The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	0	13109	3858284	holin,transposase,tail	Bacillus_phage(50.0%)	14	NA	NA
WP_179946414.1|473_2309_+|tail	phage tail protein	tail	A0A0U4B063	Bacillus_phage	48.6	9.6e-100
WP_156418601.1|2425_2935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068440007.1|3109_3517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068440011.1|3479_3749_+|holin	phage holin	holin	J7KDR1	Streptococcus_phage	51.8	2.3e-18
WP_068440014.1|3750_4299_+	N-acetylmuramoyl-L-alanine amidase	NA	D6QWM8	uncultured_phage	35.3	3.2e-06
WP_068440018.1|4328_4979_+	hypothetical protein	NA	U5PU59	Bacillus_phage	51.9	6.2e-09
WP_068448039.1|5072_5312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169792839.1|5865_6036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068440021.1|6126_6312_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_068440028.1|6610_7741_+	hypothetical protein	NA	H0USY1	Bacillus_phage	45.1	2.7e-76
WP_068448041.1|7682_8273_+	replication-relaxation family protein	NA	M5AC25	Bacillus_phage	35.5	3.9e-26
WP_068440029.1|8322_8652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068440031.1|9413_10580_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A191SB13	Nostoc_phage	32.5	3.9e-38
WP_068440034.1|10748_13109_+	N-6 DNA methylase	NA	A0A2R2ZGH5	Clostridioides_phage	26.4	4.0e-66
>prophage 2
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	24193	27313	3858284		Bacillus_phage(50.0%)	2	NA	NA
WP_068440074.1|24193_25453_+	C40 family peptidase	NA	A0A0H4TGB4	Bacillus_phage	48.1	7.5e-19
WP_068448045.1|25813_27313_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.8	2.9e-17
>prophage 3
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	33373	36615	3858284		Organic_Lake_phycodnavirus(50.0%)	3	NA	NA
WP_068440096.1|33373_34129_-	metal ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.1	2.7e-16
WP_068440099.1|34142_35087_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_068440100.1|35760_36615_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	36.9	4.0e-40
>prophage 4
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	45754	46783	3858284		Planktothrix_phage(100.0%)	1	NA	NA
WP_068440129.1|45754_46783_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.3	1.9e-28
>prophage 5
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	53718	54681	3858284		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_068440146.1|53718_54681_+	ornithine carbamoyltransferase	NA	M1I6M4	Paramecium_bursaria_Chlorella_virus	26.7	2.7e-21
>prophage 6
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	57774	61529	3858284		Pithovirus(33.33%)	4	NA	NA
WP_068440154.1|57774_58560_+	Fe-S cluster assembly ATPase SufC	NA	W5SAS9	Pithovirus	22.9	2.8e-08
WP_068440157.1|58577_59888_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_068440158.1|59887_61108_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	47.4	3.6e-119
WP_068440162.1|61097_61529_+	SUF system NifU family Fe-S cluster assembly protein	NA	A0A2P1CJL8	Mycobacterium_phage	35.8	2.5e-14
>prophage 7
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	69636	70494	3858284		Microcystis_virus(100.0%)	1	NA	NA
WP_156418766.1|69636_70494_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A7K9	Microcystis_virus	33.6	1.9e-05
>prophage 8
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	86735	88737	3858284	transposase	Leptospira_phage(100.0%)	2	NA	NA
WP_068448053.1|86735_88313_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	35.9	2.4e-70
WP_082684070.1|88380_88737_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.0	2.3e-18
>prophage 9
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	97691	102628	3858284		Bacillus_virus(25.0%)	7	NA	NA
WP_068440280.1|97691_98204_-	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	57.0	4.1e-40
WP_068440283.1|98288_99260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068440286.1|99343_100306_+	D-glycerate dehydrogenase	NA	Q89388	Paramecium_bursaria_Chlorella_virus	27.5	1.1e-22
WP_068440289.1|100349_100574_-	NifU family protein	NA	NA	NA	NA	NA
WP_068440291.1|100718_101045_+	YuzD family protein	NA	NA	NA	NA	NA
WP_068440295.1|101155_101512_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	34.9	2.3e-13
WP_068440298.1|101641_102628_-	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	47.6	1.9e-30
>prophage 10
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	108534	109191	3858284		Bacillus_phage(100.0%)	1	NA	NA
WP_082684071.1|108534_109191_+	3D domain-containing protein	NA	A0A127AW72	Bacillus_phage	42.3	8.4e-14
>prophage 11
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	113343	113928	3858284		Spodoptera_frugiperda_granulovirus(100.0%)	1	NA	NA
WP_068440334.1|113343_113928_+	superoxide dismutase family protein	NA	A0A0C5AQ67	Spodoptera_frugiperda_granulovirus	40.5	2.9e-10
>prophage 12
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	121574	125921	3858284		Bacillus_phage(100.0%)	1	NA	NA
WP_082684276.1|121574_125921_+	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	34.9	1.2e-20
>prophage 13
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	130242	131475	3858284	transposase	Lysinibacillus_phage(100.0%)	1	NA	NA
WP_068440383.1|130242_131475_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	24.4	1.3e-07
>prophage 14
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	140900	155241	3858284		Tupanvirus(33.33%)	12	NA	NA
WP_068440400.1|140900_141734_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.5	2.9e-11
WP_068440403.1|141893_142211_+	hydrolase	NA	NA	NA	NA	NA
WP_156418609.1|142423_142630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068440409.1|142821_143397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068440412.1|144059_145646_-	peptide chain release factor 3	NA	A0A2K9L2P9	Tupanvirus	34.3	4.5e-13
WP_068440417.1|146180_146480_+	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	44.4	1.7e-17
WP_082684072.1|146536_147109_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_068440425.1|147395_149543_+	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	31.7	5.3e-81
WP_068440427.1|149720_150023_+	metal-sensitive transcriptional regulator	NA	NA	NA	NA	NA
WP_068440429.1|150040_152425_+	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.9	1.2e-118
WP_068440432.1|152509_152716_+	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_068440436.1|153108_155241_+	catalase	NA	A0A2K9L572	Tupanvirus	51.1	7.4e-152
>prophage 15
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	163935	164865	3858284		Indivirus(100.0%)	1	NA	NA
WP_068440465.1|163935_164865_+	cation transporter	NA	A0A1V0SED0	Indivirus	26.4	1.7e-20
>prophage 16
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	173072	174539	3858284		Mycobacterium_phage(100.0%)	1	NA	NA
WP_068440486.1|173072_174539_+	multidrug efflux MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	22.2	1.2e-12
>prophage 17
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	227148	238558	3858284		Bacillus_phage(83.33%)	9	NA	NA
WP_068440635.1|227148_227916_+	2,4-dienoyl-CoA reductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	41.3	1.6e-43
WP_068440638.1|228501_228951_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_068440641.1|229055_229307_+	YkuS family protein	NA	NA	NA	NA	NA
WP_068440645.1|229462_230296_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_068440647.1|230458_230908_+	redoxin domain-containing protein	NA	A0A127AW88	Bacillus_phage	36.6	3.2e-25
WP_068440650.1|231059_232808_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.3	4.6e-51
WP_068440654.1|232823_234659_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.0	3.8e-56
WP_068440657.1|235109_236828_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.7	3.0e-26
WP_068440659.1|236824_238558_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	24.8	7.4e-33
>prophage 18
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	244759	245311	3858284		Synechococcus_phage(100.0%)	1	NA	NA
WP_068440679.1|244759_245311_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	45.0	9.8e-16
>prophage 19
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	250221	253613	3858284		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_068440695.1|250221_251628_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.7	1.3e-48
WP_169792894.1|251996_253613_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	27.6	9.3e-22
>prophage 20
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	270062	271916	3858284		Flavobacterium_phage(100.0%)	1	NA	NA
WP_068440734.1|270062_271916_+	cytochrome c oxidase subunit I	NA	R9VX24	Flavobacterium_phage	33.9	3.6e-09
>prophage 21
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	276530	276959	3858284		Macacine_betaherpesvirus(100.0%)	1	NA	NA
WP_068440757.1|276530_276959_+	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	35.8	9.0e-17
>prophage 22
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	280971	281460	3858284		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_068440775.1|280971_281460_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.5	2.9e-27
>prophage 23
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	287434	287917	3858284		Bacillus_phage(100.0%)	1	NA	NA
WP_068440800.1|287434_287917_+	RsfA family transcriptional regulator	NA	A0A1D6X8E5	Bacillus_phage	30.7	8.9e-05
>prophage 24
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	308746	310366	3858284		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_068440842.1|308746_309466_+	RNA polymerase sporulation sigma factor SigE	NA	A0A2H4JC68	uncultured_Caudovirales_phage	40.1	6.8e-17
WP_068440845.1|309586_310366_+	RNA polymerase sporulation sigma factor SigG	NA	A0A0Y0AU18	Bacillus_phage	46.2	1.6e-48
>prophage 25
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	315288	325602	3858284	tRNA	Klosneuvirus(25.0%)	7	NA	NA
WP_068440863.1|315288_318045_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	27.7	1.7e-87
WP_068440866.1|318657_319152_+	signal peptidase II	NA	NA	NA	NA	NA
WP_068440870.1|319120_320023_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_068440873.1|320905_322294_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	33.9	1.3e-53
WP_068440878.1|322351_323272_+	aspartate carbamoyltransferase catalytic subunit	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	30.8	7.6e-29
WP_068440880.1|323231_324515_+	dihydroorotase	NA	NA	NA	NA	NA
WP_068440884.1|324507_325602_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.1	1.8e-56
>prophage 26
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	331151	331766	3858284		Pandoravirus(100.0%)	1	NA	NA
WP_068440897.1|331151_331766_+	orotate phosphoribosyltransferase	NA	A0A0B5IW17	Pandoravirus	31.2	3.1e-26
>prophage 27
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	335344	348345	3858284	tRNA	Paramecium_bursaria_Chlorella_virus(20.0%)	10	NA	NA
WP_068440905.1|335344_337999_+	cation-translocating P-type ATPase	NA	M1HRW9	Paramecium_bursaria_Chlorella_virus	28.6	3.7e-84
WP_068440907.1|338195_338462_+	DUF370 domain-containing protein	NA	NA	NA	NA	NA
WP_068440911.1|338473_339088_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	35.5	7.8e-22
WP_068448081.1|339095_339299_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_068440914.1|339393_340602_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.3	5.1e-41
WP_068440916.1|340598_343007_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_068440920.1|343038_343980_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	34.4	1.7e-12
WP_068440923.1|343980_345327_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_068440926.1|345535_346291_+	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
WP_068440929.1|346290_348345_+	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.4	7.7e-21
>prophage 28
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	353924	355208	3858284		Moraxella_phage(100.0%)	1	NA	NA
WP_068440952.1|353924_355208_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	26.6	5.8e-27
>prophage 29
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	361824	363677	3858284		Chrysochromulina_ericina_virus(33.33%)	3	NA	NA
WP_068440972.1|361824_362565_+	3-oxoacyl-[acyl-carrier-protein] reductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.6	8.9e-12
WP_068440975.1|362668_362905_+	acyl carrier protein	NA	K4FB26	Cronobacter_phage	50.9	3.3e-05
WP_068440979.1|362978_363677_+	ribonuclease III	NA	K7YH73	Megavirus	33.6	6.2e-23
>prophage 30
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	377673	387394	3858284	protease	Emiliania_huxleyi_virus(20.0%)	8	NA	NA
WP_068441020.1|377673_378435_+	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	41.8	5.3e-28
WP_068441027.1|378894_380055_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_068441030.1|380098_381001_+	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_068441035.1|381068_381962_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	41.7	3.0e-30
WP_068441037.1|382066_384145_+	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	34.6	2.1e-103
WP_082684085.1|384489_385434_+	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	28.6	1.2e-29
WP_179946429.1|385435_385972_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_068441040.1|385987_387394_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	27.1	1.2e-38
>prophage 31
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	392126	407262	3858284	protease,tRNA	Flavobacterium_phage(25.0%)	13	NA	NA
WP_068441061.1|392126_392888_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	48.4	2.0e-27
WP_068441065.1|392900_393695_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_068441067.1|393762_395022_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_068441070.1|395486_399779_+	PolC-type DNA polymerase III	NA	A0A0A7RWA3	Clostridium_phage	43.1	1.1e-26
WP_068441074.1|400164_400635_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_068441076.1|400651_401764_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_068441079.1|401776_402055_+	YlxR family protein	NA	NA	NA	NA	NA
WP_068441082.1|402047_402350_+	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_068441085.1|402366_404526_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.4	4.7e-21
WP_068441088.1|404522_404801_+	DUF503 domain-containing protein	NA	NA	NA	NA	NA
WP_068441091.1|404944_405286_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_068441094.1|405399_406299_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_068441098.1|406320_407262_+	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SD03	Indivirus	32.3	1.7e-07
>prophage 32
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	411206	419347	3858284	integrase	Anoxybacillus_phage(28.57%)	10	408606:408619	422279:422292
408606:408619	attL	CAGGAAATCATCCG	NA	NA	NA	NA
WP_068441110.1|411206_412436_+	insulinase family protein	NA	G3MBJ8	Bacillus_virus	34.3	1.6e-53
WP_068441112.1|412546_412783_+	YlmC/YmxH family sporulation protein	NA	NA	NA	NA	NA
WP_068441114.1|413829_414432_+	dipicolinate synthase subunit B	NA	NA	NA	NA	NA
WP_068441117.1|414498_415725_-|integrase	site-specific integrase	integrase	A0A0C5AN64	Paenibacillus_phage	37.2	1.8e-57
WP_068441119.1|415846_416353_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	32.9	3.3e-18
WP_068441122.1|416453_416861_-	helix-turn-helix transcriptional regulator	NA	A0A2P1JU09	Anoxybacillus_phage	55.7	8.3e-20
WP_068441124.1|417020_417257_+	helix-turn-helix transcriptional regulator	NA	A0A2P1JU05	Anoxybacillus_phage	55.4	1.4e-16
WP_068441128.1|417256_417568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068441131.1|417641_418157_+	helix-turn-helix transcriptional regulator	NA	A0A290FZK9	Caldibacillus_phage	36.4	3.5e-23
WP_068441134.1|418639_419347_+	DnaD domain protein	NA	A0A1L2JY26	Aeribacillus_phage	59.2	1.8e-54
422279:422292	attR	CGGATGATTTCCTG	NA	NA	NA	NA
>prophage 33
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	448459	457623	3858284		Staphylococcus_phage(25.0%)	8	NA	NA
WP_068441247.1|448459_449950_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	22.2	3.8e-30
WP_068441250.1|449946_451098_+	thiolase family protein	NA	NA	NA	NA	NA
WP_068441253.1|451098_451455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068441255.1|451894_452236_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_068441258.1|452265_453066_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.7	3.1e-18
WP_068441261.1|453050_453905_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.4	6.4e-14
WP_068441264.1|453897_454704_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_082684278.1|455307_457623_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	29.9	3.3e-73
>prophage 34
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	466937	467192	3858284		Bacillus_phage(100.0%)	1	NA	NA
WP_068441296.1|466937_467192_+	hypothetical protein	NA	A0A172JI00	Bacillus_phage	44.6	1.4e-12
>prophage 35
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	473396	474521	3858284		Bacillus_virus(100.0%)	1	NA	NA
WP_068441317.1|473396_474521_+	peptidoglycan DD-metalloendopeptidase family protein	NA	G3MBP9	Bacillus_virus	29.8	1.5e-15
>prophage 36
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	478021	563371	3858284	integrase,transposase,coat,tRNA	Listeria_phage(16.67%)	73	492880:492897	564579:564596
WP_068441154.1|478021_479383_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_068441328.1|482134_482362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169792846.1|482491_482830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082684279.1|482977_484276_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_169792847.1|484573_485809_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_068448095.1|485834_486038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068441338.1|486105_486645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068441341.1|486703_487918_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_068441344.1|488241_489036_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_068441346.1|489278_489497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068441348.1|490040_490793_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_169792848.1|491684_492680_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_068441354.1|492821_493298_+	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
