1|1878953_1879133_+	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	44.8	1.0e-06
WP_005161466.1|1879204_1879465_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_013649743.1|1879471_1879750_+	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
WP_115240297.1|1880414_1881623_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	34.4	8.2e-39
WP_032904715.1|1881953_1882499_-|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	77.1	1.2e-79
WP_013649747.1|1882491_1883400_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	74.2	3.8e-121
WP_005161449.1|1883399_1883756_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	60.0	4.4e-33
WP_013649748.1|1883752_1884388_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	62.4	4.9e-67
WP_005161438.1|1884524_1884797_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_005161435.1|1884777_1885068_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	34.5	8.3e-06
WP_005161434.1|1885133_1886195_+	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_005161432.1|1886233_1886680_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	48.0	9.4e-33
WP_013649749.1|1886676_1887144_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	55.9	3.7e-40
WP_032904717.1|1887245_1887671_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	43.0	3.6e-18
WP_013649751.1|1887674_1888070_-	M15 family metallopeptidase	NA	A9DET4	Yersinia_phage	71.0	5.9e-47
WP_013649752.1|1888056_1888236_-|holin	holin	holin	NA	NA	NA	NA
WP_071822708.1|1888220_1888532_-	hypothetical protein	NA	A0A077KEQ8	Ralstonia_phage	62.4	2.7e-26
WP_005176946.1|1890217_1891420_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	72.0	1.5e-77
WP_005161398.1|1892075_1892993_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013649756.1|1893594_1894014_-	helix-turn-helix domain-containing protein	NA	A0A0M4REM4	Salmonella_phage	31.1	9.8e-16
WP_005161394.1|1894414_1895059_+	CatB-related O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	31.3	8.0e-17
WP_005161392.1|1895201_1895384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013649757.1|1895803_1896223_+	antitermination protein Q	NA	K7PGW2	Enterobacterial_phage	63.9	1.3e-39
WP_005161372.1|1896399_1896576_-	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_005161370.1|1896802_1896979_+	hypothetical protein	NA	B6SD15	Bacteriophage	60.7	2.2e-14
WP_032904719.1|1896980_1897463_+	lysozyme	NA	A0A2H4JCH1	uncultured_Caudovirales_phage	63.8	2.1e-54
WP_005161363.1|1897835_1898720_+	triacylglycerol lipase	NA	NA	NA	NA	NA
WP_005161358.1|1899021_1899678_+	DUF533 domain-containing protein	NA	NA	NA	NA	NA
WP_013649759.1|1899784_1900669_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013649760.1|1900803_1901970_+	class C beta-lactamase	NA	NA	NA	NA	NA
WP_013649761.1|1902116_1903208_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_005161346.1|1903475_1903934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013649762.1|1903988_1904582_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005161340.1|1904913_1905186_+	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_038892212.1|1905239_1905488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004390739.1|1905672_1906620_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	38.2	2.7e-45
WP_013649763.1|1906817_1907699_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_013649764.1|1907700_1908324_-	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_013649765.1|1908629_1909892_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP011286	Yersinia enterocolitica strain KNG22703, complete genome	4581645	1982639	2045962	4581645	protease,transposase,tRNA,coat	Bacillus_virus(20.0%)	58	NA	NA
WP_013649793.1|1982639_1984436_+|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	26.0	3.8e-08
WP_005178749.1|1984523_1985006_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_005165984.1|1985032_1985776_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005163071.1|1986140_1986662_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	32.4	6.5e-09
WP_013649794.1|1986784_1987402_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_005163065.1|1987437_1988442_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	27.3	8.1e-08
WP_013649795.1|1988492_1989974_-	dipeptide/tripeptide permease DtpB	NA	NA	NA	NA	NA
WP_005163061.1|1990240_1991026_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_005163059.1|1991022_1991781_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	29.8	4.2e-17
WP_013649796.1|1991856_1992819_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_032904209.1|1992833_1994150_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	41.7	1.4e-15
WP_005163051.1|1994233_1995199_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_032904222.1|1995601_1996864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005176946.1|1996977_1998180_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	72.0	1.5e-77
