The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012381	Lactobacillus helveticus strain CAUH18 chromosome, complete genome	2160583	10523	50592	2160583	integrase,transposase	Organic_Lake_phycodnavirus(20.0%)	33	25162:25186	49262:49286
WP_054607108.1|10523_11702_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_054607109.1|11784_13071_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.5	1.7e-10
WP_023062009.1|13339_13513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041809274.1|13750_15343_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	31.7	3.2e-14
WP_041809275.1|16928_17825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211200.1|18258_18867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014562768.1|19005_21027_+	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_014562769.1|21038_21494_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_014562770.1|21524_22919_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	50.6	1.7e-120
WP_014562771.1|23155_24085_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_054607110.1|24175_25105_+	DegV family protein	NA	NA	NA	NA	NA
25162:25186	attL	TTTATTGATTAATTGCCGGAGAAAA	NA	NA	NA	NA
WP_014917994.1|25196_26075_+	ROK family protein	NA	NA	NA	NA	NA
WP_023061349.1|26187_27045_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054607113.1|28417_29824_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_003624867.1|29974_30145_+	CsbD family protein	NA	NA	NA	NA	NA
WP_003631749.1|30195_30456_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_023061695.1|30517_31747_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_054607114.1|31830_32535_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	44.4	1.6e-18
WP_054607115.1|33037_35125_+	hypothetical protein	NA	A0A2K5B2C1	Erysipelothrix_phage	28.1	1.1e-27
WP_054607116.1|35127_37893_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_054607117.1|38186_39365_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_081008658.1|39449_39869_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_081008659.1|40018_40366_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	44.8	4.3e-17
WP_054607118.1|40515_41922_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_023061345.1|42138_42312_+	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_054607119.1|42493_43771_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.7	6.2e-13
WP_054607663.1|43903_45136_+|integrase	phage integrase SAM-like domain-containing protein	integrase	NA	NA	NA	NA
WP_014562791.1|45549_46836_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	51.3	1.3e-106
WP_014562792.1|47094_47448_-	DUF3278 domain-containing protein	NA	NA	NA	NA	NA
WP_003624837.1|47444_47645_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023061756.1|47812_48451_+	ATP-binding cassette domain-containing protein	NA	F2Y302	Organic_Lake_phycodnavirus	31.8	7.6e-20
WP_014562795.1|48447_49206_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_081008660.1|49362_50592_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	58.7	6.2e-127
49262:49286	attR	TTTATTGATTAATTGCCGGAGAAAA	NA	NA	NA	NA
>prophage 3
NZ_CP012381	Lactobacillus helveticus strain CAUH18 chromosome, complete genome	2160583	572646	581415	2160583		Prochlorococcus_phage(33.33%)	9	NA	NA
WP_054607248.1|572646_573132_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	46.4	2.1e-22
WP_054607249.1|573097_574273_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_054607250.1|574478_575195_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	38.3	3.7e-39
WP_041809376.1|575195_575450_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_014563199.1|575446_576118_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_054607251.1|576114_578343_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.9	3.5e-144
WP_035515999.1|578318_579785_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.2	4.1e-61
WP_041809380.1|579771_580809_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	41.5	5.0e-61
WP_014563203.1|580818_581415_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	35.7	3.3e-25
>prophage 4
NZ_CP012381	Lactobacillus helveticus strain CAUH18 chromosome, complete genome	2160583	586361	651527	2160583	bacteriocin,integrase,transposase,protease,tRNA	Bacillus_phage(33.33%)	55	584634:584693	627061:627140
584634:584693	attL	GGCTCTTTGTCAAATCCTGTTGATAGAGAGTAAATGAATAGAATCAGGCAGTCATTAAAA	NA	NA	NA	NA
WP_054607252.1|586361_587621_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.8	1.4e-12
WP_014563206.1|587867_590402_+	CRISPR-associated helicase/endonuclease Cas3	NA	A0A2R2ZGW0	Clostridioides_phage	20.8	2.0e-10
WP_012212136.1|590416_591160_+	type I-C CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_012212135.1|591159_593133_+	type I-C CRISPR-associated protein Cas8c/Csd1	NA	NA	NA	NA	NA
WP_012212134.1|593135_593987_+	type I-C CRISPR-associated protein Cas7/Csd2	NA	NA	NA	NA	NA
WP_012212133.1|593989_594646_+	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
WP_014563207.1|594642_595674_+	type I-C CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_014563208.1|595683_595974_+	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_014918443.1|598698_601362_+	DNA polymerase I	NA	F8WQ35	Bacillus_phage	30.6	5.8e-61
WP_014563219.1|601370_602201_+	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	25.9	3.2e-18
WP_054607253.1|602197_602800_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_003627138.1|602802_603270_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_054607254.1|603272_604604_+	DnaD domain protein	NA	NA	NA	NA	NA