492880:492897	attL	TTTTATTAATATTAATTC	NA	NA	NA	NA
WP_068441357.1|493317_494814_+	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_068441358.1|494897_496337_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_068441361.1|496462_497485_+	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_068441363.1|497486_499001_+	xylulokinase	NA	NA	NA	NA	NA
WP_068441365.1|499311_500694_+	adenylosuccinate lyase family protein	NA	NA	NA	NA	NA
WP_068441368.1|500724_502182_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_068441371.1|502208_502970_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_068441374.1|503936_504950_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_068448098.1|505054_506179_+	mandelate racemase/muconate lactonizing enzyme family protein	NA	NA	NA	NA	NA
WP_068441377.1|506212_507655_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_082684100.1|507724_508549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068441383.1|508576_509131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068441385.1|509150_509912_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_169792849.1|509934_511038_+	TRAP transporter substrate-binding protein DctP	NA	NA	NA	NA	NA
WP_068441390.1|511395_512721_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_068441394.1|512742_513267_+	TRAP transporter small permease subunit	NA	NA	NA	NA	NA
WP_169792847.1|513714_514950_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_068448095.1|514975_515179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068441406.1|517464_518754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068441410.1|520580_521627_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_068441413.1|521642_522878_+	aspartate kinase	NA	NA	NA	NA	NA
WP_068441415.1|523067_523934_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_082684280.1|524995_525199_+	YlzJ-like family protein	NA	NA	NA	NA	NA
WP_068448099.1|525382_527674_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	47.0	1.4e-84
WP_068441420.1|527912_528638_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_068441423.1|528743_529871_+	BMP family protein	NA	NA	NA	NA	NA
WP_068441426.1|530558_532088_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	25.3	8.2e-12
WP_068441429.1|532084_533131_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_068441432.1|533131_534091_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_068441435.1|535496_536780_+	insulinase family protein	NA	NA	NA	NA	NA
WP_068441439.1|536788_537511_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_068441442.1|537579_537837_+	DUF3243 domain-containing protein	NA	NA	NA	NA	NA
WP_068441444.1|537991_538777_+	DUF3388 domain-containing protein	NA	NA	NA	NA	NA
WP_068441447.1|538880_539798_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_068448101.1|539872_540451_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_068441450.1|540450_541695_+	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_068441454.1|541876_542920_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	72.2	2.3e-130
WP_068441457.1|543350_544916_+	ribonuclease Y	NA	NA	NA	NA	NA
WP_068441460.1|545010_545808_+	TIGR00282 family metallophosphoesterase	NA	NA	NA	NA	NA
WP_068441464.1|545954_546215_+	stage V sporulation protein S	NA	A0A1J0GVV0	Streptomyces_phage	39.5	1.8e-07
WP_068441467.1|546357_547938_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_068441469.1|547939_548368_+	RicAFT regulatory complex protein RicA family protein	NA	NA	NA	NA	NA
WP_068441473.1|548506_549073_+|coat	outer spore coat protein CotE	coat	NA	NA	NA	NA
WP_068441476.1|549198_551769_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	26.7	9.8e-42
WP_068448103.1|551788_553654_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	31.6	2.8e-70
WP_068441479.1|553737_554889_-|integrase	site-specific integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	40.3	3.8e-78
WP_068441482.1|554957_555617_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_068441486.1|555837_556245_-	helix-turn-helix transcriptional regulator	NA	A0A0B5CYL9	Listeria_phage	32.3	3.2e-11
WP_068441489.1|556388_556613_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_068441492.1|556631_556949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068441495.1|557016_557532_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_068441498.1|557553_558348_+	phage replisome organizer N-terminal domain-containing protein	NA	A8ASN4	Listeria_phage	36.4	1.2e-43
WP_068441502.1|558359_559139_+	ATP-binding protein	NA	A0A059T7P1	Staphylococcus_phage	41.8	1.2e-38
WP_068441505.1|559140_559323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068441508.1|559423_559645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068441511.1|559637_559895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156418617.1|559897_560068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068441514.1|560122_560605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068441521.1|561048_561816_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	39.9	2.7e-43
WP_068441524.1|561817_563371_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	27.6	4.9e-20
564579:564596	attR	TTTTATTAATATTAATTC	NA	NA	NA	NA
>prophage 37
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	579276	579519	3858284		Bacillus_phage(100.0%)	1	NA	NA
WP_068441584.1|579276_579519_+	hypothetical protein	NA	A0A172JI00	Bacillus_phage	43.9	1.7e-12
>prophage 38
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	585730	586858	3858284		Brochothrix_phage(100.0%)	1	NA	NA
WP_068441609.1|585730_586858_+	peptidoglycan DD-metalloendopeptidase family protein	NA	D7RWE0	Brochothrix_phage	41.4	2.1e-12
>prophage 39
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	590722	592861	3858284		Streptococcus_phage(100.0%)	1	NA	NA
WP_068441628.1|590722_592861_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	44.9	1.5e-104
>prophage 40
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	596868	599864	3858284		Tetraselmis_virus(50.0%)	2	NA	NA
WP_068441644.1|596868_597639_-	acetoin reductase	NA	A0A2P0VP75	Tetraselmis_virus	29.2	3.4e-06
WP_068441646.1|597935_599864_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1V0SGM7	Hokovirus	29.9	1.8e-32
>prophage 41
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	612957	613869	3858284		Bacillus_virus(100.0%)	1	NA	NA
WP_068441704.1|612957_613869_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.9	4.0e-14
>prophage 42
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	624218	625139	3858284		Bacillus_virus(100.0%)	1	NA	NA
WP_068441727.1|624218_625139_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	38.6	3.0e-49
>prophage 43
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	630459	635059	3858284		Phage_Wrath(25.0%)	5	NA	NA
WP_068441739.1|630459_631074_-	helix-turn-helix domain-containing protein	NA	A0A1B2APZ3	Phage_Wrath	55.6	5.1e-37
WP_068441742.1|631219_631423_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JQ34	Staphylococcus_phage	43.8	1.1e-07
WP_068441745.1|631579_631879_+	group-specific protein	NA	A0A1B1P7U4	Bacillus_phage	53.0	6.5e-22
WP_068441749.1|631937_632849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156418622.1|632809_635059_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	27.1	4.1e-68
>prophage 44
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	640913	643505	3858284		Streptococcus_phage(100.0%)	1	NA	NA
WP_068441785.1|640913_643505_+	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	25.4	1.5e-69
>prophage 45
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	647272	648349	3858284		Microcystis_virus(100.0%)	1	NA	NA
WP_068441797.1|647272_648349_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A7K9	Microcystis_virus	40.3	1.5e-15
>prophage 46
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	658305	659835	3858284		Vibrio_phage(100.0%)	1	NA	NA
WP_068441822.1|658305_659835_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.1	1.1e-11
>prophage 47
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	666348	671203	3858284		Listeria_phage(33.33%)	6	NA	NA
WP_068441837.1|666348_666789_+	single-stranded DNA-binding protein	NA	A0A059T5E0	Listeria_phage	52.2	5.6e-38
WP_068441840.1|666872_667589_+	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_068441843.1|667779_668253_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_068441846.1|668330_669194_+	alpha/beta hydrolase	NA	A0A088FS12	Mycobacterium_phage	32.5	1.1e-05
WP_068441849.1|669713_670520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068441852.1|670996_671203_-	alpha/beta-type small acid-soluble spore protein	NA	Q77YX0	Bacillus_phage	68.9	3.1e-15
>prophage 48
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	689733	690639	3858284	transposase	Macacine_betaherpesvirus(100.0%)	1	NA	NA
WP_068441897.1|689733_690639_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	23.4	4.6e-10
>prophage 49
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	694309	695920	3858284		Vibrio_phage(100.0%)	1	NA	NA
WP_068441905.1|694309_695920_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.1	5.6e-11
>prophage 50
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	712100	713543	3858284		Bacillus_phage(100.0%)	1	NA	NA
WP_068441955.1|712100_713543_+	VWA domain-containing protein	NA	A7KV72	Bacillus_phage	27.7	6.3e-30
>prophage 51
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	716953	720263	3858284		Escherichia_phage(50.0%)	3	NA	NA
WP_068441964.1|716953_718258_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	23.7	1.1e-17
WP_068441968.1|718244_719243_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_082684285.1|719378_720263_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	49.6	3.9e-30
>prophage 52
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	726440	731114	3858284	transposase	Leptospira_phage(66.67%)	5	NA	NA
WP_068440383.1|726440_727673_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	24.4	1.3e-07
WP_169792858.1|727894_728092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068441989.1|728219_728996_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_068448116.1|729112_730690_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	35.9	2.4e-70
WP_082684070.1|730757_731114_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.0	2.3e-18
>prophage 53
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	741959	748173	3858284		Staphylococcus_phage(66.67%)	4	NA	NA
WP_068442015.1|741959_744758_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	22.1	2.0e-24
WP_068442018.1|744840_745410_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_068442020.1|745406_746954_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	69.9	6.2e-209
WP_082684117.1|746955_748173_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	34.5	7.4e-40
>prophage 54
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	761626	762484	3858284	integrase	Bacillus_phage(100.0%)	1	753738:753753	762504:762519
753738:753753	attL	TTATTTTCTTGATAAT	NA	NA	NA	NA
WP_068442053.1|761626_762484_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P7C7	Bacillus_phage	24.2	7.6e-15
WP_068442053.1|761626_762484_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P7C7	Bacillus_phage	24.2	7.6e-15
762504:762519	attR	ATTATCAAGAAAATAA	NA	NA	NA	NA
>prophage 55
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	776581	836979	3858284	holin,integrase,transposase,portal	Enterobacteria_phage(20.0%)	60	820508:820567	839626:839731
WP_068442080.1|776581_777055_+|integrase	site-specific integrase	integrase	A0A1B1P7C7	Bacillus_phage	27.1	1.4e-07
WP_068442082.1|778786_779578_-	N(G),N(G)-dimethylarginine dimethylaminohydrolase	NA	NA	NA	NA	NA
WP_068442085.1|779645_780515_-	amidinotransferase	NA	NA	NA	NA	NA
WP_068442089.1|780644_781388_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_068442092.1|781677_783174_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_156418636.1|783176_783335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068442095.1|783522_783891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068442097.1|783966_784449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068442100.1|784448_785237_-	DUF3100 domain-containing protein	NA	NA	NA	NA	NA
WP_068442103.1|786922_787519_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_068442106.1|787511_788828_+	cytosine permease	NA	NA	NA	NA	NA
WP_068442109.1|788824_789916_+	DUF917 domain-containing protein	NA	NA	NA	NA	NA
WP_068442112.1|789919_791476_+	hydantoinase/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_068442115.1|791849_792221_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_068442117.1|792290_793571_-	serine hydrolase	NA	A0A1V0SLG8	Klosneuvirus	31.1	3.7e-05
WP_068442120.1|793740_794673_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_068442123.1|794707_795082_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_068442126.1|795084_795444_+	DUF2620 domain-containing protein	NA	NA	NA	NA	NA
WP_068442129.1|795463_796756_+	YhfT family protein	NA	NA	NA	NA	NA
WP_068442131.1|796775_797687_+	phosphotriesterase	NA	NA	NA	NA	NA
WP_068442133.1|797692_798823_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_068442137.1|798849_800010_+	alanine racemase	NA	NA	NA	NA	NA
WP_068442141.1|800014_801205_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_068442147.1|802100_802874_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_068442150.1|803136_803907_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_068442153.1|803921_805544_+	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	32.2	4.2e-14
WP_082684119.1|805676_806522_+	formylglycine-generating enzyme family protein	NA	A0A7H6	Microcystis_virus	31.1	1.0e-19
WP_068442159.1|806547_807672_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_068442162.1|807746_808262_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_068442165.1|808305_809592_+	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_082684287.1|809662_810538_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_068442171.1|810553_812044_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_068442174.1|812149_813811_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_068442177.1|814384_814765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068442180.1|815723_816347_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	60.9	6.5e-16
WP_068442182.1|816648_817290_+	recombinase family protein	NA	NA	NA	NA	NA
WP_068442187.1|817374_817608_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_068442189.1|817689_819696_+	transketolase	NA	NA	NA	NA	NA
WP_068442193.1|819841_820303_+	sporulation inhibitor of replication protein SirA	NA	NA	NA	NA	NA
WP_068442197.1|820347_820590_+	YneF family protein	NA	NA	NA	NA	NA
820508:820567	attL	AACCGTCGCAGAAAAAAATCAATCAAATGATGCGGTCAATGAATAACCAACAGCAAGAAA	NA	NA	NA	NA
WP_068442200.1|820712_821630_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D2W391	Mycobacterium_phage	25.5	6.7e-09
WP_156418638.1|821630_821789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068442203.1|821808_821988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068442206.1|822149_823619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068442209.1|823864_824089_+|holin	holin	holin	A0A290GDY2	Caldibacillus_phage	42.9	1.4e-05
WP_068442211.1|824088_824490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068442215.1|824502_825762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068442218.1|825758_826037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068442221.1|826055_826487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068442224.1|826710_828264_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	27.6	6.4e-20
WP_068441521.1|828265_829033_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	39.9	2.7e-43
WP_068442228.1|829032_829911_+	DUF5309 domain-containing protein	NA	NA	NA	NA	NA
WP_068442232.1|829980_830154_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_068442235.1|830403_831228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068442238.1|831224_831413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068442242.1|831738_833187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068442245.1|833380_833608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068442246.1|833604_834006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082684122.1|834024_835599_+	DNA packaging protein	NA	C7BV81	Synechococcus_phage	23.4	6.5e-20
WP_068442248.1|835650_836979_+|portal	phage portal protein	portal	NA	NA	NA	NA
839626:839731	attR	AACCGTCGCAGAAAAAAATCAATCAAATGATGCGGTCAATGAATAACCAACAGCAAGAAAAAGGTAAAGGTAAAGGAAAGTAACGGCTATTATTCATAAAAATTGC	NA	NA	NA	NA
>prophage 56
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	842658	843642	3858284		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_068448132.1|842658_843642_+	PAS domain S-box protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	24.5	1.7e-05
>prophage 57
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	849291	862583	3858284		Bacillus_virus(40.0%)	11	NA	NA
WP_068442278.1|849291_849516_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	62.2	7.0e-21
WP_068442283.1|849536_850463_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_068448139.1|850553_851135_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_068442289.1|851307_852375_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.3	3.2e-23
WP_068442292.1|852374_853901_+	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_068442295.1|853915_854329_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_068442301.1|854530_856486_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	43.7	1.7e-126
WP_068442305.1|856524_858966_+	DNA topoisomerase IV subunit A	NA	A0A172JHV7	Bacillus_phage	30.9	7.5e-92
WP_068442307.1|859078_859720_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_068442310.1|859777_860920_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_068442313.1|860948_862583_+	AMP-binding protein	NA	Q75ZG1	Hepacivirus	27.6	2.7e-45
>prophage 58
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	871478	874689	3858284		Bacillus_phage(50.0%)	3	NA	NA
WP_082684288.1|871478_872327_+	flap endonuclease	NA	F8WQ40	Bacillus_phage	33.2	1.0e-24
WP_068442336.1|872444_873755_+	D-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_068442338.1|873768_874689_+	cysteine synthase A	NA	C3U2M1	Lactococcus_phage	53.4	1.2e-79