WP_005169197.1|1998323_1999766_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_005163035.1|1999985_2000855_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005163030.1|2001207_2002692_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.6	3.4e-79
WP_005163029.1|2002997_2003639_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_011816518.1|2004320_2004701_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_005163022.1|2004687_2005017_+	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_005163018.1|2005178_2005523_-	RidA family protein	NA	NA	NA	NA	NA
WP_013649799.1|2005651_2007556_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.1	4.2e-90
WP_032904735.1|2007630_2008329_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_032904220.1|2008431_2009037_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_032904219.1|2009377_2011072_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	25.7	1.8e-31
WP_005163003.1|2011166_2012288_+	ribonuclease D	NA	NA	NA	NA	NA
WP_002211180.1|2012417_2012687_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_005163000.1|2012690_2013503_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_013649803.1|2013528_2014215_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_014608974.1|2014762_2015128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005162995.1|2015405_2015678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023161038.1|2015863_2016787_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_013649805.1|2016867_2017524_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_005162992.1|2017638_2018085_+	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005162991.1|2018149_2018506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013649809.1|2020212_2021058_-	EamA family transporter	NA	NA	NA	NA	NA
WP_013649810.1|2021291_2021549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005164915.1|2021710_2022751_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_013649811.1|2022931_2023567_+	glutathione transferase	NA	NA	NA	NA	NA
WP_032904217.1|2023635_2024184_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005164919.1|2024684_2024918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005164921.1|2025640_2026030_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_005164922.1|2026147_2026390_-	YebV family protein	NA	NA	NA	NA	NA
WP_013649813.1|2026502_2028212_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_005164926.1|2028434_2029445_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_032905225.1|2029475_2031917_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_005164928.1|2032003_2032753_-	molecular chaperone	NA	NA	NA	NA	NA
WP_013649814.1|2032799_2033357_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_005164933.1|2033368_2033926_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_072077031.1|2033931_2034486_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_013649816.1|2034795_2036220_-	MFS transporter	NA	NA	NA	NA	NA
WP_013649817.1|2036347_2037268_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032904216.1|2037280_2039911_-	PqiB family protein	NA	NA	NA	NA	NA
WP_013649819.1|2039879_2041127_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_013649820.1|2041367_2041865_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_005170218.1|2041960_2042689_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_013649821.1|2042708_2044784_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	35.4	4.3e-88
WP_005164945.1|2045080_2045962_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 6
NZ_CP011286	Yersinia enterocolitica strain KNG22703, complete genome	4581645	2082247	2090079	4581645	tRNA	Tupanvirus(33.33%)	9	NA	NA
WP_005170086.1|2082247_2084176_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	7.4e-127
WP_011816226.1|2084179_2084731_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	3.4e-16
WP_004713020.1|2084827_2085025_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_004393357.1|2085062_2085419_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_152414234.1|2085487_2085535_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_005161570.1|2085883_2086867_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	5.8e-35
WP_005161568.1|2086881_2089269_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	27.8	1.1e-07
WP_002211830.1|2089273_2089570_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	4.2e-13
WP_005161566.1|2089782_2090079_-	zinc-ribbon domain and TM2 domain-containing protein	NA	M4ZS56	Bacillus_phage	68.8	6.2e-17
>prophage 7
NZ_CP011286	Yersinia enterocolitica strain KNG22703, complete genome	4581645	2459069	2519140	4581645	integrase,transposase,tRNA,tail	Escherichia_phage(25.0%)	49	2446279:2446293	2519659:2519673
2446279:2446293	attL	ACCGCCTGAACGGCA	NA	NA	NA	NA