WP_023061996.1|604635_605544_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	28.1	9.2e-27
WP_023061995.1|605834_607769_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	33.1	1.8e-96
WP_014563224.1|607926_608448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023061994.1|608598_609129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014563226.1|609592_610843_+	DUF389 domain-containing protein	NA	NA	NA	NA	NA
WP_080553153.1|612818_613352_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	38.2	4.0e-14
WP_014563229.1|613373_613574_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_003627118.1|613617_613974_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_014563231.1|614118_614643_+	YqeG family HAD IIIA-type phosphatase	NA	NA	NA	NA	NA
WP_023061988.1|614635_615745_+	ribosome biogenesis GTPase YqeH	NA	NA	NA	NA	NA
WP_054607256.1|615755_616412_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_003627112.1|616392_616986_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK	NA	NA	NA	NA	NA
WP_003627111.1|617007_617355_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_014563235.1|617360_618512_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_023061985.1|618513_619068_+	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_003627105.1|619230_619947_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.1	1.8e-25
WP_023061984.1|619933_621493_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_014563240.1|624046_625108_+|bacteriocin	class III bacteriocin	bacteriocin	NA	NA	NA	NA
WP_054607257.1|625127_626492_+	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_014563242.1|626585_626963_+|integrase	tyrosine-type recombinase/integrase	integrase	H0USV4	Bacillus_phage	42.2	2.9e-11
WP_054607258.1|627103_628381_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.7	2.2e-10
627061:627140	attR	GGCTCTTTGTCAAATCCTGTTGATAGAGAGTAAATGAATAGAATCAGGCAGTCATTAAAAGGCTGTTTGGCTCTTTTTCT	NA	NA	NA	NA
WP_014563245.1|628557_629046_-|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
WP_041809393.1|629095_630058_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_014563247.1|630104_630377_-	acylphosphatase	NA	NA	NA	NA	NA
WP_014563248.1|630474_631242_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_014918464.1|631353_631704_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014563250.1|631988_633038_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.3	1.2e-33
WP_054607259.1|633041_635456_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_014563252.1|635532_636009_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_014563253.1|636071_636986_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_041809883.1|637509_637782_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023061714.1|637894_638818_-	ATPase	NA	NA	NA	NA	NA
WP_054607260.1|638925_641520_-	YfhO family protein	NA	NA	NA	NA	NA
WP_054607261.1|641610_643719_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_003548272.1|643795_643945_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_054607262.1|643993_644554_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_023061715.1|644574_645255_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_003627075.1|645255_645483_+	YqgQ family protein	NA	NA	NA	NA	NA
WP_012212102.1|645541_645943_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_014563261.1|646021_646942_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_014563263.1|648311_649649_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_054607263.1|649811_651527_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.9	3.6e-88
>prophage 5
NZ_CP012381	Lactobacillus helveticus strain CAUH18 chromosome, complete genome	2160583	839194	847645	2160583		uncultured_virus(16.67%)	8	NA	NA
WP_041809461.1|839194_839854_+	uracil-DNA glycosylase	NA	A0A218MKQ4	uncultured_virus	30.9	2.2e-09
WP_014563411.1|839846_840632_+	SGNH/GDSL hydrolase family protein	NA	Q6SEC0	Lactobacillus_prophage	23.6	5.9e-06
WP_014563412.1|840660_841287_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	53.6	8.9e-13
WP_041809906.1|841452_841701_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_012212011.1|841763_841982_+	YneF family protein	NA	NA	NA	NA	NA
WP_014563414.1|842063_843821_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	26.8	1.5e-46
WP_023062044.1|843813_845607_+	ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	24.5	6.3e-19
WP_023062046.1|845701_847645_+	M13 family metallopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	28.2	2.5e-58
>prophage 6
NZ_CP012381	Lactobacillus helveticus strain CAUH18 chromosome, complete genome	2160583	1004009	1061747	2160583	integrase,transposase	Paenibacillus_phage(22.22%)	54	1004137:1004152	1031342:1031357
WP_081008676.1|1004009_1004414_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5SFL0	Streptococcus_phage	44.9	1.8e-11
1004137:1004152	attL	TGTTCATAAACTTTAA	NA	NA	NA	NA
WP_012211358.1|1004481_1005660_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_081008677.1|1005776_1006010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023061119.1|1006125_1006764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157749086.1|1007686_1008298_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0C5AEA5	Paenibacillus_phage	40.7	7.5e-25
WP_080668568.1|1008329_1008662_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_023061115.1|1008688_1009393_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	40.0	1.0e-33
WP_023061114.1|1009538_1010399_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014563536.1|1010410_1011151_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.2	1.0e-31
