The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012868	Escherichia coli str. K-12 substr. MG1655 strain K-12 chromosome, complete genome	4641665	1777424	1784563	4641665		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1777424_1778063_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001393459.1|1778154_1779321_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_000848004.1|1779317_1780226_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001272547.1|1780391_1781189_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.0	1.3e-69
WP_001141337.1|1781239_1781896_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001272928.1|1782001_1784563_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 2
NZ_CP012868	Escherichia coli str. K-12 substr. MG1655 strain K-12 chromosome, complete genome	4641665	2165145	2176355	4641665	tail,integrase	Enterobacteria_phage(50.0%)	17	2161455:2161471	2178365:2178381
2161455:2161471	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_001163428.1|2165145_2165346_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_000206809.1|2165477_2165783_-	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001242717.1|2165782_2166145_-	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000008183.1|2166135_2166672_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_000081278.1|2166799_2167624_-	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000135673.1|2167689_2168052_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000128175.1|2168409_2168778_+	hypothetical protein	NA	U5P0A0	Shigella_phage	99.2	1.3e-69
WP_001393497.1|2168774_2169269_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000066913.1|2169268_2169544_+	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_011443597.1|2169593_2170112_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_001106835.1|2170138_2170579_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_047792215.1|2170877_2171159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001030215.1|2171193_2172525_-	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_000703651.1|2172521_2173442_-	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	89.9	4.2e-160
WP_000915541.1|2173438_2173801_-	GtrA family protein	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000958671.1|2173953_2175111_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000368140.1|2175422_2176355_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
2178365:2178381	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 3
NZ_CP012868	Escherichia coli str. K-12 substr. MG1655 strain K-12 chromosome, complete genome	4641665	2525757	2534428	4641665		Enterobacteria_phage(28.57%)	8	NA	NA
WP_001116026.1|2525757_2527152_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
WP_000183060.1|2527326_2528220_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_000699460.1|2528592_2529678_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	5.2e-101
WP_001023610.1|2529677_2530577_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	1.5e-29
WP_000783975.1|2530634_2531516_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	1.9e-106
WP_001100981.1|2531515_2532073_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.5	7.8e-53
WP_001393538.1|2532069_2533317_+	O16 family O-antigen flippase	NA	NA	NA	NA	NA
WP_000272486.1|2533324_2534428_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	59.5	1.0e-133
>prophage 4
NZ_CP012868	Escherichia coli str. K-12 substr. MG1655 strain K-12 chromosome, complete genome	4641665	2993001	3012212	4641665	lysis,tail	Enterobacteria_phage(40.91%)	35	NA	NA
WP_000379575.1|2993001_2993157_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000448564.1|2993323_2993731_-	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000920568.1|2993814_2994045_+	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_011443592.1|2994341_2994491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|2994927_2995260_-	protein FlxA	NA	NA	NA	NA	NA
WP_001326990.1|2995462_2995768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|2995792_2996032_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|2996031_2996319_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|2996390_2996546_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980994.1|2996762_2997014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304870.1|2997080_2997359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001393597.1|2997360_2998410_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	5.7e-113
WP_001047135.1|2998423_2999176_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_120795389.1|2999453_2999543_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|2999597_2999810_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|3000110_3000326_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|3001079_3001295_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189916.1|3001299_3001611_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|3001607_3002141_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|3002137_3002635_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_000066495.1|3002997_3003210_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|3003220_3003409_+	cold-shock protein	NA	NA	NA	NA	NA
WP_120795388.1|3003411_3003477_+	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_001309517.1|3003555_3003711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|3003882_3004056_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000373090.1|3004207_3004618_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001368374.1|3004675_3004909_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000453612.1|3005297_3005867_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001027733.1|3005817_3006780_+|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000885611.1|3006779_3007355_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000078177.1|3007452_3008043_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|3008359_3008593_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|3008661_3008775_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347482.1|3009379_3010663_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527743.1|3010751_3012212_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