WP_013649973.1|2459069_2460800_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	35.1	4.5e-91
WP_013649974.1|2460923_2462360_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	39.3	7.6e-84
WP_005169005.1|2462502_2463291_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	73.8	1.6e-88
WP_032904241.1|2463344_2463548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005164388.1|2463819_2464527_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013649976.1|2464742_2465210_-	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_005164390.1|2465206_2466541_-	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_005164391.1|2466530_2468555_-	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_013649978.1|2471714_2472932_-	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_005164396.1|2472982_2473753_-	siderophore-iron reductase FhuF	NA	NA	NA	NA	NA
WP_005164398.1|2473910_2474537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005164400.1|2474626_2475559_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005164401.1|2475609_2476479_-	SAM-dependent methyltransferase TehB	NA	NA	NA	NA	NA
WP_013649980.1|2476623_2476938_-	cytochrome c	NA	NA	NA	NA	NA
WP_005164403.1|2476937_2477426_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_005164408.1|2477415_2478129_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	4.8e-31
WP_013649981.1|2478132_2479290_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_032904240.1|2479279_2480572_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_032904239.1|2480574_2481978_-	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_004390794.1|2482113_2482641_-	iron transporter	NA	NA	NA	NA	NA
WP_014608895.1|2482721_2484659_-	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_013649984.1|2484832_2485351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013649985.1|2485467_2487108_-	MFS transporter	NA	NA	NA	NA	NA
WP_013649986.1|2487219_2488227_-	glutaminase A	NA	NA	NA	NA	NA
WP_013649987.1|2488792_2489572_-	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_013649988.1|2489574_2490198_-	aldolase	NA	A0A077SK32	Escherichia_phage	78.2	6.8e-90
WP_072077066.1|2490194_2491502_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.0	1.0e-135
WP_005164436.1|2491979_2492759_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	63.9	1.7e-82
WP_005164439.1|2493003_2494680_+	two-component system sensor histidine kinase DcuS	NA	NA	NA	NA	NA
WP_005164442.1|2494672_2495392_+	two-component system response regulator DcuR	NA	NA	NA	NA	NA
WP_005164444.1|2495688_2497047_-	2-hydroxycarboxylate transporter family protein	NA	A0A140XAH4	Dickeya_phage	69.9	3.9e-29
WP_020283103.1|2498112_2499618_+	L-asparagine permease	NA	NA	NA	NA	NA
WP_005164450.1|2499766_2500120_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_020283102.1|2500414_2501431_+	ROK family protein	NA	NA	NA	NA	NA
WP_005164455.1|2501667_2502840_+	MFS transporter	NA	NA	NA	NA	NA
WP_005164457.1|2503020_2503839_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_020282947.1|2504895_2506098_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	71.5	7.5e-77
WP_013649992.1|2506290_2506812_-	ricin-type beta-trefoil lectin domain protein	NA	NA	NA	NA	NA
WP_005166647.1|2506949_2507606_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_005176946.1|2508447_2509650_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	72.0	1.5e-77
WP_013649994.1|2509852_2510554_-	PAS and helix-turn-helix domain-containing protein	NA	Q2A088	Sodalis_phage	39.0	7.3e-16
WP_032904248.1|2510607_2511921_-	cytosine permease	NA	NA	NA	NA	NA
WP_005163571.1|2512124_2512889_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_013649997.1|2513803_2515021_+|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	41.0	3.8e-60
WP_005163578.1|2515023_2515476_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	63.2	2.7e-48
WP_013649998.1|2515472_2516615_+	phage late control D family protein	NA	A0A218M4J7	Erwinia_phage	67.3	6.1e-145
WP_071822716.1|2516707_2516929_+	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	66.2	1.3e-22
WP_005163581.1|2517013_2517829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032904249.1|2518141_2519140_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4S6G4	Salmonella_phage	58.0	2.6e-107
2519659:2519673	attR	ACCGCCTGAACGGCA	NA	NA	NA	NA
>prophage 8
NZ_CP011286	Yersinia enterocolitica strain KNG22703, complete genome	4581645	2905839	2971075	4581645	protease,transposase	uncultured_virus(13.33%)	44	NA	NA
WP_005176946.1|2905839_2907042_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	72.0	1.5e-77
WP_013650139.1|2907109_2907760_-	DUF1120 domain-containing protein	NA	NA	NA	NA	NA
WP_072077086.1|2908177_2908312_+|transposase	IS3 family transposase	transposase	Q716C1	Shigella_phage	66.7	8.4e-06
WP_013650144.1|2910433_2911465_+	methyltransferase	NA	NA	NA	NA	NA