>prophage 59
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	878258	883080	3858284	lysis	Enterobacteria_phage(50.0%)	4	NA	NA
WP_068442344.1|878258_879407_-	toxic anion resistance protein	NA	I7HXJ0	Enterobacteria_phage	23.8	2.1e-15
WP_068442346.1|879403_880048_-|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis family protein	lysis	NA	NA	NA	NA
WP_068442348.1|880984_881587_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_068442350.1|881586_883080_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	42.2	1.0e-19
>prophage 60
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	892541	900947	3858284		Staphylococcus_phage(28.57%)	11	NA	NA
WP_068442391.1|892541_893306_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	31.9	9.1e-20
WP_068442392.1|893375_893561_-	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_068442395.1|893580_893790_-	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_068442396.1|893930_894518_-	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_068442399.1|894521_895016_-	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	45.4	5.7e-39
WP_068442404.1|895036_895993_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	67.5	2.2e-127
WP_068442408.1|896143_897163_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	41.8	2.2e-16
WP_068442411.1|897233_897833_-	HD domain-containing protein	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.5	5.9e-14
WP_068442414.1|897832_899503_-	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_068442417.1|899850_900051_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	64.6	5.9e-19
WP_068442420.1|900269_900947_+	queuosine precursor transporter	NA	R4TNY5	Halovirus	32.3	5.8e-18
>prophage 61
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	908217	908832	3858284		Bacillus_phage(100.0%)	1	NA	NA
WP_156418640.1|908217_908832_+	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	36.2	3.4e-25
>prophage 62
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	912875	925844	3858284	tRNA	Temperate_phage(20.0%)	12	NA	NA
WP_068442462.1|912875_913556_-	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	36.0	1.7e-09
WP_068442464.1|913696_914989_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	29.5	1.5e-54
WP_068442466.1|915008_916193_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_068442473.1|916193_916748_-	DUF5590 domain-containing protein	NA	NA	NA	NA	NA
WP_068442475.1|917043_919848_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	29.4	3.4e-72
WP_068442477.1|919879_920869_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_156418774.1|920844_922047_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	32.2	1.1e-43
WP_068442481.1|922064_923186_-	N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA	NA	NA	NA	NA	NA
WP_068442483.1|923185_923605_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_068442491.1|923616_924414_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_068442494.1|924492_924831_-	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_068442497.1|924974_925844_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	41.1	1.8e-64
>prophage 63
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	932837	933401	3858284		Bacillus_virus(100.0%)	1	NA	NA
WP_068442519.1|932837_933401_-	YpiB family protein	NA	G3MAV7	Bacillus_virus	43.8	2.2e-34
>prophage 64
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	937218	941233	3858284		Faustovirus(50.0%)	4	NA	NA
WP_068442527.1|937218_938325_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	27.8	2.3e-24
WP_068442529.1|938314_939418_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_068442531.1|939417_940590_-	chorismate synthase	NA	NA	NA	NA	NA
WP_068442534.1|940786_941233_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	41.2	5.9e-27
>prophage 65
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	944258	944531	3858284		Bacillus_phage(100.0%)	1	NA	NA
WP_068442558.1|944258_944531_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	68.9	4.0e-26
>prophage 66
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	964102	971112	3858284		Bacillus_phage(75.0%)	7	NA	NA
WP_068442605.1|964102_965647_-	ATP-dependent DNA helicase RecQ	NA	F2NZ48	Diadromus_pulchellus_ascovirus	38.6	1.3e-57
WP_068442608.1|965660_966707_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_068442611.1|966861_967113_+	ferredoxin	NA	A0A127AYY7	Bacillus_phage	58.7	4.8e-18
WP_068442613.1|967227_967743_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_068442617.1|967747_968191_-	DUF4430 domain-containing protein	NA	NA	NA	NA	NA
WP_068442620.1|968632_970396_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	34.9	1.1e-31
WP_068442622.1|970395_971112_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	45.5	5.3e-46
>prophage 67
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	976623	979641	3858284		uncultured_Mediterranean_phage(66.67%)	3	NA	NA
WP_068442639.1|976623_977733_-	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	30.4	2.1e-12
WP_068442642.1|978305_978905_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	29.5	5.9e-14
WP_068442645.1|978891_979641_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	24.2	2.4e-09
>prophage 68
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	985991	993537	3858284		Bacillus_phage(25.0%)	6	NA	NA
WP_068442673.1|985991_986747_-	RNA polymerase sporulation sigma factor SigF	NA	A0A0A0RV91	Bacillus_phage	56.9	2.7e-64
WP_068442678.1|987188_987542_-	anti-sigma F factor antagonist	NA	NA	NA	NA	NA
WP_068442681.1|989164_990469_-	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	56.6	8.0e-133
WP_068442686.1|990486_991308_-	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	43.1	1.1e-63
WP_068442688.1|991339_992521_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_068442690.1|992643_993537_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	33.1	5.5e-40
>prophage 69
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	996551	999586	3858284		Lactobacillus_phage(33.33%)	3	NA	NA
WP_068442705.1|996551_997100_-	NUDIX hydrolase	NA	A0A2K9VCP4	Lactobacillus_phage	31.4	3.5e-13
WP_068442707.1|997214_998129_+	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	40.2	6.7e-09
WP_068442710.1|998335_999586_+	UV damage repair protein UvrX	NA	O64031	Bacillus_phage	50.2	9.1e-110
>prophage 70
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1002818	1003562	3858284		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_068442717.1|1002818_1003562_+	glycerophosphodiester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	28.3	6.4e-18
>prophage 71
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1006924	1009474	3858284		Caldibacillus_phage(50.0%)	2	NA	NA
WP_068442725.1|1006924_1008172_-	DNA polymerase IV	NA	A0A290GHP0	Caldibacillus_phage	33.0	2.0e-24
WP_068442728.1|1008346_1009474_-	M20/M25/M40 family metallo-hydrolase	NA	A0A0K2CPK3	Brevibacillus_phage	30.3	2.8e-09
>prophage 72
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1018902	1020324	3858284		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_068442755.1|1018902_1020324_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.5	2.9e-43
>prophage 73
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1033057	1036370	3858284		Indivirus(66.67%)	4	NA	NA
WP_156418645.1|1033057_1033948_-	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	24.2	6.5e-09
WP_068442780.1|1033944_1034178_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_068442783.1|1034164_1035520_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	35.9	6.5e-45
WP_068442788.1|1035509_1036370_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.3	5.6e-42
>prophage 74
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1048590	1061960	3858284		Brevibacillus_phage(33.33%)	8	NA	NA
WP_068442844.1|1048590_1049481_-	patatin-like phospholipase family protein	NA	A0A1X7C039	Faustovirus	27.6	1.9e-21
WP_082684130.1|1050258_1051380_-	hypothetical protein	NA	A0A0K2CP92	Brevibacillus_phage	47.2	9.1e-77
WP_082684290.1|1051584_1053078_-	vitamin B12-dependent ribonucleotide reductase	NA	A0A0K2CP92	Brevibacillus_phage	45.7	6.2e-97
WP_068442847.1|1053468_1053840_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_068442850.1|1055876_1057334_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPB	NA	E3ST28	Prochlorococcus_phage	41.1	1.5e-82
WP_068442853.1|1057326_1058676_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	39.9	2.5e-60
WP_068442857.1|1058697_1059801_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_068442860.1|1060307_1061960_+	DEAD/DEAH box helicase family protein	NA	A0A2H4J643	uncultured_Caudovirales_phage	32.1	3.3e-51
>prophage 75
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1068341	1071282	3858284		Streptococcus_phage(100.0%)	3	NA	NA
WP_068442889.1|1068341_1068965_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	41.0	1.4e-34
WP_082684132.1|1069121_1069280_+	DUF2759 family protein	NA	NA	NA	NA	NA
WP_068442893.1|1069317_1071282_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	34.8	4.8e-97
>prophage 76
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1079161	1083712	3858284	transposase	Staphylococcus_virus(50.0%)	6	NA	NA
WP_068442915.1|1079161_1080868_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	51.3	1.1e-145
WP_010530995.1|1081043_1081193_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_068442920.1|1081375_1081597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068442923.1|1081618_1082155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068442925.1|1082213_1082870_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_068442928.1|1082890_1083712_-	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.1	1.5e-15
>prophage 77
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1090610	1091222	3858284		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_068442946.1|1090610_1091222_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	60.3	1.2e-67
>prophage 78
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1096784	1104555	3858284	tRNA	Bodo_saltans_virus(25.0%)	7	NA	NA
WP_068442962.1|1096784_1097678_-	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	33.0	4.1e-27
WP_068442964.1|1097694_1099008_-	DEAD/DEAH box helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.9	1.8e-44
WP_068442967.1|1099059_1100172_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_068442970.1|1100152_1100866_-|tRNA	tRNA (adenine(22)-N(1))-methyltransferase TrmK	tRNA	NA	NA	NA	NA
WP_082684134.1|1100972_1101395_-	cytochrome c	NA	NA	NA	NA	NA
WP_068442973.1|1101590_1102715_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	39.8	5.8e-39
WP_068442976.1|1102740_1104555_-	DNA primase	NA	C7F4F5	Cyanophage	30.2	8.8e-37
>prophage 79
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1115400	1116360	3858284		Rhizobium_phage(100.0%)	1	NA	NA
WP_068443008.1|1115400_1116360_-	PhoH family protein	NA	L7TP00	Rhizobium_phage	51.5	2.5e-51
>prophage 80
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1121056	1121503	3858284		Bacillus_phage(100.0%)	1	NA	NA
WP_068443020.1|1121056_1121503_-	GatB/YqeY domain-containing protein	NA	A0A218KC79	Bacillus_phage	28.6	8.5e-10
>prophage 81
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1125798	1129049	3858284		Catovirus(50.0%)	2	NA	NA
WP_068443035.1|1125798_1126917_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.6	8.1e-17
WP_068443038.1|1127207_1129049_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.7	5.8e-129
>prophage 82
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1132160	1133966	3858284		Streptococcus_phage(100.0%)	1	NA	NA
WP_068443050.1|1132160_1133966_-	elongation factor 4	NA	A0A1B0RXH7	Streptococcus_phage	24.8	2.7e-22
>prophage 83
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1138978	1141829	3858284		Clostridium_botulinum_C_phage(50.0%)	2	NA	NA
WP_068443068.1|1138978_1141255_-	DNA internalization-related competence protein ComEC/Rec2	NA	Q332B9	Clostridium_botulinum_C_phage	32.0	1.9e-28
WP_068443070.1|1141265_1141829_-	ComE operon protein 2	NA	A7KUY9	Bacillus_phage	55.5	7.7e-32
>prophage 84
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1154385	1157914	3858284		Bacillus_phage(50.0%)	5	NA	NA
WP_068443113.1|1154385_1155093_+	RNA polymerase sporulation sigma factor SigK	NA	A0A0Y0AU18	Bacillus_phage	27.6	7.7e-13
WP_068443116.1|1155132_1155822_-	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_068443120.1|1155851_1156496_-	DUF1510 family protein	NA	NA	NA	NA	NA
WP_068443124.1|1156689_1157166_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_068443127.1|1157272_1157914_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	37.1	6.7e-32
>prophage 85
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1161009	1167928	3858284	tRNA	Tupanvirus(50.0%)	4	NA	NA
WP_068443146.1|1161009_1163652_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	33.6	5.2e-62
WP_068443149.1|1164123_1165188_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_068443152.1|1165233_1165425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068443155.1|1165603_1167928_-	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	26.8	1.4e-42
>prophage 86
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1171557	1187789	3858284	tRNA	Bacillus_phage(25.0%)	12	NA	NA
WP_068443170.1|1171557_1172835_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	47.6	1.1e-99
WP_068448163.1|1172927_1173590_+	RsfA family transcriptional regulator	NA	NA	NA	NA	NA
WP_068443173.1|1173999_1175775_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	26.3	1.8e-18
WP_068443178.1|1175767_1177057_-|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	22.7	2.3e-15
WP_169792862.1|1177462_1177636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068443182.1|1177730_1178792_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JCM7	uncultured_Caudovirales_phage	35.1	1.7e-19
WP_068443184.1|1179054_1179501_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_068448165.1|1179515_1181717_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	34.8	8.5e-10
WP_068443187.1|1182180_1182693_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.9	2.2e-30
WP_068443190.1|1182682_1185010_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	33.5	3.7e-80
WP_068443193.1|1185066_1185402_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_068443196.1|1185512_1187789_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	36.4	2.9e-29
>prophage 87
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1192015	1199287	3858284	tRNA	uncultured_Mediterranean_phage(50.0%)	9	NA	NA
WP_068443206.1|1192015_1192285_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	51.9	2.0e-06
WP_068443209.1|1192304_1193444_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.8	3.5e-84
WP_068443212.1|1193500_1194529_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_068443215.1|1194666_1194858_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_068443218.1|1194860_1195862_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	26.2	2.5e-09
WP_068443221.1|1195874_1196480_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_068443224.1|1196853_1197585_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_068443225.1|1197906_1198464_-	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_068443229.1|1198546_1199287_-	NAD(+) synthase	NA	E3SLH5	Synechococcus_phage	32.9	1.9e-30
>prophage 88
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1213810	1218238	3858284	tRNA	Cyanophage(50.0%)	3	NA	NA
WP_068443287.1|1213810_1214704_+	RimK family alpha-L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	31.6	6.7e-22
WP_068443289.1|1214714_1215575_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_068448167.1|1215592_1218238_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	43.8	7.5e-162
>prophage 89
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1229556	1233554	3858284	protease	Moraxella_phage(50.0%)	2	NA	NA
WP_068443325.1|1229556_1231890_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	45.9	4.3e-185
WP_068443328.1|1232273_1233554_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	65.3	2.4e-150
>prophage 90
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1237233	1237824	3858284		Cassava_brown_streak_virus(100.0%)	1	NA	NA
WP_068443343.1|1237233_1237824_-	XTP/dITP diphosphatase	NA	A0A2P1DNN0	Cassava_brown_streak_virus	32.5	1.3e-13
>prophage 91
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1242301	1242526	3858284		Caldibacillus_phage(100.0%)	1	NA	NA
WP_068443357.1|1242301_1242526_+	response regulator transcription factor	NA	A0A290GJH9	Caldibacillus_phage	77.0	6.8e-16
>prophage 92
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1249015	1249333	3858284		Staphylococcus_phage(100.0%)	1	NA	NA
WP_068443376.1|1249015_1249333_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	45.6	3.3e-24
>prophage 93
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1252925	1259492	3858284		Staphylococcus_phage(33.33%)	4	NA	NA
WP_068443392.1|1252925_1254614_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	31.8	7.9e-48
WP_068443395.1|1254875_1255289_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_068443398.1|1255316_1257659_-	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	40.7	2.5e-15
WP_068443402.1|1257770_1259492_-	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	25.4	8.1e-16
>prophage 94
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1264157	1265207	3858284	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_068443417.1|1264157_1265207_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	36.5	3.6e-27
>prophage 95
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1270895	1271567	3858284		Cedratvirus(100.0%)	1	NA	NA
WP_068443432.1|1270895_1271567_+	ABC transporter ATP-binding protein	NA	A0A2R8FFL6	Cedratvirus	35.4	5.4e-24
>prophage 96
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1275195	1275918	3858284		Staphylococcus_phage(100.0%)	1	NA	NA
WP_068448172.1|1275195_1275918_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.0	1.2e-45
>prophage 97
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1296750	1297521	3858284		Enterobacteria_phage(100.0%)	1	NA	NA
WP_068443525.1|1296750_1297521_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	37.8	8.6e-42
>prophage 98
