The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012869	Escherichia coli strain K-12 substr. MG1655_TMP32XR1 chromosome, complete genome	4641684	1777424	1784563	4641684		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1777424_1778063_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001393459.1|1778154_1779321_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_000848004.1|1779317_1780226_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001272547.1|1780391_1781189_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.0	1.3e-69
WP_001141337.1|1781239_1781896_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001272928.1|1782001_1784563_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 2
NZ_CP012869	Escherichia coli strain K-12 substr. MG1655_TMP32XR1 chromosome, complete genome	4641684	2165145	2176355	4641684	tail,integrase	Enterobacteria_phage(50.0%)	17	2161455:2161471	2178365:2178381
2161455:2161471	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_001163428.1|2165145_2165346_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_000206809.1|2165477_2165783_-	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001242717.1|2165782_2166145_-	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000008183.1|2166135_2166672_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_000081278.1|2166799_2167624_-	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000135673.1|2167689_2168052_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000128175.1|2168409_2168778_+	hypothetical protein	NA	U5P0A0	Shigella_phage	99.2	1.3e-69
WP_001393497.1|2168774_2169269_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000066913.1|2169268_2169544_+	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_011443597.1|2169593_2170112_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_001106835.1|2170138_2170579_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_047792215.1|2170877_2171159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001030215.1|2171193_2172525_-	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_000703651.1|2172521_2173442_-	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	89.9	4.2e-160
WP_000915541.1|2173438_2173801_-	GtrA family protein	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000958671.1|2173953_2175111_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000368140.1|2175422_2176355_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
2178365:2178381	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 3
NZ_CP012869	Escherichia coli strain K-12 substr. MG1655_TMP32XR1 chromosome, complete genome	4641684	2525757	2534428	4641684		Enterobacteria_phage(28.57%)	8	NA	NA
WP_001116026.1|2525757_2527152_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
WP_000183060.1|2527326_2528220_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_000699460.1|2528592_2529678_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	5.2e-101
WP_001023610.1|2529677_2530577_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	1.5e-29
WP_000783975.1|2530634_2531516_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	1.9e-106
WP_001100981.1|2531515_2532073_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.5	7.8e-53
WP_001393538.1|2532069_2533317_+	O16 family O-antigen flippase	NA	NA	NA	NA	NA
WP_000272486.1|2533324_2534428_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	59.5	1.0e-133
>prophage 4
NZ_CP012869	Escherichia coli strain K-12 substr. MG1655_TMP32XR1 chromosome, complete genome	4641684	2993008	3012219	4641684	tail,lysis	Enterobacteria_phage(40.91%)	35	NA	NA
WP_000379575.1|2993008_2993164_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000448564.1|2993330_2993738_-	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000920568.1|2993821_2994052_+	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_011443592.1|2994348_2994498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|2994934_2995267_-	protein FlxA	NA	NA	NA	NA	NA
WP_001326990.1|2995469_2995775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|2995799_2996039_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|2996038_2996326_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|2996397_2996553_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980994.1|2996769_2997021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304870.1|2997087_2997366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001393597.1|2997367_2998417_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	5.7e-113
WP_001047135.1|2998430_2999183_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_120795389.1|2999460_2999550_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|2999604_2999817_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|3000117_3000333_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|3001086_3001302_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189916.1|3001306_3001618_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|3001614_3002148_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|3002144_3002642_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_000066495.1|3003004_3003217_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|3003227_3003416_+	cold-shock protein	NA	NA	NA	NA	NA
WP_120795388.1|3003418_3003484_+	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_001309517.1|3003562_3003718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|3003889_3004063_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000373090.1|3004214_3004625_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001368374.1|3004682_3004916_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000453612.1|3005304_3005874_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001027733.1|3005824_3006787_+|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000885611.1|3006786_3007362_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000078177.1|3007459_3008050_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|3008366_3008600_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|3008668_3008782_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347482.1|3009386_3010670_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527743.1|3010758_3012219_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
>prophage 5
NZ_CP012869	Escherichia coli strain K-12 substr. MG1655_TMP32XR1 chromosome, complete genome	4641684	3171162	3235113	4641684	integrase,tRNA,tail,lysis,transposase	Escherichia_phage(38.71%)	59	3214061:3214079	3244436:3244454
WP_001254932.1|3171162_3172314_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_085947917.1|3172477_3173750_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_010723099.1|3176441_3176507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001123464.1|3176610_3177201_-	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_000039887.1|3177182_3178133_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_000632280.1|3178233_3179547_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_001206197.1|3179573_3180779_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000018413.1|3180778_3181201_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_000973360.1|3181190_3182618_-	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000969784.1|3182619_3183408_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_001292353.1|3183407_3184175_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000206388.1|3184171_3185242_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001189201.1|3185249_3185747_-	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_001072837.1|3185761_3186508_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_000073393.1|3186516_3186804_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_000191077.1|3186815_3187745_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_001186469.1|3188029_3190075_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000535469.1|3190322_3192596_+	primary-amine oxidase	NA	NA	NA	NA	NA