>prophage 5
NZ_CP012868	Escherichia coli str. K-12 substr. MG1655 strain K-12 chromosome, complete genome	4641665	3136799	3235102	4641665	tRNA,tail,transposase,lysis,integrase	Escherichia_phage(41.67%)	85	3214050:3214068	3244425:3244443
WP_000826416.1|3136799_3138008_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	1.7e-206
WP_001261013.1|3138539_3139208_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_000586732.1|3139509_3140103_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001301046.1|3140099_3141092_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_001234042.1|3141215_3142196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000140873.1|3142187_3142727_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001296778.1|3142789_3143014_-	YdcH family protein	NA	NA	NA	NA	NA
WP_000375961.1|3143153_3144809_-	glucan biosynthesis protein OpgD	NA	NA	NA	NA	NA
WP_000013789.1|3145033_3146377_-	VOC family protein	NA	NA	NA	NA	NA
WP_000414567.1|3146593_3147517_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001098559.1|3147554_3149195_-	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_001320773.1|3149593_3149743_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731833.1|3149814_3149988_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_000428998.1|3150232_3150763_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000115943.1|3151993_3153433_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001027942.1|3153629_3154430_-	YdcF family protein	NA	NA	NA	NA	NA
WP_000139543.1|3154701_3158604_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
WP_000048950.1|3158804_3159410_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_000627368.1|3159463_3160780_-	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_000431845.1|3160769_3162527_-	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000890941.1|3162542_3163439_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000177515.1|3163438_3164044_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_000910026.1|3164214_3166521_-	DUF2773 domain-containing bactofilin	NA	NA	NA	NA	NA
WP_000097801.1|3166583_3167444_-	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_032313496.1|3167651_3170063_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001254932.1|3171155_3172307_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_085947917.1|3172470_3173743_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_010723099.1|3176434_3176500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001123464.1|3176603_3177194_-	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_000039887.1|3177175_3178126_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_000632280.1|3178226_3179540_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_001206197.1|3179566_3180772_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000018413.1|3180771_3181194_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_000973360.1|3181183_3182611_-	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000969784.1|3182612_3183401_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_001292353.1|3183400_3184168_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000206388.1|3184164_3185235_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001189201.1|3185242_3185740_-	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_001072837.1|3185754_3186501_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_000073393.1|3186509_3186797_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_000191077.1|3186808_3187738_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_001186469.1|3188022_3190068_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000535469.1|3190315_3192589_+	primary-amine oxidase	NA	NA	NA	NA	NA
WP_000138615.1|3192646_3194146_-	phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001067514.1|3194381_3195287_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_001300734.1|3195458_3195785_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698145.1|3195792_3195978_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_000900941.1|3195974_3198614_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762236.1|3198821_3199811_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
WP_001298828.1|3199921_3200344_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|3200340_3200607_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_000628244.1|3200880_3204405_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837921.1|3204771_3205905_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
WP_001300461.1|3206045_3206480_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_120795384.1|3207258_3207372_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836770.1|3207440_3207674_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_000086527.1|3207990_3208581_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_001698950.1|3208678_3209254_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000279097.1|3209253_3212616_-|tail	side tail fiber protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_000019448.1|3212938_3213919_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
3214050:3214068	attL	GCTTATTCGCACCTTCCCT	NA	NA	NA	NA