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1314131	1320059	3858284		Staphylococcus_phage(33.33%)	5	NA	NA
WP_068443592.1|1314131_1315046_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.1	4.4e-21
WP_068443595.1|1315544_1316000_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_068443598.1|1316093_1316888_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	41.0	4.2e-36
WP_068443608.1|1318420_1319506_-	M42 family metallopeptidase	NA	NA	NA	NA	NA
WP_068443611.1|1319573_1320059_-	dUTP diphosphatase	NA	A0A0K1LLP8	Bacillus_phage	40.5	6.4e-27
>prophage 99
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1323398	1329101	3858284	tRNA	Agrobacterium_phage(33.33%)	4	NA	NA
WP_068443630.1|1323398_1323902_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.3	6.9e-16
WP_068443633.1|1324245_1326192_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.5	1.0e-107
WP_068448179.1|1326543_1327395_-	putative sporulation protein YtxC	NA	NA	NA	NA	NA
WP_068443636.1|1328168_1329101_-	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	34.6	1.5e-37
>prophage 100
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1335289	1342184	3858284	holin	Bacillus_phage(50.0%)	6	NA	NA
WP_068443663.1|1335289_1336120_-	DNA-formamidopyrimidine glycosylase	NA	G3MA33	Bacillus_virus	35.1	9.6e-31
WP_068443666.1|1336132_1338772_-	DNA polymerase I	NA	A7XXH2	Thermus_virus	32.4	1.5e-48
WP_068443669.1|1338884_1339574_-	LrgB family protein	NA	NA	NA	NA	NA
WP_068448181.1|1339566_1339932_-|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_068443671.1|1340109_1341492_-	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	40.1	2.9e-40
WP_068443674.1|1341488_1342184_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	43.2	3.4e-45
>prophage 101
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1347776	1349537	3858284		Staphylococcus_phage(100.0%)	1	NA	NA
WP_068443693.1|1347776_1349537_-	pyruvate kinase	NA	A0A2H4PQU5	Staphylococcus_phage	44.4	5.0e-13
>prophage 102
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1355295	1358661	3858284		Streptomyces_phage(100.0%)	1	NA	NA
WP_068443713.1|1355295_1358661_-	DNA polymerase III subunit alpha	NA	R4TPF1	Streptomyces_phage	32.3	4.6e-156
>prophage 103
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1374755	1374962	3858284		Bacillus_phage(100.0%)	1	NA	NA
WP_068443765.1|1374755_1374962_-	alpha/beta-type small acid-soluble spore protein	NA	Q77YX0	Bacillus_phage	67.7	1.4e-15
>prophage 104
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1382181	1383456	3858284	tRNA	Pectobacterium_phage(100.0%)	1	NA	NA
WP_068448187.1|1382181_1383456_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	41.6	7.4e-83
>prophage 105
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1395169	1399693	3858284		Mycobacterium_phage(33.33%)	4	NA	NA
WP_068443812.1|1395169_1397371_-	stage III sporulation protein E	NA	S5VNE3	Mycobacterium_phage	47.7	2.9e-90
WP_068443814.1|1397546_1398149_-	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
WP_068443817.1|1398164_1398971_-	DUF1444 domain-containing protein	NA	A0A2H4PQY3	Staphylococcus_phage	55.6	2.1e-35
WP_068443820.1|1399375_1399693_-	thioredoxin family protein	NA	J7KD15	Aeromonas_phage	31.3	7.7e-05
>prophage 106
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1407498	1417217	3858284		Oenococcus_phage(25.0%)	11	NA	NA
WP_068443859.1|1407498_1407894_-	VOC family protein	NA	V5UQY3	Oenococcus_phage	56.6	5.5e-37
WP_082684144.1|1408094_1408295_-	DUF1048 domain-containing protein	NA	NA	NA	NA	NA
WP_068443861.1|1408569_1410183_-	tetronasin resistance protein	NA	NA	NA	NA	NA
WP_068443864.1|1410208_1411090_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.1	1.7e-22
WP_082684145.1|1411243_1411864_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_068443868.1|1412344_1412713_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_068443870.1|1412705_1413587_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	24.0	8.1e-12
WP_068443873.1|1413573_1414278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068443876.1|1414676_1415372_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_068443879.1|1415364_1416363_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_068443882.1|1416458_1417217_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.8	1.3e-29
>prophage 107
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1432076	1433342	3858284		Staphylococcus_phage(100.0%)	1	NA	NA
WP_068443931.1|1432076_1433342_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	57.4	3.2e-25
>prophage 108
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1440556	1461292	3858284	tRNA	Staphylococcus_phage(50.0%)	15	NA	NA
WP_068443937.1|1440556_1442971_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	72.3	0.0e+00
WP_068443940.1|1443460_1444030_+	class I SAM-dependent methyltransferase	NA	A0A2H4PQV0	Staphylococcus_phage	44.1	3.5e-40
WP_068448193.1|1444047_1445079_-	tetraprenyl-beta-curcumene synthase family protein	NA	NA	NA	NA	NA
WP_068443943.1|1445203_1445713_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_068443945.1|1445825_1447709_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	31.2	3.2e-34
WP_068443948.1|1447981_1449187_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	73.6	9.0e-163
WP_068443951.1|1449731_1451321_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	61.1	4.5e-186
WP_068443952.1|1451605_1452595_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_068443955.1|1452607_1453411_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.0	6.2e-35
WP_068443959.1|1453407_1454214_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_068443972.1|1454489_1455386_-	ectoine hydroxylase	NA	NA	NA	NA	NA
WP_068443975.1|1455635_1457120_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	23.8	3.4e-18
WP_068448195.1|1457371_1458421_+	linear amide C-N hydrolase	NA	NA	NA	NA	NA
WP_068443977.1|1458738_1459437_-	amino acid racemase	NA	NA	NA	NA	NA
WP_068443980.1|1459699_1461292_-	long-chain-fatty-acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	24.9	8.9e-17
>prophage 109
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1468634	1469792	3858284		Klosneuvirus(100.0%)	1	NA	NA
WP_068444015.1|1468634_1469792_-	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.1	2.5e-29
>prophage 110
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1477887	1478871	3858284		Bacillus_virus(100.0%)	1	NA	NA
WP_068444042.1|1477887_1478871_+	GMP reductase	NA	G3MBI2	Bacillus_virus	79.8	5.3e-153
>prophage 111
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1484800	1486201	3858284		Bacillus_phage(50.0%)	2	NA	NA
WP_068444060.1|1484800_1485388_+	cell wall hydrolase	NA	A0A0E3XAL9	Bacillus_phage	44.6	1.7e-34
WP_068444062.1|1485580_1486201_-	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	36.0	1.8e-26
>prophage 112
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1529935	1531075	3858284		uncultured_virus(100.0%)	1	NA	NA
WP_082684151.1|1529935_1531075_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	42.1	7.6e-71
>prophage 113
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1540423	1543848	3858284		Bacillus_phage(33.33%)	4	NA	NA
WP_068444204.1|1540423_1540744_-	YolD-like family protein	NA	A0A1P8CWP2	Bacillus_phage	30.3	9.1e-06
WP_082684296.1|1540984_1541848_+	thermonuclease family protein	NA	V5UN65	Mycobacterium_phage	38.5	1.0e-14
WP_068444209.1|1542052_1542310_-	DUF2187 family protein	NA	NA	NA	NA	NA
WP_068444213.1|1542849_1543848_-	DnaD domain protein	NA	A0A1L2JY26	Aeribacillus_phage	30.8	4.1e-28
>prophage 114
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1551128	1552553	3858284		Liberibacter_phage(100.0%)	1	NA	NA
WP_068444232.1|1551128_1552553_-	N-6 DNA methylase	NA	A0A220A2U4	Liberibacter_phage	26.1	4.2e-26
>prophage 115
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1565383	1566798	3858284		Faecalibacterium_phage(50.0%)	2	NA	NA
WP_068444249.1|1565383_1565689_-	hypothetical protein	NA	A0A2K9V3H4	Faecalibacterium_phage	52.8	4.2e-08
WP_068444252.1|1565991_1566798_+	C40 family peptidase	NA	M4QSS2	Vibrio_phage	43.3	9.4e-07
>prophage 116
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1573711	1580969	3858284		Streptococcus_phage(50.0%)	7	NA	NA
WP_068444270.1|1573711_1574959_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	50.4	8.5e-108
WP_068444273.1|1574955_1576083_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	45.1	2.3e-75
WP_156418660.1|1576557_1576731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068444277.1|1576936_1577716_-	serine hydrolase	NA	NA	NA	NA	NA
WP_068444282.1|1577926_1578076_-	small acid-soluble spore protein O	NA	NA	NA	NA	NA
WP_068444285.1|1578237_1579524_-	S8 family peptidase	NA	A0A1B0T6A2	Bacillus_phage	34.1	6.7e-23
WP_068444288.1|1579628_1580969_-	N-acetylmuramoyl-L-alanine amidase	NA	Q0H257	Geobacillus_phage	44.1	3.0e-42
>prophage 117
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1587237	1588029	3858284		Deep-sea_thermophilic_phage(100.0%)	1	NA	NA
WP_068444304.1|1587237_1588029_+	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	42.2	2.0e-38
>prophage 118
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1594163	1595644	3858284		Bacillus_phage(50.0%)	2	NA	NA
WP_068444326.1|1594163_1594961_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N6W8I1	Bacillus_phage	45.7	6.8e-42
WP_068444328.1|1594972_1595644_-	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	44.7	3.2e-45
>prophage 119
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1602694	1605251	3858284		Staphylococcus_phage(50.0%)	2	NA	NA
WP_068444357.1|1602694_1604158_-	adenosylcobinamide amidohydrolase	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	1.2e-15
WP_068448203.1|1604249_1605251_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.6	3.6e-16
>prophage 120
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1615998	1621219	3858284		Bathycoccus_sp._RCC1105_virus(50.0%)	2	NA	NA
WP_068444396.1|1615998_1617672_-	ABC transporter	NA	E5ES62	Bathycoccus_sp._RCC1105_virus	30.0	3.0e-47
WP_068444398.1|1618126_1621219_-	SMC family ATPase	NA	A0A1D8KN42	Synechococcus_phage	28.5	3.3e-07
>prophage 121
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1629344	1630226	3858284		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_068444422.1|1629344_1630226_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.7	1.7e-14
>prophage 122
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1641465	1643847	3858284		Planktothrix_phage(50.0%)	3	NA	NA
WP_068448212.1|1641465_1642188_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.6	8.3e-31
WP_068444463.1|1642187_1642847_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_082684159.1|1643016_1643847_-	glutamine ABC transporter substrate-binding protein	NA	E3T502	Cafeteria_roenbergensis_virus	30.6	9.3e-10
>prophage 123
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1647513	1652425	3858284		Tupanvirus(50.0%)	5	NA	NA
WP_068444477.1|1647513_1648617_-	class II histone deacetylase	NA	A0A2K9L2T7	Tupanvirus	36.5	6.7e-56
WP_068444481.1|1648812_1649046_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_068444485.1|1649065_1650130_-	amidohydrolase	NA	NA	NA	NA	NA
WP_068444488.1|1650357_1651368_-	VOC family protein	NA	NA	NA	NA	NA
WP_068444491.1|1651402_1652425_-	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	41.1	2.6e-22
>prophage 124
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1656733	1660283	3858284		Bacillus_phage(100.0%)	2	NA	NA
WP_068448215.1|1656733_1658473_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.7	4.3e-49
WP_068444505.1|1658453_1660283_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.1	3.6e-46
>prophage 125
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1670484	1673026	3858284		Vibrio_phage(50.0%)	2	NA	NA
WP_068444540.1|1670484_1671225_+	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	A0A2I7QSF5	Vibrio_phage	22.5	1.0e-07
WP_068444543.1|1671646_1673026_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	23.9	2.6e-25
>prophage 126
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1681572	1682793	3858284		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_068448221.1|1681572_1682793_-	MFS transporter	NA	A0A2H4UVM2	Bodo_saltans_virus	20.1	2.3e-09
>prophage 127
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1694305	1695067	3858284		Bacillus_phage(100.0%)	1	NA	NA
WP_068444605.1|1694305_1695067_-	YjbA family protein	NA	A0A0A0RUW1	Bacillus_phage	44.4	1.8e-47
>prophage 128
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1703381	1706924	3858284		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_068444637.1|1703381_1704842_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	57.5	2.4e-141
WP_068444639.1|1705145_1705337_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_068444642.1|1706129_1706924_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	29.2	7.0e-15
>prophage 129
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1720194	1721211	3858284		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_068444686.1|1720194_1721211_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.3	1.9e-17
>prophage 130
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1724610	1731191	3858284		Klosneuvirus(50.0%)	3	NA	NA
WP_068444697.1|1724610_1725807_+	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.9	1.1e-32
WP_068444701.1|1725883_1727056_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_068444702.1|1727471_1731191_-	helicase-exonuclease AddAB subunit AddA	NA	G3MA40	Bacillus_virus	22.5	1.9e-17
>prophage 131
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1739968	1741774	3858284		Streptococcus_phage(100.0%)	1	NA	NA
WP_068444726.1|1739968_1741774_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	40.6	1.1e-119
>prophage 132
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1753964	1755751	3858284		Staphylococcus_phage(50.0%)	2	NA	NA
WP_068444767.1|1753964_1754708_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.0	9.5e-22
WP_068444769.1|1755325_1755751_+	HIT family protein	NA	B5LJ12	Mycobacterium_phage	30.1	1.6e-05
>prophage 133
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1759053	1760268	3858284		Bacillus_virus(100.0%)	1	NA	NA
WP_068444782.1|1759053_1760268_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.0	2.4e-30
>prophage 134
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1768582	1770005	3858284		Planktothrix_phage(50.0%)	2	NA	NA
WP_068444816.1|1768582_1769680_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.8	1.8e-21
WP_068444817.1|1769810_1770005_-	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	72.6	6.5e-15
>prophage 135
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1773782	1774547	3858284		Planktothrix_phage(100.0%)	1	NA	NA
WP_068444824.1|1773782_1774547_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	2.5e-33
>prophage 136
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1791590	1793339	3858284	transposase	Staphylococcus_virus(100.0%)	1	NA	NA
WP_068444857.1|1791590_1793339_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	51.5	5.0e-146
>prophage 137
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1797099	1801033	3858284		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_068444865.1|1797099_1797921_-	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	27.5	1.7e-11
WP_068444866.1|1798040_1799231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068444867.1|1799237_1799789_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_068444869.1|1799824_1801033_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	1.3e-28
>prophage 138
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1813357	1813864	3858284		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_068444881.1|1813357_1813864_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	48.0	4.9e-22
>prophage 139
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1826324	1826720	3858284		Oenococcus_phage(100.0%)	1	NA	NA
WP_068444904.1|1826324_1826720_-	VOC family protein	NA	V5UQY3	Oenococcus_phage	51.2	2.0e-34
>prophage 140
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1832994	1835359	3858284		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_068444915.1|1832994_1833966_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	42.3	6.8e-52
WP_068448231.1|1834225_1835359_-	glutathione-dependent formaldehyde dehydrogenase	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	28.1	5.5e-13
>prophage 141
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1846814	1849036	3858284		Mycobacterium_phage(50.0%)	2	NA	NA
WP_068444936.1|1846814_1848245_-	serine hydrolase	NA	S5Z991	Mycobacterium_phage	27.8	7.0e-13
WP_068444938.1|1848460_1849036_-	cupin domain-containing protein	NA	Q2I8C5	Bacillus_phage	68.8	2.5e-54
>prophage 142
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1855574	1857005	3858284		Mycobacterium_phage(100.0%)	1	NA	NA
WP_068444951.1|1855574_1857005_-	serine hydrolase	NA	S5Z991	Mycobacterium_phage	27.3	2.0e-12
>prophage 143
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1860079	1866579	3858284		Staphylococcus_phage(66.67%)	8	NA	NA
WP_068444960.1|1860079_1861408_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.5	1.3e-29
WP_068444965.1|1861962_1862457_-	DinB family protein	NA	NA	NA	NA	NA
WP_068444967.1|1862515_1862971_-	DinB family protein	NA	NA	NA	NA	NA
WP_082684172.1|1863116_1863218_-	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_068444969.1|1863231_1864176_-	DUF2705 family protein	NA	NA	NA	NA	NA
WP_068444971.1|1864163_1865111_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	40.6	1.7e-39
WP_068444972.1|1865129_1865720_-	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_068444974.1|1865703_1866579_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.2	5.6e-21
>prophage 144
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1884191	1892717	3858284		Catovirus(33.33%)	8	NA	NA
WP_068445000.1|1884191_1885796_-	acyl-CoA synthetase	NA	A0A1V0SBX8	Catovirus	22.3	4.7e-18
WP_068445002.1|1885942_1886395_-	RDD family protein	NA	NA	NA	NA	NA
WP_068445004.1|1886407_1887403_-	signal peptide peptidase SppA	NA	NA	NA	NA	NA
WP_068445005.1|1887821_1888421_-	short chain dehydrogenase	NA	NA	NA	NA	NA
WP_068445008.1|1888479_1889091_-	3'-5' exonuclease	NA	A0A1S5SFA9	Streptococcus_phage	35.5	6.4e-32