WP_000138615.1|3192653_3194153_-	phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001067514.1|3194388_3195294_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_001300734.1|3195465_3195792_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698145.1|3195799_3195985_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_000900941.1|3195981_3198621_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762236.1|3198828_3199818_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
WP_001298828.1|3199928_3200351_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|3200347_3200614_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_000628244.1|3200887_3204412_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837921.1|3204778_3205912_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
WP_001300461.1|3206052_3206487_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_120795384.1|3207265_3207379_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836770.1|3207447_3207681_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_000086527.1|3207997_3208588_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_001698950.1|3208685_3209261_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000279097.1|3209260_3212623_-|tail	side tail fiber protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
3214061:3214079	attL	GCTTATTCGCACCTTCCCT	NA	NA	NA	NA
WP_000091628.1|3215695_3216055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001350510.1|3216035_3216299_-	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_001097895.1|3216436_3217894_-	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001228696.1|3218090_3218276_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_000450663.1|3218363_3218924_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_000788970.1|3218946_3219693_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000899748.1|3219699_3220557_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000693797.1|3220569_3220992_-	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000712069.1|3221014_3221311_-	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000948459.1|3221434_3221911_+	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_001169151.1|3222364_3222520_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|3222516_3223005_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560225.1|3223446_3223668_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001352098.1|3223667_3223838_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|3223912_3224188_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_000105143.1|3224289_3226890_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000166319.1|3226882_3227692_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001317028.1|3227748_3227943_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000276809.1|3227935_3228145_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_000079604.1|3228223_3228439_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040852.1|3228440_3229676_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_001157406.1|3229727_3230663_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123737.1|3230791_3232165_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|3232642_3233626_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628058.1|3233880_3235113_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
3244436:3244454	attR	AGGGAAGGTGCGAATAAGC	NA	NA	NA	NA
>prophage 6
NZ_CP012869	Escherichia coli strain K-12 substr. MG1655_TMP32XR1 chromosome, complete genome	4641684	3427616	3441997	4641684	tail,portal,plate,integrase	Escherichia_phage(26.32%)	25	3424992:3425005	3443023:3443036
3424992:3425005	attL	AAAATAAGATGAAT	NA	NA	NA	NA
WP_000332303.1|3427616_3428348_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
WP_000373101.1|3428568_3428973_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_032082692.1|3429025_3429136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295666.1|3429672_3429996_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_000943927.1|3430098_3430263_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	4.2e-23
WP_000557907.1|3430496_3431330_-	5-methylcytosine-specific endonuclease McrA	NA	NA	NA	NA	NA
WP_000905001.1|3431436_3431991_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.3	2.8e-87
WP_024184299.1|3432062_3432557_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	57.0	3.7e-46
WP_000548498.1|3432556_3433159_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	83.5	9.2e-92
WP_010723096.1|3433130_3433544_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	53.6	7.1e-27
WP_000554703.1|3433545_3434175_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	95.4	1.1e-52
WP_000383574.1|3434178_3434763_-	YmfQ family protein	NA	O22003	Shigella_phage	98.5	2.0e-112
WP_001350503.1|3434753_3435545_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	97.3	4.7e-144
WP_001350502.1|3435471_3435945_-|portal	phage portal protein	portal	A0A1B5FP95	Escherichia_phage	100.0	3.6e-75
WP_000605606.1|3435944_3436127_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_000104929.1|3436138_3437506_-	GntR family transcriptional regulator	NA	A0A1C9IIA1	Salmonella_phage	99.2	5.1e-223
WP_001250269.1|3437495_3437675_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515837.1|3437850_3438408_-	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	7.4e-96
WP_000649480.1|3438451_3438652_-	transcriptional regulator	NA	U5P445	Shigella_phage	98.5	1.9e-30
WP_000848748.1|3438742_3439417_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_001005353.1|3439591_3439900_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	3.8e-09
WP_010723095.1|3439837_3440179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011443584.1|3440295_3440607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000939945.1|3440643_3440889_+	excisionase-like protein from lambdoid prophage 14	NA	NA	NA	NA	NA
WP_000741310.1|3440869_3441997_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	61.5	7.2e-122
3443023:3443036	attR	AAAATAAGATGAAT	NA	NA	NA	NA
>prophage 7
NZ_CP012869	Escherichia coli strain K-12 substr. MG1655_TMP32XR1 chromosome, complete genome	4641684	4032498	4076861	4641684	integrase,terminase,protease,lysis,transposase	Enterobacteria_phage(56.0%)	49	4055573:4055619	4076875:4076921
WP_001300563.1|4032498_4033611_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000956455.1|4033687_4033840_-	type I toxin-antitoxin system toxin HokE	NA	NA	NA	NA	NA
WP_001130654.1|4034292_4035411_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_000682509.1|4035476_4035725_+	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_000360951.1|4035789_4036158_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000351487.1|4036251_4036905_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_001153148.1|4037012_4038260_+	mechanosensitive ion channel YbdG	NA	NA	NA	NA	NA
WP_000786319.1|4038340_4039717_-	phenylalanine transporter	NA	NA	NA	NA	NA
