The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012513	Salmonella enterica subsp. enterica serovar Thompson strain RM1984 chromosome, complete genome	4708710	1039437	1141316	4708710	integrase,tail,terminase,holin,capsid,protease,lysis,portal,tRNA,head	Salmonella_phage(45.45%)	101	1042346:1042365	1118504:1118523
WP_001154028.1|1039437_1040241_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1040233_1041556_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1041536_1042241_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_017465607.1|1042240_1046707_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
1042346:1042365	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_017465608.1|1047051_1048899_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1049156_1049705_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1049732_1050380_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1050441_1051632_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977709.1|1051816_1052908_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	1.7e-99
WP_000117867.1|1053513_1054914_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.8	4.5e-81
WP_000762342.1|1055114_1055576_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_021294193.1|1055892_1057107_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_017465610.1|1057352_1058786_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_017465611.1|1058866_1060069_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262307.1|1060263_1061556_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	100.0	3.4e-253
WP_000065276.1|1061600_1061849_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1061889_1062129_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_010835407.1|1062171_1063329_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	7.9e-217
WP_001750117.1|1063291_1066219_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.8	0.0e+00
WP_001750116.1|1066345_1066696_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	96.6	3.2e-60
WP_001750115.1|1067284_1067491_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	69.1	4.3e-17
WP_001750114.1|1067517_1068459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001230956.1|1068564_1068960_-	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	72.5	3.5e-47
WP_000992434.1|1069064_1069301_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	73.1	9.0e-27
WP_010835408.1|1069266_1069641_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_001540689.1|1069725_1070709_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_001750113.1|1070711_1071461_+	ATP-binding protein	NA	H6WRX8	Salmonella_phage	99.2	7.3e-139
WP_000113626.1|1071471_1071819_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	100.0	4.5e-59
WP_000065089.1|1071815_1072136_+	hypothetical protein	NA	H6WRY0	Salmonella_phage	65.5	6.7e-25
WP_000974174.1|1072135_1072381_+	hypothetical protein	NA	Q5G8U9	Enterobacteria_phage	88.9	3.0e-33
WP_000132543.1|1072691_1073909_+	hypothetical protein	NA	J9Q803	Salmonella_phage	53.3	3.1e-118
WP_107251218.1|1073889_1073958_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_000802853.1|1074051_1074378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217669.1|1074625_1074859_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_014343878.1|1074975_1075224_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_001750112.1|1075258_1075861_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_001096547.1|1076069_1076681_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	99.5	4.2e-92
WP_001617856.1|1076677_1076824_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047630.1|1076813_1077611_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	4.0e-151
WP_001534733.1|1078009_1078135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|1078270_1078720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001574216.1|1080042_1080372_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984583.1|1080355_1080808_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.7	4.6e-80
WP_031607240.1|1080825_1081275_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	90.4	6.1e-64
WP_001252721.1|1081603_1082107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001750111.1|1082363_1082765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001102153.1|1083050_1083596_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000623092.1|1083567_1085499_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	1.3e-259
WP_000201415.1|1085482_1085686_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000831821.1|1085682_1087263_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_001189498.1|1087252_1088749_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	1.1e-96
WP_000011260.1|1088761_1089109_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_000522566.1|1089163_1090192_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000201485.1|1090249_1090615_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_000083293.1|1090625_1091003_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	1.5e-28
WP_000677089.1|1090989_1091568_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000033885.1|1091564_1091966_+|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000971953.1|1091973_1092720_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000479607.1|1092770_1093166_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_010989052.1|1093162_1093501_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000372075.1|1093472_1096568_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	61.7	4.8e-277
WP_000447370.1|1096570_1096900_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	71.3	7.3e-43
WP_001152686.1|1096909_1097608_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	75.9	1.6e-103
WP_000662738.1|1097614_1098352_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	84.2	9.8e-128
WP_001750110.1|1098249_1098897_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	78.1	1.6e-89
WP_000514902.1|1098958_1102321_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.5	0.0e+00
WP_000178849.1|1102359_1102602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023193196.1|1102655_1105151_+|tail	Gifsy-2 prophage tail fiber protein	tail	E5G6P0	Salmonella_phage	76.1	7.3e-159
WP_000143168.1|1105150_1105732_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.3e-94
WP_010835411.1|1106561_1108052_-	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	98.6	1.6e-254
WP_001536069.1|1108619_1109420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497440.1|1109895_1110102_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	100.0	1.8e-31
WP_000193775.1|1110528_1113141_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	3.7e-20