WP_068445010.1|1889437_1890856_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_068445012.1|1891165_1891585_+	general stress protein	NA	NA	NA	NA	NA
WP_068448241.1|1891949_1892717_+	NRDE family protein	NA	A0A0M3ZEJ9	Turkeypox_virus	36.5	2.8e-37
>prophage 145
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1897453	1898416	3858284		Bacillus_phage(100.0%)	1	NA	NA
WP_068445020.1|1897453_1898416_+	S8 family peptidase	NA	A0A127AWU5	Bacillus_phage	52.5	8.1e-82
>prophage 146
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1909143	1913186	3858284		Bacillus_phage(66.67%)	4	NA	NA
WP_068445037.1|1909143_1909821_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	54.8	1.0e-67
WP_068445039.1|1910019_1911396_+	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	42.9	1.7e-56
WP_068445040.1|1911465_1912530_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_068445042.1|1912526_1913186_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.4	5.1e-35
>prophage 147
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1926909	1927758	3858284		Staphylococcus_phage(100.0%)	1	NA	NA
WP_068445065.1|1926909_1927758_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.8	6.3e-30
>prophage 148
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1941142	1942375	3858284	transposase	Lysinibacillus_phage(100.0%)	1	NA	NA
WP_068440383.1|1941142_1942375_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	24.4	1.3e-07
>prophage 149
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1946147	1956631	3858284		Staphylococcus_phage(25.0%)	11	NA	NA
WP_068445091.1|1946147_1947020_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.7	2.1e-12
WP_068445092.1|1947023_1947815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068445095.1|1948001_1948436_-	universal stress protein	NA	NA	NA	NA	NA
WP_068445097.1|1948549_1949314_-	SDR family oxidoreductase	NA	A0A167REC2	Powai_lake_megavirus	27.6	8.0e-16
WP_082684179.1|1949432_1951664_-	bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase	NA	NA	NA	NA	NA
WP_068445098.1|1951897_1952599_+	NAD-dependent protein deacylase	NA	A0A068EPD4	Bacillus_phage	42.9	1.2e-45
WP_156418782.1|1952822_1952969_+	Spo0E family sporulation regulatory protein-aspartic acid phosphatase	NA	NA	NA	NA	NA
WP_068448252.1|1953019_1953286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068445103.1|1953317_1954238_-	DMT family transporter	NA	NA	NA	NA	NA
WP_068445105.1|1954748_1955489_+	cyclase family protein	NA	NA	NA	NA	NA
WP_068445107.1|1955524_1956631_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	46.2	4.2e-82
>prophage 150
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1961107	1964398	3858284		Acanthamoeba_polyphaga_mimivirus(50.0%)	3	NA	NA
WP_068445116.1|1961107_1961884_-	3-hydroxybutyrate dehydrogenase	NA	A0A0G2Y601	Acanthamoeba_polyphaga_mimivirus	23.1	6.9e-07
WP_068445118.1|1962139_1963504_-	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_068448254.1|1963873_1964398_-	GrpB family protein	NA	A0A2K5B2B6	Erysipelothrix_phage	52.7	8.7e-46
>prophage 151
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1968551	1973490	3858284		Vibrio_phage(50.0%)	3	NA	NA
WP_068445130.1|1968551_1970042_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.6	2.6e-26
WP_068445132.1|1970751_1971906_+	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_068445134.1|1971906_1973490_+	phosphoglycerate dehydrogenase	NA	M1H9J0	Paramecium_bursaria_Chlorella_virus	33.7	2.5e-35
>prophage 152
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1979435	1980221	3858284		Staphylococcus_phage(100.0%)	1	NA	NA
WP_068445152.1|1979435_1980221_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.8	5.9e-30
>prophage 153
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1988231	1988969	3858284		Bacillus_virus(100.0%)	1	NA	NA
WP_068445174.1|1988231_1988969_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.8	4.5e-32
>prophage 154
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	1994236	1995928	3858284	holin	Klosneuvirus(100.0%)	1	NA	NA
WP_068445183.1|1994236_1995928_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	32.0	6.9e-60
>prophage 155
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2008840	2009350	3858284		Paenibacillus_phage(100.0%)	1	NA	NA
WP_068445213.1|2008840_2009350_-	putative metal-dependent hydrolase	NA	D0R7I3	Paenibacillus_phage	34.3	2.5e-13
>prophage 156
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2013427	2016841	3858284		Klosneuvirus(50.0%)	4	NA	NA
WP_068445223.1|2013427_2014270_+	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	25.7	2.0e-23
WP_068445225.1|2014347_2015001_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_068445226.1|2015061_2015718_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_068448262.1|2016070_2016841_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.9	4.4e-38
>prophage 157
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2028867	2036274	3858284		uncultured_virus(33.33%)	7	NA	NA
WP_068445254.1|2028867_2029989_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	47.3	5.9e-92
WP_082684182.1|2030457_2030712_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_068445256.1|2030957_2031542_-	TetR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_068448263.1|2031693_2032455_+	SDR family oxidoreductase	NA	A0A167REC2	Powai_lake_megavirus	24.7	4.2e-09
WP_068445258.1|2032623_2033352_-	Fic family protein	NA	NA	NA	NA	NA
WP_068445260.1|2034046_2034523_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_068445262.1|2034540_2036274_-	acyl--CoA ligase	NA	Q75ZG1	Hepacivirus	25.5	9.9e-38
>prophage 158
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2052560	2054312	3858284		Bacillus_phage(100.0%)	1	NA	NA
WP_068445282.1|2052560_2054312_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.2	5.5e-52
>prophage 159
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2060154	2076479	3858284	protease	Staphylococcus_phage(50.0%)	14	NA	NA
WP_068445291.1|2060154_2060814_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	47.8	1.9e-05
WP_068445294.1|2060859_2061672_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_068445296.1|2061858_2062746_+	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_179946399.1|2063131_2063359_+	PLDc N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_068445300.1|2063360_2064269_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.1	5.0e-25
WP_068445304.1|2064268_2065045_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_068445306.1|2065288_2065996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068445309.1|2066170_2068054_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.2	8.6e-27
WP_068445311.1|2068765_2069638_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.4	7.7e-15
WP_068445312.1|2069627_2070005_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_068445314.1|2070285_2070465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068448270.1|2070479_2071325_-	SPFH domain-containing protein	NA	NA	NA	NA	NA
WP_068445316.1|2072496_2074626_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	42.1	1.0e-124
WP_068445317.1|2074898_2076479_-	acyl--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	36.3	7.3e-72
>prophage 160
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2083772	2087939	3858284		Bacillus_phage(100.0%)	4	NA	NA
WP_068445335.1|2083772_2084444_-	SOS response-associated peptidase	NA	A0A1P8CX02	Bacillus_phage	46.4	5.0e-30
WP_068445337.1|2084482_2085478_-	glutaminase	NA	NA	NA	NA	NA
WP_068445339.1|2085851_2087021_+	MFS transporter	NA	NA	NA	NA	NA
WP_068445341.1|2087081_2087939_-	hypothetical protein	NA	A0A0E3JT82	Bacillus_phage	62.4	6.8e-32
>prophage 161
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2107464	2113232	3858284		Staphylococcus_phage(80.0%)	6	NA	NA
WP_068445369.1|2107464_2109339_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	29.5	1.9e-47
WP_068445372.1|2109343_2109541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156418681.1|2109841_2110321_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	66.7	1.1e-42
WP_068445375.1|2110326_2111529_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	52.9	6.5e-113
WP_068445377.1|2111509_2112160_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	43.7	1.1e-37
WP_068448276.1|2112140_2113232_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	40.4	2.4e-66
>prophage 162
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2120660	2122217	3858284		Staphylococcus_phage(100.0%)	1	NA	NA
WP_156418682.1|2120660_2122217_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	1.8e-14
>prophage 163
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2127800	2128571	3858284		Enterobacteria_phage(100.0%)	1	NA	NA
WP_068443525.1|2127800_2128571_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	37.8	8.6e-42
>prophage 164
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2139808	2140891	3858284		Bacillus_phage(100.0%)	1	NA	NA
WP_068445414.1|2139808_2140891_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.1	8.7e-24
>prophage 165
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2161989	2164381	3858284		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_068445448.1|2161989_2163378_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	46.6	1.7e-117
WP_068445450.1|2163469_2164381_-	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	28.8	2.9e-20
>prophage 166
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2173027	2177260	3858284		Ralstonia_phage(50.0%)	2	NA	NA
WP_068445461.1|2173027_2175031_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	38.7	1.1e-125
WP_068445462.1|2175046_2177260_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	43.1	3.8e-143
>prophage 167
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2185760	2197407	3858284		Prochlorococcus_phage(25.0%)	11	NA	NA
WP_068445477.1|2185760_2187284_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.5	1.6e-79
WP_068445479.1|2187473_2188043_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.5	4.0e-28
WP_068445481.1|2188039_2189059_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FGG1	Synechococcus_phage	45.6	5.8e-70
WP_068445482.1|2189265_2190672_-	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	31.2	3.8e-48
WP_068445485.1|2190656_2192876_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.4	8.8e-148
WP_068445488.1|2192859_2193543_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_068445490.1|2193539_2193791_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_179946402.1|2193787_2194504_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	39.4	2.4e-38
WP_068445493.1|2194500_2195802_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	31.5	1.9e-17
WP_179946403.1|2195798_2196929_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_068445497.1|2196915_2197407_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.8	1.4e-21
>prophage 168
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2202765	2205713	3858284	integrase,transposase	Brevibacillus_phage(50.0%)	2	2200368:2200381	2215336:2215349
2200368:2200381	attL	CTATTGTCATCATA	NA	NA	NA	NA
WP_068445510.1|2202765_2203608_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	32.0	5.9e-28
WP_068440383.1|2204480_2205713_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	24.4	1.3e-07
2215336:2215349	attR	CTATTGTCATCATA	NA	NA	NA	NA
>prophage 169
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2213993	2215529	3858284		Hokovirus(100.0%)	1	NA	NA
WP_068445526.1|2213993_2215529_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	29.4	8.5e-17
>prophage 170
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2222991	2223720	3858284		Bacillus_phage(100.0%)	1	NA	NA
WP_068445540.1|2222991_2223720_+	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	34.5	7.4e-19
>prophage 171
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2231511	2233107	3858284		Planktothrix_phage(100.0%)	1	NA	NA
WP_068445552.1|2231511_2233107_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.6	8.3e-15
>prophage 172
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2250176	2251445	3858284	transposase	uncultured_virus(100.0%)	1	NA	NA
WP_156418687.1|2250176_2251445_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	40.4	8.3e-34
>prophage 173
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2257824	2258415	3858284		Streptomyces_phage(100.0%)	1	NA	NA
WP_068445593.1|2257824_2258415_+	TlpA family protein disulfide reductase	NA	A0A1J0GW78	Streptomyces_phage	58.1	3.8e-05
>prophage 174
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2264271	2272148	3858284	protease,tRNA	uncultured_virus(50.0%)	8	NA	NA
WP_068445608.1|2264271_2265906_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	55.1	1.3e-156
WP_068445610.1|2265959_2266244_-	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	53.8	8.3e-19
WP_068445612.1|2266523_2267237_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_068445613.1|2267243_2267447_+	YdiK family protein	NA	NA	NA	NA	NA
WP_156418786.1|2267601_2268240_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_068448291.1|2268220_2268730_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_068448293.1|2268942_2270859_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	32.0	1.5e-58
WP_068445618.1|2271137_2272148_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	43.5	5.4e-68
>prophage 175
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2282096	2287981	3858284		Bacillus_phage(66.67%)	5	NA	NA
WP_068445630.1|2282096_2282567_-	SprT family protein	NA	U5J9G1	Bacillus_phage	28.8	1.3e-08
WP_179946432.1|2282780_2284235_+	catalase	NA	A0A2K9L0T1	Tupanvirus	39.2	5.9e-100
WP_068445632.1|2284354_2286508_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_068448295.1|2286590_2287181_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_068445634.1|2287189_2287981_-	RNA polymerase sigma factor SigB	NA	A0A0Y0AU18	Bacillus_phage	30.9	2.9e-21
>prophage 176
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2292115	2292475	3858284		Lactobacillus_phage(100.0%)	1	NA	NA
WP_068445650.1|2292115_2292475_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A2P0ZKX3	Lactobacillus_phage	36.0	2.3e-13
>prophage 177
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2301120	2305095	3858284		Klosneuvirus(50.0%)	3	NA	NA
WP_068445663.1|2301120_2302608_-	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	30.3	1.7e-54
WP_068445665.1|2303160_2304066_+	DMT family transporter	NA	NA	NA	NA	NA
WP_068445667.1|2304240_2305095_+	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	28.6	3.5e-28
>prophage 178
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2310124	2321876	3858284		Staphylococcus_phage(50.0%)	13	NA	NA
WP_068445681.1|2310124_2310817_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.8	2.0e-34
WP_068445682.1|2310996_2311623_+	VOC family protein	NA	NA	NA	NA	NA
WP_068445683.1|2311801_2312173_+	helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	50.0	8.3e-27
WP_068445685.1|2312141_2314229_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	57.8	1.9e-221
WP_068445687.1|2314527_2314848_-	thioredoxin family protein	NA	A0A1X9I9P5	Staphylococcus_phage	34.5	2.2e-07
WP_068445689.1|2315005_2315818_-	DUF368 domain-containing protein	NA	NA	NA	NA	NA
WP_068445690.1|2315989_2317156_-	CapA family protein	NA	A0A2H4JG01	uncultured_Caudovirales_phage	33.8	6.6e-54
WP_156418691.1|2317375_2317525_+	YfhE family protein	NA	NA	NA	NA	NA
WP_068445692.1|2317685_2318606_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.4	1.3e-36
WP_068445694.1|2318598_2319549_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_068445697.1|2319620_2319800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068445700.1|2319837_2320257_-	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	54.9	5.9e-37
WP_068445702.1|2320577_2321876_-	arsenic transporter	NA	A0A2H4PQU3	Staphylococcus_phage	63.4	1.8e-145
>prophage 179
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2328093	2329434	3858284		Pithovirus(100.0%)	1	NA	NA
WP_068445716.1|2328093_2329434_+	trypsin-like peptidase domain-containing protein	NA	W5SAB9	Pithovirus	29.6	4.8e-08
>prophage 180
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2332692	2343542	3858284	tRNA	Bacillus_phage(50.0%)	12	NA	NA
WP_068445727.1|2332692_2333385_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.3	5.0e-41
WP_068445729.1|2333384_2334464_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	27.5	4.7e-22
WP_068445731.1|2334950_2335262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082684300.1|2335263_2335875_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_010529359.1|2336019_2336220_-	cold shock domain-containing protein	NA	Q9AZD3	Lactococcus_phage	65.6	4.5e-19
WP_068445735.1|2336522_2337506_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_068448299.1|2337707_2338187_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_068445740.1|2338299_2339739_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	36.9	2.2e-99
WP_068445742.1|2340181_2340733_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	44.3	4.0e-33
WP_068445744.1|2341670_2342156_-	DUF456 domain-containing protein	NA	NA	NA	NA	NA
WP_068448301.1|2342171_2342792_-	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_068445746.1|2342972_2343542_+	M15 family metallopeptidase	NA	A0A0A0RV08	Bacillus_phage	46.6	4.3e-30
>prophage 181
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2346725	2347496	3858284		Planktothrix_phage(100.0%)	1	NA	NA
WP_068445751.1|2346725_2347496_+	ectoine/hydroxyectoine ABC transporter ATP-binding protein EhuA	NA	G9BWD6	Planktothrix_phage	36.6	3.1e-31
>prophage 182
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2359445	2362115	3858284		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_068445781.1|2359445_2360405_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	48.4	4.0e-81
WP_068445783.1|2360388_2361345_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_068445785.1|2361341_2362115_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	1.5e-14
>prophage 183
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2377601	2378054	3858284		Pandoravirus(100.0%)	1	NA	NA
WP_068445813.1|2377601_2378054_-	nucleoside deaminase	NA	S4VYT2	Pandoravirus	34.4	6.0e-11
>prophage 184
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2382454	2384273	3858284		Acinetobacter_phage(100.0%)	2	NA	NA