WP_000573945.1|4039818_4042962_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
WP_000717157.1|4042973_4044197_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_000709870.1|4044212_4044545_-	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000074234.1|4044702_4046076_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000770953.1|4046232_4046916_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_000253839.1|4046905_4048348_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.2	3.0e-11
WP_000383932.1|4048497_4050735_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000662357.1|4050721_4053694_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224604.1|4053694_4054585_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177471.1|4054767_4055529_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
4055573:4055619	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201845.1|4056042_4056996_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000386784.1|4057245_4057995_-	DNA-binding transcriptional activator AppY	NA	NA	NA	NA	NA
WP_026089880.1|4058897_4059524_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001027248.1|4059578_4060322_-|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
WP_000453566.1|4060296_4060842_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001421937.1|4061230_4061425_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_001031427.1|4061589_4061796_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079503.1|4062081_4062492_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_000738500.1|4062782_4063076_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_001228697.1|4063166_4063349_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_001135281.1|4063565_4064063_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_000839596.1|4064062_4064278_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737282.1|4064850_4065918_+	porin	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
WP_010723085.1|4065922_4066939_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001204791.1|4067336_4067720_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000971055.1|4067805_4067946_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099712.1|4067942_4068305_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774486.1|4068301_4068592_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_000224915.1|4068584_4068755_-	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001054340.1|4068754_4069210_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_001303586.1|4069206_4069308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881075.1|4069424_4070222_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001306955.1|4070231_4070783_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000709082.1|4071247_4072774_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001372443.1|4072831_4072981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070439.1|4073028_4073361_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000878218.1|4073671_4074538_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000169527.1|4074534_4074834_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000145909.1|4074896_4074992_-	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_000672150.1|4075314_4075578_+	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_001350488.1|4075697_4076861_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
4076875:4076921	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 8
NZ_CP012869	Escherichia coli strain K-12 substr. MG1655_TMP32XR1 chromosome, complete genome	4641684	4310179	4360847	4641684	integrase,holin,transposase	Acinetobacter_phage(33.33%)	46	4301607:4301623	4363935:4363951
4301607:4301623	attL	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
WP_000131044.1|4310179_4312213_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001335745.1|4312341_4312929_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089110.1|4312942_4314415_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159094.1|4314428_4316099_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001209100.1|4316311_4316980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370307.1|4317222_4317918_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023927.1|4317910_4319338_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102108.1|4319348_4320068_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339594.1|4320594_4321449_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001046307.1|4321674_4323000_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
WP_000474084.1|4323108_4323345_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|4323356_4323950_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000878218.1|4325222_4326089_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000169527.1|4326085_4326385_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000020224.1|4326431_4327319_-	inverse autotransporter beta domain-containing protein	NA	NA	NA	NA	NA
WP_000662258.1|4328433_4328535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|4328898_4329162_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|4329161_4329302_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147279.1|4329336_4329564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301257.1|4330387_4330930_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|4331004_4331592_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|4331649_4332318_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131096.1|4332343_4334869_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001310578.1|4334858_4336502_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001350485.1|4336470_4337181_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|4337493_4337823_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|4338070_4338685_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070700.1|4339102_4339792_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643333.1|4339788_4340745_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667026.1|4340741_4342940_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000121359.1|4342949_4343906_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111342.1|4343884_4344295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|4344579_4345980_+|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
WP_000224818.1|4346096_4346537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|4346533_4346758_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000072039.1|4346876_4347731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001214248.1|4347757_4348456_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000860996.1|4348727_4349354_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000388269.1|4349444_4350176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001281825.1|4351370_4352375_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_001121657.1|4352513_4353272_+	DNA-binding transcriptional repressor XynR	NA	NA	NA	NA	NA
WP_000406871.1|4353276_4354887_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_000192863.1|4354898_4356281_-	MFS transporter	NA	NA	NA	NA	NA
WP_000151261.1|4356507_4358475_-	xylonate dehydratase YagF	NA	NA	NA	NA	NA
WP_001136613.1|4358489_4359398_-	2-keto-3-deoxygluconate aldolase	NA	NA	NA	NA	NA
WP_010723086.1|4359692_4360847_+|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
4363935:4363951	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