WP_000091628.1|3215684_3216044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001350510.1|3216024_3216288_-	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_001097895.1|3216425_3217883_-	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001228696.1|3218079_3218265_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_000450663.1|3218352_3218913_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_000788970.1|3218935_3219682_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000899748.1|3219688_3220546_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000693797.1|3220558_3220981_-	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000712069.1|3221003_3221300_-	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000948459.1|3221423_3221900_+	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_001169151.1|3222353_3222509_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|3222505_3222994_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560225.1|3223435_3223657_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001352098.1|3223656_3223827_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|3223901_3224177_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_000105143.1|3224278_3226879_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000166319.1|3226871_3227681_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001317028.1|3227737_3227932_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000276809.1|3227924_3228134_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_000079604.1|3228212_3228428_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040852.1|3228429_3229665_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_001157406.1|3229716_3230652_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123737.1|3230780_3232154_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|3232631_3233615_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628058.1|3233869_3235102_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
3244425:3244443	attR	AGGGAAGGTGCGAATAAGC	NA	NA	NA	NA
>prophage 6
NZ_CP012868	Escherichia coli str. K-12 substr. MG1655 strain K-12 chromosome, complete genome	4641665	3427605	3441986	4641665	tail,integrase,plate,portal	Escherichia_phage(26.32%)	25	3424981:3424994	3443012:3443025
3424981:3424994	attL	AAAATAAGATGAAT	NA	NA	NA	NA
WP_000332303.1|3427605_3428337_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
WP_000373101.1|3428557_3428962_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_032082692.1|3429014_3429125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295666.1|3429661_3429985_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_000943927.1|3430087_3430252_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	4.2e-23
WP_000557907.1|3430485_3431319_-	5-methylcytosine-specific endonuclease McrA	NA	NA	NA	NA	NA
WP_000905001.1|3431425_3431980_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.3	2.8e-87
WP_024184299.1|3432051_3432546_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	57.0	3.7e-46
WP_000548498.1|3432545_3433148_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	83.5	9.2e-92
WP_010723096.1|3433119_3433533_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	53.6	7.1e-27
WP_000554703.1|3433534_3434164_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	95.4	1.1e-52
WP_000383574.1|3434167_3434752_-	YmfQ family protein	NA	O22003	Shigella_phage	98.5	2.0e-112
WP_001350503.1|3434742_3435534_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	97.3	4.7e-144
WP_001350502.1|3435460_3435934_-|portal	phage portal protein	portal	A0A1B5FP95	Escherichia_phage	100.0	3.6e-75
WP_000605606.1|3435933_3436116_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_000104929.1|3436127_3437495_-	GntR family transcriptional regulator	NA	A0A1C9IIA1	Salmonella_phage	99.2	5.1e-223
WP_001250269.1|3437484_3437664_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515837.1|3437839_3438397_-	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	7.4e-96
WP_000649480.1|3438440_3438641_-	transcriptional regulator	NA	U5P445	Shigella_phage	98.5	1.9e-30
WP_000848748.1|3438731_3439406_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_001005353.1|3439580_3439889_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	3.8e-09
WP_010723095.1|3439826_3440168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011443584.1|3440284_3440596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000939945.1|3440632_3440878_+	excisionase-like protein from lambdoid prophage 14	NA	NA	NA	NA	NA
WP_000741310.1|3440858_3441986_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	61.5	7.2e-122
3443012:3443025	attR	AAAATAAGATGAAT	NA	NA	NA	NA
>prophage 7
NZ_CP012868	Escherichia coli str. K-12 substr. MG1655 strain K-12 chromosome, complete genome	4641665	4032487	4076850	4641665	protease,transposase,lysis,terminase,integrase	Enterobacteria_phage(56.0%)	49	4055562:4055608	4076864:4076910
WP_001300563.1|4032487_4033600_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000956455.1|4033676_4033829_-	type I toxin-antitoxin system toxin HokE	NA	NA	NA	NA	NA
WP_001130654.1|4034281_4035400_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_000682509.1|4035465_4035714_+	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_000360951.1|4035778_4036147_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000351487.1|4036240_4036894_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_001153148.1|4037001_4038249_+	mechanosensitive ion channel YbdG	NA	NA	NA	NA	NA
WP_000786319.1|4038329_4039706_-	phenylalanine transporter	NA	NA	NA	NA	NA
WP_000573945.1|4039807_4042951_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
WP_000717157.1|4042962_4044186_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_000709870.1|4044201_4044534_-	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000074234.1|4044691_4046065_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000770953.1|4046221_4046905_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_000253839.1|4046894_4048337_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.2	3.0e-11
WP_000383932.1|4048486_4050724_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000662357.1|4050710_4053683_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224604.1|4053683_4054574_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177471.1|4054756_4055518_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
4055562:4055608	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201845.1|4056031_4056985_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000386784.1|4057234_4057984_-	DNA-binding transcriptional activator AppY	NA	NA	NA	NA	NA
WP_026089880.1|4058886_4059513_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001027248.1|4059567_4060311_-|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