WP_068445821.1|2382454_2383480_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	33.5	8.7e-50
WP_068445822.1|2383481_2384273_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	39.2	5.2e-34
>prophage 185
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2395584	2397653	3858284		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_068445852.1|2395584_2396670_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	37.2	2.6e-60
WP_068448309.1|2396666_2397653_-	NAD-dependent epimerase/dehydratase family protein	NA	M1NML0	Moumouvirus	28.9	8.2e-29
>prophage 186
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2402229	2403354	3858284		Tupanvirus(100.0%)	1	NA	NA
WP_068445862.1|2402229_2403354_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	33.2	3.9e-35
>prophage 187
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2407367	2408057	3858284		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_068445869.1|2407367_2408057_-	ABC transporter ATP-binding protein	NA	A0A2H4UUX5	Bodo_saltans_virus	24.4	2.6e-05
>prophage 188
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2420633	2421515	3858284		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_068445902.1|2420633_2421515_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.5	8.6e-30
>prophage 189
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2429371	2429908	3858284		Leuconostoc_phage(100.0%)	1	NA	NA
WP_068445921.1|2429371_2429908_-	topology modulation protein	NA	A0A097BYE2	Leuconostoc_phage	41.9	6.4e-36
>prophage 190
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2438642	2446326	3858284		Vibrio_phage(33.33%)	8	NA	NA
WP_068445941.1|2438642_2440205_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	21.4	1.0e-09
WP_068445942.1|2440635_2441346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156418696.1|2441345_2442098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068445945.1|2442075_2442978_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	2.2e-12
WP_068445946.1|2442974_2443361_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_068445948.1|2443805_2444252_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_068445950.1|2444248_2444752_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_068445953.1|2444913_2446326_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A2P1CIG4	Microbacterium_phage	44.4	7.6e-12
>prophage 191
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2456318	2460648	3858284		Tupanvirus(50.0%)	3	NA	NA
WP_068445968.1|2456318_2457932_+	catalase	NA	A0A2K9L572	Tupanvirus	44.2	3.9e-97
WP_068445969.1|2458141_2459749_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_068445970.1|2459748_2460648_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.9	9.1e-27
>prophage 192
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2477988	2488488	3858284		Streptococcus_phage(25.0%)	9	NA	NA
WP_068448315.1|2477988_2479998_-	sulfatase-like hydrolase/transferase	NA	W6LM83	Streptococcus_phage	42.1	2.7e-127
WP_068446005.1|2480292_2480661_+	DUF393 domain-containing protein	NA	NA	NA	NA	NA
WP_068446007.1|2480845_2481853_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_068446008.1|2481883_2482915_-	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	29.0	7.0e-15
WP_068446010.1|2482930_2483815_-	NAD-dependent deacetylase	NA	NA	NA	NA	NA
WP_068446012.1|2483824_2484619_-	protein-ADP-ribose hydrolase	NA	A0A140G0J9	Infectious_spleen_and_kidney_necrosis_virus	39.2	1.7e-21
WP_068446014.1|2484714_2485047_-	glycine cleavage system protein H	NA	NA	NA	NA	NA
WP_068446015.1|2485365_2486550_+	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_068448317.1|2486685_2488488_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q84421	Paramecium_bursaria_Chlorella_virus	38.6	6.1e-99
>prophage 193
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2497252	2498155	3858284		Klosneuvirus(100.0%)	1	NA	NA
WP_068446024.1|2497252_2498155_-	arginase	NA	A0A1V0SJM8	Klosneuvirus	30.4	7.7e-26
>prophage 194
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2505418	2507527	3858284		Tupanvirus(100.0%)	1	NA	NA
WP_082684204.1|2505418_2507527_+	catalase	NA	A0A2K9L572	Tupanvirus	41.6	3.0e-113
>prophage 195
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2518306	2519020	3858284		Thermus_virus(100.0%)	1	NA	NA
WP_068446047.1|2518306_2519020_-	N-acetylmuramoyl-L-alanine amidase CwlD	NA	C8CHK8	Thermus_virus	40.0	2.7e-05
>prophage 196
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2527516	2529204	3858284		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_068446065.1|2527516_2528389_-	energy-coupling factor ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.4	1.8e-16
WP_068446067.1|2528364_2529204_-	energy-coupling factor ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.4	9.1e-21
>prophage 197
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2544981	2557242	3858284		Hokovirus(25.0%)	7	NA	NA
WP_068446123.1|2544981_2546172_-	elongation factor Tu	NA	A0A1V0SGC3	Hokovirus	27.7	1.2e-31
WP_068446125.1|2546295_2548374_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.9	2.3e-65
WP_068446127.1|2548527_2548998_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_068446130.1|2549034_2549457_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_068448321.1|2549596_2549848_-	50S ribosomal protein L7ae-like protein	NA	NA	NA	NA	NA
WP_068446132.1|2549990_2553605_-	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.5	1.3e-63
WP_068446134.1|2553705_2557242_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	24.8	7.4e-48
>prophage 198
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2561491	2569450	3858284	tRNA	Bacillus_virus(33.33%)	10	NA	NA
WP_068446147.1|2561491_2562025_-	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	31.4	3.7e-12
WP_082684205.1|2562193_2562370_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_082684206.1|2562404_2562551_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_068446149.1|2562620_2563274_-	RNA polymerase sporulation sigma factor SigH	NA	NA	NA	NA	NA
WP_068446150.1|2563379_2563889_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_068446152.1|2563891_2564635_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_068446154.1|2564642_2565035_-	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_068446156.1|2565024_2566437_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	30.2	3.2e-50
WP_179946406.1|2566417_2567092_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_068446158.1|2567980_2569450_-|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L0I5	Tupanvirus	27.3	3.6e-12
>prophage 199
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2572495	2577997	3858284	protease	Cronobacter_phage(50.0%)	5	NA	NA
WP_068446161.1|2572495_2574928_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	40.6	7.7e-129
WP_068446163.1|2574944_2576009_-	protein arginine kinase	NA	NA	NA	NA	NA
WP_068446165.1|2576005_2576539_-	UvrB/UvrC motif-containing protein	NA	NA	NA	NA	NA
WP_068446167.1|2576553_2577021_-	CtsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_179946407.1|2577295_2577997_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	49.0	6.2e-15
>prophage 200
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2589992	2594774	3858284	tRNA	Tupanvirus(33.33%)	7	NA	NA
WP_068448339.1|2589992_2591474_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	38.8	9.2e-93
WP_068446169.1|2591574_2591781_-|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
WP_068446171.1|2591788_2592016_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_068446172.1|2591985_2592498_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_068446174.1|2592494_2592860_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_068446176.1|2592852_2593686_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.2	4.6e-25
WP_068446178.1|2593847_2594774_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	59.7	3.7e-100
>prophage 201
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2598195	2600982	3858284	protease	Bathycoccus_sp._RCC1105_virus(50.0%)	2	NA	NA
WP_068446184.1|2598195_2600256_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	E5EQU5	Bathycoccus_sp._RCC1105_virus	49.7	2.2e-113
WP_068446186.1|2600439_2600982_-	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	26.8	4.8e-07
>prophage 202
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2613151	2613688	3858284		Paenibacillus_phage(100.0%)	1	NA	NA
WP_068446202.1|2613151_2613688_-	stage V sporulation protein T	NA	A0A2I7SC16	Paenibacillus_phage	72.5	2.4e-11
>prophage 203
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2619280	2621629	3858284		Tupanvirus(100.0%)	2	NA	NA
WP_068446212.1|2619280_2620234_-	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	37.5	4.4e-48
WP_068446214.1|2620249_2621629_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L4K9	Tupanvirus	37.1	3.1e-34
>prophage 204
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2628320	2634708	3858284	tRNA	Bacillus_phage(20.0%)	6	NA	NA
WP_068446230.1|2628320_2629586_-	G5 and 3D domain-containing protein	NA	A0A217ER34	Bacillus_phage	69.2	1.3e-26
WP_068446233.1|2629792_2630566_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_068446235.1|2630634_2632593_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	37.9	7.9e-100
WP_068446237.1|2632888_2633167_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	55.6	5.7e-12
WP_068446239.1|2633555_2634437_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	47.8	7.5e-66
WP_068446242.1|2634414_2634708_-	GIY-YIG nuclease family protein	NA	W8W2G4	Invertebrate_iridovirus	40.0	3.1e-08
>prophage 205
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2638260	2638893	3858284		Streptococcus_phage(100.0%)	1	NA	NA
WP_068446251.1|2638260_2638893_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	51.2	1.2e-52
>prophage 206
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2642605	2647789	3858284		Bacteriophage(50.0%)	4	NA	NA
WP_068446266.1|2642605_2644303_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	33.4	9.0e-52
WP_068446268.1|2644462_2645581_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_068446270.1|2645577_2646843_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_068446272.1|2646856_2647789_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.0	9.4e-27
>prophage 207
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2654580	2657459	3858284	transposase	Trichoplusia_ni_ascovirus(33.33%)	3	NA	NA
WP_068446288.1|2654580_2655342_-	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.1	3.0e-15
WP_082684210.1|2655576_2656170_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	37.8	2.0e-06
WP_156418703.1|2656190_2657459_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	41.0	1.7e-34
>prophage 208
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2668462	2669047	3858284		Enterococcus_phage(100.0%)	1	NA	NA
WP_068446314.1|2668462_2669047_-	TIGR00730 family Rossman fold protein	NA	A0A1D3SNB7	Enterococcus_phage	37.8	1.1e-17
>prophage 209
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2687728	2712342	3858284	tRNA	Bacillus_virus(18.18%)	20	NA	NA
WP_068446356.1|2687728_2689018_+	glycoside hydrolase family 18 protein	NA	A0A2P1CIG4	Microbacterium_phage	33.3	3.7e-05
WP_068446358.1|2689068_2689587_-	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	33.1	2.1e-12
WP_068446360.1|2689771_2691487_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	67.3	1.7e-194
WP_068446362.1|2692078_2692726_+	deoxynucleoside kinase	NA	NA	NA	NA	NA
WP_068446365.1|2692738_2693422_+	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	36.3	2.9e-25
WP_068446367.1|2693502_2694318_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	33.7	1.8e-29
WP_068446369.1|2694767_2695592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068446371.1|2695581_2696085_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_068446373.1|2696428_2696650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068446375.1|2696704_2697982_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.8	5.7e-91
WP_068446378.1|2698496_2699087_-	pyridoxal 5'-phosphate synthase glutaminase subunit PdxT	NA	NA	NA	NA	NA
WP_068446380.1|2699105_2699990_-	pyridoxal 5'-phosphate synthase lyase subunit PdxS	NA	NA	NA	NA	NA
WP_068446382.1|2700051_2701398_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	29.7	6.1e-27
WP_068446384.1|2701575_2703042_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.6	9.7e-95
WP_068446386.1|2704563_2707065_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	36.1	2.5e-114
WP_068446388.1|2707147_2709073_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	46.7	1.9e-154
WP_068446391.1|2709175_2709454_-	DUF370 domain-containing protein	NA	NA	NA	NA	NA
WP_068446393.1|2709468_2710581_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_068448361.1|2710594_2710801_-	S4 domain-containing protein YaaA	NA	NA	NA	NA	NA
WP_068446396.1|2711205_2712342_-	DNA polymerase III subunit beta	NA	A0A1I9SD41	Arthrobacter_phage	22.2	9.4e-13
>prophage 210
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2721680	2727398	3858284	protease	Leptospira_phage(50.0%)	6	NA	NA
WP_156418705.1|2721680_2722541_+	nucleoid occlusion protein	NA	S5VSZ7	Leptospira_phage	33.8	1.0e-14
WP_068446415.1|2722795_2723569_+	AAA family ATPase	NA	Q8JL10	Natrialba_phage	29.4	6.2e-24
WP_068446418.1|2723549_2724389_+	ParB/RepB/Spo0J family partition protein	NA	S5VTK0	Leptospira_phage	39.3	8.2e-14
WP_068448363.1|2724493_2725648_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_068446420.1|2725673_2726378_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_068446422.1|2726738_2727398_-|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	34.9	2.5e-18
>prophage 211
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2731856	2733287	3858284		Caldibacillus_phage(50.0%)	3	NA	NA
WP_068448367.1|2731856_2732333_+	single-stranded DNA-binding protein	NA	A0A290GHL8	Caldibacillus_phage	53.8	2.1e-43
WP_068446432.1|2732398_2732629_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_068448368.1|2732669_2733287_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	31.8	2.9e-24
>prophage 212
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2739007	2751301	3858284		Bacillus_phage(28.57%)	9	NA	NA
WP_068446445.1|2739007_2740381_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	51.0	4.6e-123
WP_068446451.1|2740996_2742283_+	adenylosuccinate synthase	NA	A0A2P1EKE7	Megavirus	36.5	1.5e-67
WP_082684305.1|2742613_2744041_+	M23 family metallopeptidase	NA	A0A075BS18	Microcystis_phage	47.9	2.6e-20
WP_068446455.1|2744357_2745062_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.9	1.1e-43
WP_068446456.1|2745071_2746895_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	34.4	1.3e-35
WP_068446458.1|2746894_2748199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068446460.1|2748201_2749122_+	two-component system regulatory protein YycI	NA	NA	NA	NA	NA
WP_068446461.1|2749130_2749916_+	MBL fold metallo-hydrolase	NA	A0A2I7SDH3	Paenibacillus_phage	36.4	9.7e-41
WP_068446463.1|2750080_2751301_+	trypsin-like peptidase domain-containing protein	NA	W5SAB9	Pithovirus	27.5	1.5e-11
>prophage 213
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2760215	2763578	3858284		Thermus_phage(50.0%)	2	NA	NA
WP_068446482.1|2760215_2762111_+	PrkA family serine protein kinase	NA	A0MN77	Thermus_phage	37.0	1.2e-105
WP_068446484.1|2762408_2763578_+	sporulation protein YhbH	NA	A0A140HLI1	Bacillus_phage	43.9	2.6e-21
>prophage 214
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2789120	2791040	3858284		Streptococcus_phage(100.0%)	1	NA	NA
WP_068446524.1|2789120_2791040_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	39.3	1.1e-114
>prophage 215
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2798746	2799124	3858284		Bacillus_phage(100.0%)	1	NA	NA
WP_082684306.1|2798746_2799124_-	hypothetical protein	NA	A0A0E3T7R5	Bacillus_phage	52.8	1.3e-30
>prophage 216
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2832557	2837247	3858284		Staphylococcus_phage(50.0%)	3	NA	NA
WP_068446598.1|2832557_2834288_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	64.8	1.0e-183
WP_068446600.1|2834469_2835228_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_068446602.1|2835495_2837247_-	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	25.5	7.2e-44
>prophage 217
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2842348	2847870	3858284		Bacillus_thuringiensis_phage(50.0%)	4	NA	NA
WP_068446607.1|2842348_2843332_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	41.3	2.0e-35
WP_156418713.1|2843331_2843550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068446609.1|2843638_2844865_-	DUF819 domain-containing protein	NA	NA	NA	NA	NA
WP_068446610.1|2845056_2847870_+	DEAD/DEAH box helicase	NA	A0A2I7SC38	Paenibacillus_phage	28.0	8.6e-23
>prophage 218
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2856580	2857849	3858284	transposase	uncultured_virus(100.0%)	1	NA	NA
WP_156418687.1|2856580_2857849_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	40.4	8.3e-34
>prophage 219
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2863196	2863919	3858284		Bacillus_phage(100.0%)	1	NA	NA
WP_068446627.1|2863196_2863919_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	53.3	8.6e-28
>prophage 220
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2883726	2898015	3858284		Bacillus_phage(33.33%)	12	NA	NA
WP_068446645.1|2883726_2884899_+	ParM/StbA family protein	NA	A0A1B1P792	Bacillus_phage	38.1	3.3e-61
WP_068446646.1|2884908_2885436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068446647.1|2885553_2886207_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_068446648.1|2886244_2887660_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_068446649.1|2887711_2889331_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.4	3.2e-14
WP_156418715.1|2889784_2889925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068446650.1|2890115_2891003_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_068446651.1|2891955_2894166_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0Y0AS84	Bacillus_phage	64.7	4.1e-270
WP_068446652.1|2894168_2894597_+	flavodoxin	NA	A8ASW0	Listeria_phage	36.6	8.7e-12
WP_068446653.1|2894577_2895621_+	ribonucleotide-diphosphate reductase subunit beta	NA	A0A059T7I4	Listeria_phage	56.6	5.8e-110