WP_000291723.1|1113348_1114359_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1114524_1115067_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224072.1|1115063_1116173_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|1116271_1118380_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1118392_1120300_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1118504:1118523	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_017465789.1|1120314_1121568_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_017465790.1|1121572_1123213_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1123209_1123773_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1124028_1124196_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1124295_1124814_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_017465791.1|1124882_1126643_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_017465792.1|1126828_1127281_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1127352_1128405_-	porin OmpA	NA	NA	NA	NA	NA
WP_017465793.1|1128762_1129272_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1129488_1130094_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950861.1|1130080_1132234_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1132252_1132699_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_017465794.1|1132822_1134877_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|1134912_1135371_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|1135465_1136128_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001537782.1|1136301_1136715_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1136759_1137077_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1137134_1138346_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859416.1|1138560_1139109_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_017465795.1|1139134_1139914_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|1139962_1140244_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1140240_1140570_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374046.1|1140656_1141316_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
>prophage 2
NZ_CP012513	Salmonella enterica subsp. enterica serovar Thompson strain RM1984 chromosome, complete genome	4708710	2038983	2049599	4708710		Morganella_phage(25.0%)	12	NA	NA
WP_001157305.1|2038983_2040414_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377042.1|2040487_2041183_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_017465543.1|2041262_2041574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017465542.1|2042223_2043435_+	porin	NA	Q1MVN1	Enterobacteria_phage	56.2	4.4e-109
WP_024131163.1|2043694_2043883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2043893_2044106_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_017465541.1|2044560_2045829_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.7	3.5e-226
WP_000394197.1|2045831_2046251_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_001532308.1|2046377_2046539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017465540.1|2047019_2047817_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001736108.1|2048188_2048479_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	49.1	3.0e-08
WP_017465538.1|2049125_2049599_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	76.6	1.6e-38
>prophage 3
NZ_CP012513	Salmonella enterica subsp. enterica serovar Thompson strain RM1984 chromosome, complete genome	4708710	2220057	2229228	4708710	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195330.1|2220057_2222091_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703143.1|2222331_2222790_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	71.9	2.4e-52
WP_017465874.1|2222961_2223492_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2223548_2224016_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2224062_2224782_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272850.1|2224778_2226464_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_001240418.1|2226686_2227418_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2227477_2227585_+	protein YohO	NA	NA	NA	NA	NA
WP_000824854.1|2227565_2228297_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569168.1|2228280_2229228_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
>prophage 4
NZ_CP012513	Salmonella enterica subsp. enterica serovar Thompson strain RM1984 chromosome, complete genome	4708710	4270729	4291178	4708710	plate,tail	Burkholderia_phage(40.0%)	25	NA	NA
WP_022544687.1|4270729_4271458_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	7.3e-35
WP_017465885.1|4272196_4272652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017465886.1|4272648_4273254_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_017465887.1|4273258_4275028_-|tail	tail protein	tail	A0A0M3ULH6	Salmonella_phage	40.5	3.2e-52
WP_000359504.1|4275030_4275663_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	1.1e-23
WP_000951730.1|4275655_4276771_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	3.1e-101
WP_001093501.1|4276761_4277121_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001095011.1|4277284_4278832_-	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_000703628.1|4278831_4279761_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	7.9e-151
WP_000593184.1|4279757_4280120_-	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
WP_017465888.1|4280447_4281170_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_017465889.1|4281179_4282223_-	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.9	6.5e-77
WP_017465890.1|4282210_4282420_-	membrane protein	NA	A4JWL2	Burkholderia_virus	58.8	2.8e-16
WP_017465891.1|4282419_4283373_-	hypothetical protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262486.1|4283372_4285727_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.9	4.0e-66
WP_001185654.1|4285823_4285952_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003639.1|4285911_4286229_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|4286280_4286805_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729852.1|4286804_4288232_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|4288221_4288419_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|4288415_4288871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017465892.1|4289031_4289346_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.2	1.1e-19
WP_017465893.1|4289358_4289964_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	4.2e-60
WP_001226439.1|4289966_4290254_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	3.0e-16
WP_000615248.1|4290830_4291178_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