WP_000453566.1|4060285_4060831_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001421937.1|4061219_4061414_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_001031427.1|4061578_4061785_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079503.1|4062070_4062481_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_000738500.1|4062771_4063065_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_001228697.1|4063155_4063338_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_001135281.1|4063554_4064052_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_000839596.1|4064051_4064267_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737282.1|4064839_4065907_+	porin	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
WP_010723085.1|4065911_4066928_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001204791.1|4067325_4067709_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000971055.1|4067794_4067935_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099712.1|4067931_4068294_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774486.1|4068290_4068581_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_000224915.1|4068573_4068744_-	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001054340.1|4068743_4069199_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_001303586.1|4069195_4069297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881075.1|4069413_4070211_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001306955.1|4070220_4070772_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000709082.1|4071236_4072763_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001372443.1|4072820_4072970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070439.1|4073017_4073350_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000878218.1|4073660_4074527_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000169527.1|4074523_4074823_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000145909.1|4074885_4074981_-	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_000672150.1|4075303_4075567_+	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_001350488.1|4075686_4076850_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
4076864:4076910	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 8
NZ_CP012868	Escherichia coli str. K-12 substr. MG1655 strain K-12 chromosome, complete genome	4641665	4310168	4360836	4641665	holin,integrase,transposase	Acinetobacter_phage(33.33%)	46	4301596:4301612	4363924:4363940
4301596:4301612	attL	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
WP_000131044.1|4310168_4312202_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001335745.1|4312330_4312918_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089110.1|4312931_4314404_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159094.1|4314417_4316088_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001209100.1|4316300_4316969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370307.1|4317211_4317907_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023927.1|4317899_4319327_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102108.1|4319337_4320057_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339594.1|4320583_4321438_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001046307.1|4321663_4322989_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
WP_000474084.1|4323097_4323334_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|4323345_4323939_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000878218.1|4325211_4326078_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000169527.1|4326074_4326374_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000020224.1|4326420_4327308_-	inverse autotransporter beta domain-containing protein	NA	NA	NA	NA	NA
WP_000662258.1|4328422_4328524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|4328887_4329151_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|4329150_4329291_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147279.1|4329325_4329553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301257.1|4330376_4330919_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|4330993_4331581_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|4331638_4332307_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131096.1|4332332_4334858_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001310578.1|4334847_4336491_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001350485.1|4336459_4337170_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|4337482_4337812_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|4338059_4338674_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070700.1|4339091_4339781_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643333.1|4339777_4340734_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667026.1|4340730_4342929_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000121359.1|4342938_4343895_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111342.1|4343873_4344284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|4344568_4345969_+|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
WP_000224818.1|4346085_4346526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|4346522_4346747_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000072039.1|4346865_4347720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001214248.1|4347746_4348445_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000860996.1|4348716_4349343_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000388269.1|4349433_4350165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001281825.1|4351359_4352364_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_001121657.1|4352502_4353261_+	DNA-binding transcriptional repressor XynR	NA	NA	NA	NA	NA
WP_000406871.1|4353265_4354876_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_000192863.1|4354887_4356270_-	MFS transporter	NA	NA	NA	NA	NA
WP_000151261.1|4356496_4358464_-	xylonate dehydratase YagF	NA	NA	NA	NA	NA
WP_001136613.1|4358478_4359387_-	2-keto-3-deoxygluconate aldolase	NA	NA	NA	NA	NA
WP_010723086.1|4359681_4360836_+|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
4363924:4363940	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