WP_156418716.1|2895729_2897004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068446655.1|2897115_2898015_-	N-acetylmuramoyl-L-alanine amidase	NA	C8CHK8	Thermus_virus	37.0	6.5e-09
>prophage 221
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2901387	2920198	3858284	transposase	Staphylococcus_phage(21.43%)	28	NA	NA
WP_068446659.1|2901387_2902215_+	nucleotidyltransferase domain-containing protein	NA	A0A1X9I6C9	Streptococcus_phage	50.6	4.8e-75
WP_068446660.1|2902523_2903774_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_068446661.1|2903766_2904693_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	6.9e-22
WP_068446662.1|2904707_2905613_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_068446663.1|2905929_2906151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068446664.1|2906475_2906988_+	DoxX family protein	NA	NA	NA	NA	NA
WP_068446665.1|2907195_2907573_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	40.6	2.6e-15
WP_068446666.1|2907697_2908291_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	35.9	6.9e-15
WP_068446667.1|2908436_2909153_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_068446668.1|2909396_2909621_+	DUF1659 domain-containing protein	NA	NA	NA	NA	NA
WP_068446669.1|2909656_2909878_+	DUF2922 domain-containing protein	NA	NA	NA	NA	NA
WP_068446670.1|2910004_2911432_-	recombinase family protein	NA	A0A2P1JU08	Anoxybacillus_phage	50.5	1.0e-125
WP_082684307.1|2911397_2911781_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	52.3	3.3e-18
WP_156418718.1|2911945_2912203_-	DUF4352 domain-containing protein	NA	A0A2H4PQN2	Staphylococcus_phage	46.5	1.4e-09
WP_068446673.1|2912233_2912608_-	helix-turn-helix transcriptional regulator	NA	A0A1L2JY18	Aeribacillus_phage	41.0	2.5e-15
WP_068446674.1|2912759_2912978_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_068446675.1|2913008_2913779_+	phage antirepressor KilAC domain-containing protein	NA	A0A0C5ABV5	Paenibacillus_phage	44.3	3.4e-46
WP_068446676.1|2913979_2914495_+	helix-turn-helix transcriptional regulator	NA	A0A290FZK9	Caldibacillus_phage	32.7	2.1e-20
WP_068446677.1|2914578_2915388_+	phage replisome organizer N-terminal domain-containing protein	NA	A8ASN4	Listeria_phage	39.5	9.3e-47
WP_068446678.1|2915400_2916180_+	ATP-binding protein	NA	A0A059T7P1	Staphylococcus_phage	42.7	1.8e-39
WP_068446679.1|2916180_2916363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068446680.1|2916463_2916685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068446681.1|2916681_2916939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156418719.1|2916941_2917112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068446682.1|2917166_2917649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156418720.1|2917648_2917792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068441524.1|2917875_2919429_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	27.6	4.9e-20
WP_068441521.1|2919430_2920198_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	39.9	2.7e-43
>prophage 222
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2928445	2929375	3858284		Salmonella_phage(100.0%)	1	NA	NA
WP_068446688.1|2928445_2929375_-	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	42.6	6.0e-50
>prophage 223
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2936844	2941425	3858284	transposase	Tupanvirus(50.0%)	5	NA	NA
WP_068446694.1|2936844_2937894_+	2,3-butanediol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	24.9	5.7e-12
WP_156418722.1|2938149_2938452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068446696.1|2938647_2938851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068445400.1|2939092_2940658_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_068443525.1|2940654_2941425_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	37.8	8.6e-42
>prophage 224
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2955066	2955309	3858284		Bacillus_phage(100.0%)	1	NA	NA
WP_068446709.1|2955066_2955309_+	hypothetical protein	NA	A0A172JI00	Bacillus_phage	43.9	2.2e-12
>prophage 225
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2961533	2962661	3858284		Brochothrix_phage(100.0%)	1	NA	NA
WP_068446715.1|2961533_2962661_+	peptidoglycan DD-metalloendopeptidase family protein	NA	D7RWE0	Brochothrix_phage	42.9	1.9e-13
>prophage 226
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2966323	2971934	3858284	transposase	Staphylococcus_virus(50.0%)	5	NA	NA
WP_082684225.1|2966323_2968477_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	51.5	1.4e-145
WP_068446719.1|2969585_2970005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068446720.1|2970230_2970524_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_082684226.1|2970683_2971238_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_068446721.1|2971241_2971934_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	1.2e-29
>prophage 227
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	2975771	2978936	3858284		Choristoneura_murinana_nucleopolyhedrovirus(100.0%)	1	NA	NA
WP_068446725.1|2975771_2978936_+	DEAD/DEAH box helicase	NA	V9XTV7	Choristoneura_murinana_nucleopolyhedrovirus	29.3	2.6e-44
>prophage 228
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3001202	3013348	3858284		Planktothrix_phage(14.29%)	9	NA	NA
WP_068446742.1|3001202_3002258_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.0	6.9e-18
WP_068446743.1|3002257_3003193_+	ABC transporter ATP-binding protein	NA	M1IB70	Acanthocystis_turfacea_Chlorella_virus	26.4	1.9e-06
WP_068446744.1|3003440_3004271_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A217EQJ4	Bacillus_phage	71.0	9.6e-31
WP_068446745.1|3004921_3006112_+	glycine C-acetyltransferase	NA	D2TEZ5	Emiliania_huxleyi_virus	28.9	1.4e-43
WP_068446746.1|3006211_3007144_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A222YY99	Synechococcus_phage	25.1	1.1e-06
WP_068446747.1|3007321_3008944_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.9	1.4e-54
WP_068446748.1|3009365_3009992_-	YpmS family protein	NA	NA	NA	NA	NA
WP_082684228.1|3010007_3010913_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_068446750.1|3011608_3013348_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	24.7	4.5e-14
>prophage 229
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3018241	3022016	3858284		Staphylococcus_phage(100.0%)	4	NA	NA
WP_068446754.1|3018241_3019144_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.2	1.4e-22
WP_068446755.1|3019136_3020393_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_068446756.1|3020635_3021304_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_068448386.1|3021293_3022016_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.0	1.6e-45
>prophage 230
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3034292	3037705	3858284		Bacillus_phage(50.0%)	3	NA	NA
WP_068446765.1|3034292_3034979_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.8	4.8e-36
WP_068446766.1|3034975_3036775_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_068446767.1|3036976_3037705_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N9SGH1	Paenibacillus_phage	36.8	5.1e-20
>prophage 231
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3048237	3050388	3858284		Acanthamoeba_polyphaga_lentillevirus(100.0%)	1	NA	NA
WP_068446777.1|3048237_3050388_-	DNA helicase RecQ	NA	J2YAJ8	Acanthamoeba_polyphaga_lentillevirus	35.9	4.8e-74
>prophage 232
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3058113	3066487	3858284		Streptococcus_phage(25.0%)	7	NA	NA
WP_068446784.1|3058113_3059835_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	42.8	5.4e-137
WP_068446785.1|3060143_3060926_+	TerC family protein	NA	S5MAL1	Bacillus_phage	41.1	3.2e-28
WP_068446786.1|3060958_3061318_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_068446787.1|3061477_3061918_+	OsmC family protein	NA	NA	NA	NA	NA
WP_068446788.1|3062170_3063565_+	L-cystine transporter	NA	NA	NA	NA	NA
WP_068446789.1|3063750_3065559_-	DNA ligase D	NA	A0A068CDF3	Rhizobium_phage	32.7	1.6e-17
WP_068446790.1|3065647_3066487_+	Ku protein	NA	A0A0A1EPK3	Mycobacterium_phage	37.5	5.1e-40
>prophage 233
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3070282	3071401	3858284	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_068446794.1|3070282_3071401_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	68.9	4.0e-149
>prophage 234
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3079112	3082468	3858284		Bacillus_phage(50.0%)	3	NA	NA
WP_068446803.1|3079112_3079904_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	38.0	6.0e-06
WP_068446804.1|3080196_3081048_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_068446805.1|3081136_3082468_+	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	27.6	1.3e-24
>prophage 235
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3102343	3105508	3858284		Only_Syngen_Nebraska_virus(50.0%)	3	NA	NA
WP_068446820.1|3102343_3103942_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.1	8.8e-150
WP_068446821.1|3104161_3104518_+	response regulator	NA	NA	NA	NA	NA
WP_068446822.1|3104866_3105508_+	fructose-6-phosphate aldolase	NA	E3SNX1	Prochlorococcus_phage	49.8	2.8e-46
>prophage 236
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3110533	3124568	3858284		Bacillus_virus(16.67%)	14	NA	NA
WP_068446827.1|3110533_3111160_+	thymidine kinase	NA	G3MBK1	Bacillus_virus	41.3	4.5e-33
WP_068446828.1|3111307_3112378_+	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	40.0	5.2e-05
WP_068448398.1|3112393_3113257_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_068446829.1|3113390_3113996_+	stage II sporulation protein R	NA	NA	NA	NA	NA
WP_068446830.1|3114101_3114503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068446831.1|3114966_3115989_+	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	43.2	1.9e-57
WP_068446832.1|3116080_3116635_+	manganese efflux pump	NA	NA	NA	NA	NA
WP_068446833.1|3116835_3117444_+	low molecular weight protein arginine phosphatase	NA	NA	NA	NA	NA
WP_068448400.1|3117477_3117936_+	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
WP_068446834.1|3117942_3118509_+	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_068446835.1|3118586_3119822_+	serine hydroxymethyltransferase	NA	A0A240F2Y9	Aeromonas_phage	52.6	2.3e-97
WP_068446836.1|3120054_3120684_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_068446837.1|3120698_3121814_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	29.4	5.6e-26
WP_068446838.1|3122384_3124568_+	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	37.5	2.2e-18
>prophage 237
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3137890	3146390	3858284		Clostridium_phage(33.33%)	7	NA	NA
WP_068446855.1|3137890_3138898_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.6	1.7e-18
WP_068446857.1|3138916_3140578_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_068446859.1|3140801_3141758_+	C40 family peptidase	NA	A0A0A8WIF2	Clostridium_phage	33.3	1.1e-14
WP_068446861.1|3141757_3142777_+	ATP-binding cassette domain-containing protein	NA	M1IB70	Acanthocystis_turfacea_Chlorella_virus	25.5	1.1e-07
WP_082684230.1|3142942_3144064_+	stage II sporulation protein D	NA	Q2XU88	Pseudomonas_phage	40.7	3.7e-46
WP_068446862.1|3144295_3145297_+	M23 family metallopeptidase	NA	A0A0K2CNY2	Brevibacillus_phage	35.8	5.8e-06
WP_068446867.1|3146105_3146390_+	sporulation transcriptional regulator SpoIIID	NA	M9Q261	Clostridium_phage	45.3	2.6e-12
>prophage 238
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3152595	3160602	3858284		Leptospira_phage(33.33%)	7	NA	NA
WP_068446881.1|3152595_3155670_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	26.5	5.9e-110
WP_068446883.1|3156084_3157053_+	NERD domain-containing protein	NA	NA	NA	NA	NA
WP_068446885.1|3157364_3157655_+	hypothetical protein	NA	A0A0M4R382	Bacillus_phage	53.4	2.5e-18
WP_068446887.1|3157662_3158106_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_068446889.1|3158167_3158905_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_068446890.1|3159241_3159670_-	DUF2935 domain-containing protein	NA	NA	NA	NA	NA
WP_068446892.1|3159861_3160602_+	heme ABC exporter ATP-binding protein CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	32.1	4.7e-29
>prophage 239
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3165475	3166357	3858284		Bacillus_phage(100.0%)	1	NA	NA
WP_068446904.1|3165475_3166357_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	52.7	1.2e-76
>prophage 240
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3171984	3174185	3858284		Bacillus_phage(100.0%)	2	NA	NA
WP_068446916.1|3171984_3172878_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	57.0	3.1e-83
WP_068446918.1|3172877_3174185_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	40.9	4.9e-90
>prophage 241
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3178268	3187249	3858284		Catovirus(50.0%)	5	NA	NA
WP_068446931.1|3178268_3179825_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.9	6.9e-14
WP_082684232.1|3179850_3181764_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	39.1	1.8e-16
WP_082684309.1|3182443_3184105_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.2	4.6e-16
WP_068446934.1|3184180_3185572_+	teichuronopeptide biosynthesis	NA	NA	NA	NA	NA
WP_068446936.1|3185620_3187249_+	acylphosphatase	NA	S4VXG8	Pandoravirus	28.2	9.4e-06
>prophage 242
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3196221	3197757	3858284		Staphylococcus_phage(100.0%)	1	NA	NA
WP_068446948.1|3196221_3197757_+	peptidoglycan-binding protein	NA	H9A0W8	Staphylococcus_phage	39.0	1.5e-32
>prophage 243
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3200813	3201485	3858284		Bacillus_phage(100.0%)	1	NA	NA
WP_179946434.1|3200813_3201485_+	phosphoadenylyl-sulfate reductase	NA	M4W6M9	Bacillus_phage	25.8	1.3e-09
>prophage 244
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3205176	3205560	3858284		Hokovirus(100.0%)	1	NA	NA
WP_068446964.1|3205176_3205560_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	39.3	3.3e-18
>prophage 245
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3209323	3209911	3858284		Salmonella_phage(100.0%)	1	NA	NA
WP_068446977.1|3209323_3209911_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	34.6	2.0e-11
>prophage 246
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3230434	3231970	3858284		Aeromonas_phage(100.0%)	1	NA	NA
WP_068447006.1|3230434_3231970_+	sodium:solute symporter	NA	A0A219Y9P9	Aeromonas_phage	26.8	1.5e-24
>prophage 247
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3275635	3277171	3858284		Staphylococcus_phage(100.0%)	1	NA	NA
WP_068447075.1|3275635_3277171_+	xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	7.5e-21
>prophage 248
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3280795	3281464	3858284		Bacillus_phage(100.0%)	1	NA	NA
WP_068447085.1|3280795_3281464_+	hypothetical protein	NA	U5Q0C0	Bacillus_phage	56.3	1.8e-35
>prophage 249
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3287691	3293216	3858284		Cedratvirus(66.67%)	6	NA	NA
WP_068447102.1|3287691_3288531_+	ATP-binding cassette domain-containing protein	NA	A0A1M7XV31	Cedratvirus	24.4	6.8e-08
WP_068447104.1|3288543_3289725_+	phosphonate metabolism protein PhnM	NA	NA	NA	NA	NA
WP_068447106.1|3289739_3290453_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.7	4.5e-13
WP_068447108.1|3290442_3291264_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_068447109.1|3291325_3292369_+	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_068447111.1|3292451_3293216_+	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	28.0	5.2e-15
>prophage 250
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3303896	3306769	3858284		Leuconostoc_phage(50.0%)	3	NA	NA
WP_082684312.1|3303896_3304577_-	Ltp family lipoprotein	NA	A0A097BY93	Leuconostoc_phage	65.3	4.0e-11
WP_068447135.1|3304915_3305107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068447138.1|3305074_3306769_-	thiamine pyrophosphate-binding protein	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.8	1.0e-31
>prophage 251
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3312542	3317631	3858284	transposase	Vibrio_phage(50.0%)	3	NA	NA
WP_068447146.1|3312542_3314060_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.4	2.3e-22
WP_082684237.1|3314873_3316298_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_068440383.1|3316398_3317631_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	24.4	1.3e-07
>prophage 252
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3356607	3361734	3858284		Catovirus(50.0%)	4	NA	NA
WP_068447211.1|3356607_3358125_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	40.8	3.6e-92
WP_068447213.1|3358223_3359540_+	Na+/H+ antiporter family protein	NA	NA	NA	NA	NA
WP_068447215.1|3359734_3360589_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_068447217.1|3360837_3361734_+	decarboxylating 6-phosphogluconate dehydrogenase	NA	A0A1D8KGX1	Synechococcus_phage	35.8	1.3e-54
>prophage 253
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3372742	3373480	3858284		Escherichia_phage(100.0%)	1	NA	NA
WP_156418740.1|3372742_3373480_-	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	26.5	3.0e-12
>prophage 254
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3404328	3405480	3858284		Tupanvirus(100.0%)	1	NA	NA
WP_068447284.1|3404328_3405480_+	sulfate adenylyltransferase	NA	A0A2K9L4R9	Tupanvirus	32.5	6.8e-51
>prophage 255
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3408971	3409553	3858284		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_082684241.1|3408971_3409553_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.6	3.2e-25
>prophage 256
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3412812	3413994	3858284		Clostridium_phage(100.0%)	1	NA	NA
WP_068447294.1|3412812_3413994_+	XRE family transcriptional regulator	NA	A0A0A7RTT7	Clostridium_phage	29.3	5.9e-34
>prophage 257
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3433835	3435224	3858284		Pandoravirus(100.0%)	1	NA	NA
WP_068447323.1|3433835_3435224_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	29.4	4.2e-47
>prophage 258
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3444068	3449008	3858284		uncultured_Caudovirales_phage(33.33%)	3	NA	NA
WP_068447333.1|3444068_3446108_-	DEAD/DEAH box helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	28.8	1.2e-45