WP_013650145.1|2911713_2912448_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_005159375.1|2912723_2914160_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_013650146.1|2914263_2915790_-	PTS-system permease	NA	NA	NA	NA	NA
WP_013650147.1|2915955_2916696_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005159363.1|2916787_2917159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013650148.1|2917465_2917795_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_013650149.1|2917795_2918110_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	48.3	9.5e-16
WP_013650150.1|2918220_2918700_-	antitermination protein Q	NA	K7PGW2	Enterobacterial_phage	59.2	1.4e-34
WP_005159354.1|2918973_2919597_+	helix-turn-helix domain-containing protein	NA	F1C599	Cronobacter_phage	53.2	1.6e-51
WP_005159352.1|2919943_2920186_+	DinI family protein	NA	K7PKM2	Enterobacterial_phage	70.9	5.1e-25
WP_013650151.1|2920350_2921286_+|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_013650152.1|2921612_2923400_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	48.9	6.2e-11
WP_020283006.1|2923469_2924483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005159340.1|2924872_2926399_+	MFS transporter	NA	NA	NA	NA	NA
WP_005171542.1|2926578_2927721_+	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	NA	NA	NA	NA
WP_005159330.1|2928235_2929339_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.9	4.6e-113
WP_013650153.1|2931787_2932942_+	MFS transporter	NA	NA	NA	NA	NA
WP_013650154.1|2932964_2935658_+	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_013650155.1|2935660_2936308_+	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_020283005.1|2936569_2939437_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	28.4	5.8e-43
WP_020282800.1|2939701_2940721_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_054540936.1|2941115_2943773_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	A0A172JHV7	Bacillus_phage	30.9	1.8e-102
WP_032904274.1|2943976_2944705_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_013650159.1|2945221_2947507_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	65.1	9.3e-286
WP_005159298.1|2947592_2948723_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.4	4.0e-173
WP_013650160.1|2948802_2949108_+	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	56.1	4.3e-21
WP_020283002.1|2949367_2949874_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_013650162.1|2949960_2955381_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_054540937.1|2955392_2956142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013650165.1|2956376_2957579_-	nicotinamide mononucleotide deamidase-related protein YfaY	NA	NA	NA	NA	NA
WP_005159280.1|2957932_2959141_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_013650166.1|2959338_2959881_-	membrane protein	NA	NA	NA	NA	NA
WP_020282999.1|2960235_2961678_+	catalase	NA	A0A2K9L0T1	Tupanvirus	38.1	3.8e-99
WP_013650167.1|2962327_2963722_-	o-succinylbenzoate--CoA ligase	NA	NA	NA	NA	NA
WP_013650168.1|2963709_2964681_-	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_013650169.1|2964680_2965538_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_085903015.1|2965551_2966379_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_005159264.1|2966372_2968046_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_013650170.1|2968274_2969639_-	isochorismate synthase MenF	NA	NA	NA	NA	NA
WP_005176946.1|2969872_2971075_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	72.0	1.5e-77
>prophage 9
NZ_CP011286	Yersinia enterocolitica strain KNG22703, complete genome	4581645	3578655	3646114	4581645	integrase,transposase,tRNA,protease	Bacillus_phage(11.11%)	55	3586537:3586563	3650379:3650405
WP_020282800.1|3578655_3579675_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_013649351.1|3580178_3581261_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_013649350.1|3581653_3582961_+	MFS transporter	NA	NA	NA	NA	NA
WP_013649349.1|3582987_3585363_+	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_011817011.1|3585439_3585856_-	DUF2000 domain-containing protein	NA	NA	NA	NA	NA
WP_013649348.1|3585989_3586460_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
3586537:3586563	attL	GAAGAGTAAAGCGTCCGCGCCAGGGAT	NA	NA	NA	NA
WP_005166619.1|3588060_3589305_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.9	3.1e-17
WP_005166615.1|3589387_3589783_-	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_005166614.1|3591008_3591209_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_005176946.1|3591351_3592554_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	72.0	1.5e-77
WP_005166024.1|3592660_3593059_-	type II toxin-antitoxin system MqsA family antitoxin	NA	NA	NA	NA	NA
WP_005166025.1|3593058_3593355_-	type II toxin-antitoxin system MqsR family toxin	NA	NA	NA	NA	NA
WP_005166026.1|3593511_3593874_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005166028.1|3593939_3594200_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	36.0	2.5e-06
WP_032904770.1|3595413_3595878_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_032904342.1|3596117_3596612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032904343.1|3596654_3597824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032904344.1|3597931_3598495_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	38.8	1.8e-20
WP_032904345.1|3598703_3599138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005180650.1|3600473_3601982_+|transposase	IS21-like element ISYen2A family transposase	transposase	A0A2L1IVA1	Escherichia_phage	31.2	1.1e-21
WP_013649170.1|3601968_3602694_+	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	33.3	4.4e-32
WP_013649345.1|3602677_3604555_-|integrase	site-specific integrase	integrase	A0A059XK29	uncultured_phage	25.5	7.3e-10
WP_013649344.1|3604888_3606406_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	37.6	2.3e-86
WP_020282590.1|3606415_3607514_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	5.4e-05
WP_013649343.1|3607959_3609693_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.7	2.8e-64
WP_013649342.1|3609699_3610416_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_005166040.1|3610464_3611364_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	30.2	2.1e-31
WP_005166042.1|3611470_3611989_+	flavodoxin FldB	NA	NA	NA	NA	NA
WP_013649341.1|3612047_3613469_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_032904346.1|3613560_3614988_-	two-component system sensor histidine kinase CreC	NA	NA	NA	NA	NA
WP_005166045.1|3614998_3615697_-	two-component system response regulator CreB	NA	NA	NA	NA	NA
WP_005166047.1|3615696_3616122_-	membrane protein	NA	NA	NA	NA	NA
WP_013649338.1|3616102_3616369_-	FAD assembly factor SdhE	NA	NA	NA	NA	NA
WP_005166051.1|3616635_3617628_+|tRNA	tRNA-modifying protein YgfZ	tRNA	NA	NA	NA	NA
WP_020282800.1|3617823_3618843_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_013649336.1|3619254_3619938_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_013649335.1|3620168_3620771_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_013649334.1|3620783_3621533_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.5	2.6e-27
WP_013649333.1|3621548_3621986_-	lipocalin-like domain-containing protein	NA	NA	NA	NA	NA
WP_013649332.1|3622319_3625208_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	52.7	9.4e-267
WP_005164125.1|3625307_3625694_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_013649331.1|3625760_3626858_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_013649330.1|3627250_3628465_-	FAD-dependent 2-octaprenylphenol hydroxylase	NA	NA	NA	NA	NA
WP_005164121.1|3628552_3629722_-	2-octaprenyl-6-methoxyphenyl hydroxylase	NA	NA	NA	NA	NA
WP_005164115.1|3629725_3631039_-	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
WP_005164114.1|3631093_3631672_-	YecA family protein	NA	NA	NA	NA	NA
WP_004706812.1|3632127_3632457_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_005164106.1|3632960_3633557_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_005164105.1|3633702_3634998_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.0	2.2e-130
WP_013649329.1|3635077_3636715_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.7	1.6e-154
WP_013649328.1|3636926_3637763_-	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_005164102.1|3638050_3640285_-	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_005167240.1|3640294_3641626_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.4	3.9e-34
WP_050330922.1|3641682_3644565_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	29.2	2.7e-48
WP_013649325.1|3644677_3646114_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	31.0	5.0e-27
3650379:3650405	attR	GAAGAGTAAAGCGTCCGCGCCAGGGAT	NA	NA	NA	NA
>prophage 1
NZ_CP011287	Yersinia enterocolitica strain KNG22703 plasmid, complete sequence	69433	57244	64930	69433	transposase	uncultured_Caudovirales_phage(57.14%)	9	NA	NA
WP_054540950.1|57244_58567_+	trimeric autotransporter adhesin YadA	NA	Q9MCI8	Enterobacteria_phage	55.6	2.4e-12
WP_013749484.1|58636_59512_+	DMT family transporter	NA	NA	NA	NA	NA
WP_010891241.1|59833_60286_-	PprA	NA	NA	NA	NA	NA
WP_071598611.1|60441_61278_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.5	4.2e-18
WP_010891243.1|61453_62035_+	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	35.5	2.6e-22
WP_010891244.1|62052_62478_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	5.6e-51
WP_010891245.1|62490_63780_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	70.2	1.6e-165
WP_013749489.1|63825_64146_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	46.7	1.7e-20
WP_013749490.1|64231_64930_+	arsenic resistance NADPH-dependent reductase ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.5	7.7e-90