WP_068447335.1|3446506_3448039_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	21.5	2.1e-07
WP_068447337.1|3448171_3449008_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	28.1	5.1e-32
>prophage 259
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3477157	3482048	3858284		Lactobacillus_phage(66.67%)	5	NA	NA
WP_068447378.1|3477157_3478045_-	fructose bisphosphate aldolase	NA	A0A0K0KVJ8	Prochlorococcus_phage	30.2	3.0e-06
WP_068447379.1|3478270_3478813_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	38.8	1.2e-26
WP_068447381.1|3479017_3479908_+	DMT family transporter	NA	NA	NA	NA	NA
WP_068447382.1|3479956_3481012_-	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
WP_068447383.1|3481142_3482048_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	21.9	1.5e-08
>prophage 260
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3485647	3487576	3858284		Micromonas_sp._RCC1109_virus(100.0%)	2	NA	NA
WP_068447390.1|3485647_3486538_+	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	37.0	6.9e-43
WP_068447392.1|3486553_3487576_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	33.8	2.0e-46
>prophage 261
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3499789	3500539	3858284		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_068447412.1|3499789_3500539_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	28.6	1.1e-12
>prophage 262
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3515088	3519685	3858284		Streptococcus_phage(50.0%)	4	NA	NA
WP_068447434.1|3515088_3516042_+	hydroxyacid dehydrogenase	NA	M1NSB9	Streptococcus_phage	34.5	8.7e-36
WP_068447436.1|3516131_3516611_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_068447438.1|3516861_3518403_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_068447442.1|3518818_3519685_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	45.7	1.6e-57
>prophage 263
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3530968	3531898	3858284		Staphylococcus_phage(100.0%)	1	NA	NA
WP_068447462.1|3530968_3531898_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	37.3	1.0e-36
>prophage 264
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3535006	3539866	3858284		Cedratvirus(100.0%)	1	NA	NA
WP_068447470.1|3535006_3539866_+	5'-nucleotidase C-terminal domain-containing protein	NA	A0A1M7XTW9	Cedratvirus	27.2	8.4e-26
>prophage 265
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3548381	3549263	3858284		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_068447489.1|3548381_3549263_-	MoxR family ATPase	NA	A0A142EZN6	Stenotrophomonas_phage	25.1	2.7e-07
>prophage 266
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3558581	3559598	3858284		Staphylococcus_phage(100.0%)	1	NA	NA
WP_068447505.1|3558581_3559598_+	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	47.4	3.5e-83
>prophage 267
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3563046	3565191	3858284		Aureococcus_anophage(33.33%)	3	NA	NA
WP_068447510.1|3563046_3563700_+	reverse transcriptase-like protein	NA	A0A076FI68	Aureococcus_anophage	31.7	5.8e-07
WP_068447512.1|3564052_3564547_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	60.9	2.1e-49
WP_068447514.1|3564597_3565191_+	queuosine precursor transporter	NA	R4TNY5	Halovirus	38.5	1.6e-16
>prophage 268
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3570002	3574868	3858284		Yellowstone_lake_phycodnavirus(50.0%)	4	NA	NA
WP_068447523.1|3570002_3571730_+	biosynthetic-type acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	29.6	3.1e-55
WP_068447525.1|3571726_3572245_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_068447527.1|3572290_3573337_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_068447529.1|3573323_3574868_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	24.7	3.9e-09
>prophage 269
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3581715	3582654	3858284		Hokovirus(100.0%)	1	NA	NA
WP_068447545.1|3581715_3582654_+	MBL fold metallo-hydrolase	NA	A0A1V0SGC6	Hokovirus	22.9	6.4e-07
>prophage 270
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3585974	3586664	3858284		Feldmannia_irregularis_virus(100.0%)	1	NA	NA
WP_068447552.1|3585974_3586664_+	response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	25.6	1.5e-05
>prophage 271
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3593782	3595282	3858284		Staphylococcus_phage(100.0%)	1	NA	NA
WP_068447566.1|3593782_3595282_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.6	3.4e-18
>prophage 272
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3601459	3602242	3858284		Bacillus_virus(100.0%)	1	NA	NA
WP_068447579.1|3601459_3602242_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.4	4.3e-33
>prophage 273
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3608791	3612008	3858284		Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
WP_068447589.1|3608791_3609775_-	D-glycerate dehydrogenase	NA	A7ITA6	Paramecium_bursaria_Chlorella_virus	25.5	6.7e-15
WP_068447591.1|3609974_3610652_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_068447594.1|3610655_3612008_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.0	1.2e-25
>prophage 274
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3620863	3624655	3858284		Staphylococcus_phage(50.0%)	3	NA	NA
WP_068447609.1|3620863_3621691_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	48.9	3.2e-71
WP_068447611.1|3622076_3623636_+	AbgT family transporter	NA	NA	NA	NA	NA
WP_068447613.1|3623821_3624655_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	34.7	4.2e-42
>prophage 275
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3629883	3634918	3858284		Escherichia_phage(66.67%)	6	NA	NA
WP_068447620.1|3629883_3630996_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A2K9L0G1	Tupanvirus	30.5	1.0e-27
WP_068447622.1|3631006_3631372_-	EamA family transporter	NA	NA	NA	NA	NA
WP_068448449.1|3631371_3632046_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_068447624.1|3632050_3633001_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_068447626.1|3632979_3633993_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	44.4	9.5e-73
WP_068447628.1|3633985_3634918_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	57.9	1.4e-91
>prophage 276
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3645359	3648397	3858284		Streptococcus_phage(50.0%)	4	NA	NA
WP_068447649.1|3645359_3646478_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	35.9	8.1e-41
WP_082684319.1|3646668_3646998_+	GntP family permease	NA	NA	NA	NA	NA
WP_068447652.1|3647091_3647874_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_068447657.1|3648199_3648397_+	alpha/beta-type small acid-soluble spore protein	NA	Q77YX0	Bacillus_phage	51.6	2.9e-10
>prophage 277
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3695103	3697816	3858284		Staphylococcus_phage(50.0%)	3	NA	NA
WP_068447737.1|3695103_3696057_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.8	4.6e-21
WP_068447739.1|3696053_3696830_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_068447741.1|3697033_3697816_+	carbon-nitrogen family hydrolase	NA	M1HAZ6	Paramecium_bursaria_Chlorella_virus	24.7	5.7e-09
>prophage 278
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3701637	3703687	3858284		Streptococcus_phage(50.0%)	2	NA	NA
WP_082684263.1|3701637_3702654_-	LCP family protein	NA	A0A1X9I5X1	Streptococcus_phage	30.9	3.7e-24
WP_068447747.1|3703357_3703687_+	helix-turn-helix domain-containing protein	NA	Q786F1	Bacillus_phage	35.6	9.4e-06
>prophage 279
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3709499	3711795	3858284		Staphylococcus_phage(50.0%)	2	NA	NA
WP_068447759.1|3709499_3710345_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	37.2	1.2e-17
WP_068447761.1|3710424_3711795_+	DEAD/DEAH box helicase	NA	A0A1X9I5S6	Streptococcus_phage	38.1	5.2e-66
>prophage 280
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3719284	3724102	3858284		Planktothrix_phage(33.33%)	4	NA	NA
WP_068447772.1|3719284_3719971_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	36.3	8.2e-28
WP_068447774.1|3719960_3720854_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_068447775.1|3721076_3722492_+	M23 family metallopeptidase	NA	D6QWN5	uncultured_phage	38.1	1.5e-07
WP_068447777.1|3722650_3724102_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	32.6	2.3e-24
>prophage 281
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3731277	3734157	3858284		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_068447792.1|3731277_3734157_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.5	2.6e-309
>prophage 282
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3741283	3745863	3858284		Bacillus_virus(33.33%)	4	NA	NA
WP_068447814.1|3741283_3742723_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	49.3	8.3e-123
WP_068447816.1|3742915_3743464_+	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
WP_068447818.1|3743574_3744792_+	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	27.5	9.5e-11
WP_068447820.1|3744999_3745863_+	aquaporin family protein	NA	M1IAZ4	Acanthocystis_turfacea_Chlorella_virus	31.8	8.2e-25
>prophage 283
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3754518	3762736	3858284		Bacillus_virus(28.57%)	9	NA	NA
WP_068447832.1|3754518_3755472_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	49.5	1.2e-82
WP_068447834.1|3755853_3756318_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_068447836.1|3756333_3757218_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.0	5.1e-06
WP_068447838.1|3757219_3758188_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	36.2	3.2e-54
WP_068447840.1|3758228_3759179_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.1	2.5e-51
WP_068447842.1|3759359_3759611_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_068447844.1|3759826_3760420_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.8	1.5e-54
WP_068447846.1|3760758_3761778_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	8.7e-18
WP_068447849.1|3761752_3762736_+	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.8e-15
>prophage 284
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3776179	3780109	3858284		Catovirus(50.0%)	4	NA	NA
WP_169792892.1|3776179_3777511_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	25.9	4.2e-20
WP_082684267.1|3777525_3777738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068447872.1|3777741_3779316_+	CoA-transferase	NA	NA	NA	NA	NA
WP_068447874.1|3779368_3780109_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.1	5.7e-19
>prophage 285
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3800242	3801529	3858284		Streptococcus_phage(100.0%)	1	NA	NA
WP_068447908.1|3800242_3801529_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	67.8	1.6e-165
>prophage 286
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3807226	3811886	3858284		Yaba-like_disease_virus(50.0%)	4	NA	NA
WP_068447916.1|3807226_3808159_-	alpha/beta hydrolase	NA	Q9DHU9	Yaba-like_disease_virus	27.0	7.7e-13
WP_068447918.1|3808322_3808556_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_068447920.1|3808890_3809637_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_068447922.1|3809687_3811886_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	39.5	8.3e-90
>prophage 287
NZ_CP013862	Lentibacillus amyloliquefaciens strain LAM0015 chromosome, complete genome	3858284	3815000	3857468	3858284	capsid,transposase,terminase,plate,protease,integrase,holin,portal,head,tail	Bacillus_phage(25.64%)	70	3815928:3815954	3855695:3855721
WP_068447932.1|3815000_3815468_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	65.3	7.7e-46
3815928:3815954	attL	GATTCCCACCGTCTCCACCAATACATA	NA	NA	NA	NA
WP_068447934.1|3816009_3817074_-|integrase	site-specific integrase	integrase	H0UST3	Bacillus_phage	50.1	3.9e-93
WP_082684270.1|3817236_3817446_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_169792838.1|3817401_3817551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068447936.1|3817547_3817943_-	helix-turn-helix domain-containing protein	NA	A0A2H4JDE4	uncultured_Caudovirales_phage	63.2	1.4e-16
WP_156418757.1|3818100_3818322_+	XRE family transcriptional regulator	NA	A0A2I7SCT7	Paenibacillus_phage	62.3	3.7e-14
WP_068447940.1|3818504_3819242_+	phage regulatory protein/antirepressor Ant	NA	A0A2H4JCT2	uncultured_Caudovirales_phage	52.9	6.9e-57
WP_068447942.1|3819238_3819460_+	helix-turn-helix domain-containing protein	NA	A0A1B2APY7	Phage_Wrath	50.8	1.4e-08
WP_068447944.1|3819461_3819773_+	TM2 domain-containing protein	NA	A0A127AZ85	Bacillus_phage	43.8	6.1e-15
WP_068447947.1|3819774_3819990_+	hypothetical protein	NA	Q5YAA2	Bacillus_phage	36.9	2.7e-06
WP_068447948.1|3819990_3820236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068447950.1|3820236_3820467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156418758.1|3820552_3820726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068447952.1|3820846_3821083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068447954.1|3821149_3821410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068447956.1|3821423_3821957_+	host-nuclease inhibitor Gam family protein	NA	A0A0K2CZ48	Paenibacillus_phage	38.5	5.4e-27
WP_068447964.1|3821953_3822649_+	AAA family ATPase	NA	A0A2H4J2Z5	uncultured_Caudovirales_phage	61.8	3.4e-82
WP_082684271.1|3822645_3823980_+	DEAD/DEAH box helicase family protein	NA	Q8W5V9	Listeria_phage	58.7	8.5e-138
WP_068447966.1|3823996_3824515_+	DUF669 domain-containing protein	NA	A0A1P8BMS1	Lactococcus_phage	45.0	1.5e-21
WP_068447967.1|3824526_3826827_+	DNA primase	NA	Q8W5V7	Listeria_phage	55.9	7.8e-248
WP_068447968.1|3827176_3827365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068447970.1|3827351_3827684_+	VRR-NUC domain-containing protein	NA	Q8W5V6	Listeria_phage	63.5	6.7e-28
WP_068447972.1|3827670_3827940_+	hypothetical protein	NA	A0A290GJP7	Caldibacillus_phage	66.2	2.0e-22
WP_068447975.1|3827929_3828139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156418759.1|3828570_3829119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156418760.1|3829115_3829277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068447982.1|3829273_3829645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068447984.1|3829641_3829890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068447985.1|3829891_3830095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068447986.1|3830318_3830597_+	hypothetical protein	NA	A0A0S2MYC7	Enterococcus_phage	38.0	8.5e-08
WP_068447988.1|3830714_3830906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068447989.1|3830921_3831119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068447991.1|3831119_3831698_+	dUTP diphosphatase	NA	Q5YA87	Bacillus_phage	46.9	2.2e-42
WP_156418761.1|3831697_3831868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169792893.1|3831864_3832023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068447992.1|3832082_3832331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068448473.1|3832345_3832756_+	transcriptional regulator	NA	E5DV97	Deep-sea_thermophilic_phage	39.6	8.1e-23
WP_068447994.1|3832746_3832938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156418762.1|3833118_3833271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082684273.1|3833276_3833597_+	HNH endonuclease	NA	A0A0U4JIC7	Exiguobacterium_phage	61.2	4.7e-26
WP_068447995.1|3833703_3834060_+|terminase	P27 family phage terminase small subunit	terminase	A0A0U4JV93	Exiguobacterium_phage	54.7	6.3e-24
WP_068447996.1|3834056_3835790_+|terminase	terminase large subunit	terminase	A6XMJ4	Bacillus_virus	72.7	3.0e-252
WP_068447997.1|3835807_3836983_+|portal	phage portal protein	portal	A0A1S5S8H6	Streptococcus_phage	57.4	3.4e-130
WP_156418763.1|3837051_3837351_+	hypothetical protein	NA	A0A1V0DY51	Dinoroseobacter_phage	65.9	1.8e-08
WP_068448000.1|3837350_3837926_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0S2SXJ4	Bacillus_phage	50.3	2.5e-46
WP_068448002.1|3837918_3839097_+|capsid	phage major capsid protein	capsid	A0A0S2SXJ6	Bacillus_phage	62.8	1.2e-108
WP_068448004.1|3839110_3839290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068448007.1|3839282_3839576_+	hypothetical protein	NA	Q0H259	Geobacillus_phage	50.6	2.4e-21
WP_068448008.1|3839559_3839865_+|head	phage head closure protein	head	A6XMK0	Bacillus_virus	58.4	1.4e-27
WP_068448009.1|3839857_3840223_+	hypothetical protein	NA	A0A290FZT5	Caldibacillus_phage	51.7	5.1e-21
WP_068448011.1|3840219_3840534_+	hypothetical protein	NA	A6XMK2	Bacillus_virus	56.7	6.4e-28
WP_068448013.1|3840534_3841110_+|tail	phage tail protein	tail	A0A0U4JWV5	Exiguobacterium_phage	64.4	3.8e-63
WP_068448015.1|3841123_3841480_+	hypothetical protein	NA	D2XR24	Bacillus_phage	52.5	1.1e-28
WP_156418764.1|3841812_3843963_+	hypothetical protein	NA	A0A290FZP4	Caldibacillus_phage	51.0	3.5e-16
WP_068448019.1|3843959_3844769_+|tail	phage tail family protein	tail	A0A290FZP5	Caldibacillus_phage	42.3	3.8e-56
WP_068448024.1|3844895_3845168_+|plate	BppU family phage baseplate upper protein	plate	NA	NA	NA	NA
WP_068448025.1|3845331_3845823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068448027.1|3845822_3846335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068448029.1|3846338_3849185_+|tail	phage tail protein	tail	A0A2H4J3N3	uncultured_Caudovirales_phage	49.8	1.0e-108
WP_156418601.1|3849301_3849811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068448031.1|3849985_3850366_+	DUF2951 family protein	NA	NA	NA	NA	NA
WP_068440011.1|3850366_3850636_+|holin	phage holin	holin	J7KDR1	Streptococcus_phage	51.8	2.3e-18
WP_068448033.1|3850637_3851867_+	N-acetylmuramoyl-L-alanine amidase	NA	U5PU59	Bacillus_phage	51.9	1.2e-08
WP_068448039.1|3851960_3852200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169792839.1|3852753_3852924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068440021.1|3853014_3853200_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_068440028.1|3853498_3854629_+	hypothetical protein	NA	H0USY1	Bacillus_phage	45.1	2.7e-76
WP_068448041.1|3854570_3855161_+	replication-relaxation family protein	NA	M5AC25	Bacillus_phage	35.5	3.9e-26
WP_068440029.1|3855210_3855540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068440031.1|3856301_3857468_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A191SB13	Nostoc_phage	32.5	3.9e-38
3855695:3855721	attR	GATTCCCACCGTCTCCACCAATACATA	NA	NA	NA	NA