WP_014918745.1|1011160_1011835_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003615004.1|1011815_1012475_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_013854742.1|1012840_1013248_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023061113.1|1013257_1013440_+	DUF2255 family protein	NA	NA	NA	NA	NA
WP_081008716.1|1013455_1013626_+	DUF2255 family protein	NA	NA	NA	NA	NA
WP_014563539.1|1014212_1014818_+	sugar O-acetyltransferase	NA	A0A1V0SJ47	Klosneuvirus	35.2	2.0e-06
WP_014563540.1|1014830_1015736_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_014563541.1|1015913_1016060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054607348.1|1016114_1016975_-	Abi family protein	NA	NA	NA	NA	NA
WP_014563543.1|1016983_1017541_-	RNA 2'-phosphotransferase	NA	A0A0A8WJJ2	Clostridium_phage	40.9	5.3e-33
WP_014563544.1|1017543_1018437_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_014918752.1|1018553_1018784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054607349.1|1018881_1020144_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	38.8	1.1e-70
WP_014563547.1|1020143_1021007_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	24.8	2.4e-16
WP_023061107.1|1021018_1021471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041808708.1|1021457_1021673_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003626351.1|1021796_1022450_+	endonuclease III	NA	NA	NA	NA	NA
WP_014563551.1|1022515_1022791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211907.1|1022968_1023406_+	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041809496.1|1023407_1023821_+	DUF3021 domain-containing protein	NA	NA	NA	NA	NA
WP_014563553.1|1023856_1024354_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014563554.1|1025838_1026051_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_054607350.1|1026086_1028825_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_099046779.1|1028941_1029952_-	serine hydrolase	NA	NA	NA	NA	NA
WP_014563557.1|1030158_1031562_+	dipeptidase PepV	NA	NA	NA	NA	NA
1031342:1031357	attR	TTAAAGTTTATGAACA	NA	NA	NA	NA
WP_014563560.1|1034599_1035034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014563563.1|1037203_1038013_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054607352.1|1038924_1040298_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_054607353.1|1040680_1041016_-	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_003626373.1|1042042_1042282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041809504.1|1042393_1042945_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_054607354.1|1043079_1043310_-	replication initiator protein A	NA	NA	NA	NA	NA
WP_014563569.1|1043459_1043999_-	hypoxanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_041809507.1|1044288_1045824_+	YfcC family protein	NA	NA	NA	NA	NA
WP_014563571.1|1045887_1047354_-	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_054607671.1|1048784_1050032_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_054607355.1|1050073_1051465_-	amino acid permease	NA	NA	NA	NA	NA
WP_054607672.1|1051476_1052397_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_054607356.1|1052740_1053928_-	amidohydrolase	NA	NA	NA	NA	NA
WP_099046781.1|1053959_1055291_-	amino acid permease	NA	NA	NA	NA	NA
WP_023191317.1|1055565_1055931_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_054607358.1|1056124_1058071_+	M13 family metallopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	28.6	8.8e-59
WP_023061554.1|1058296_1060774_+	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_157749106.1|1060986_1061313_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_157749087.1|1061363_1061747_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP012381	Lactobacillus helveticus strain CAUH18 chromosome, complete genome	2160583	1138127	1203157	2160583	protease,integrase,tRNA,transposase	Aureococcus_anophage(11.11%)	57	1153232:1153248	1183013:1183029
WP_014563640.1|1138127_1138739_-|integrase	tyrosine-type recombinase/integrase	integrase	E2ELN7	Clostridium_phage	34.8	1.2e-17
WP_054607381.1|1139024_1140407_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.7	2.0e-57
WP_014563643.1|1140472_1140751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054607382.1|1140911_1141403_-	DUF5067 domain-containing protein	NA	NA	NA	NA	NA
WP_014563645.1|1141512_1141872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003626474.1|1142262_1142886_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_054607383.1|1142888_1143650_-	nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_054607384.1|1144248_1144674_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_054607385.1|1144761_1145202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054607386.1|1145377_1146568_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	58.7	1.5e-125
WP_012211857.1|1146676_1147387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003626488.1|1147475_1148657_+	MFS transporter	NA	NA	NA	NA	NA
WP_014563663.1|1148722_1149304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211856.1|1149393_1150011_-	Fic family protein	NA	NA	NA	NA	NA
WP_014563664.1|1150273_1150819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023191942.1|1150731_1151235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211854.1|1151407_1151785_-	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_003628493.1|1151797_1152538_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_012211853.1|1152544_1154128_-	ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	26.5	1.1e-19
1153232:1153248	attL	ATTATTCATCAAATTAT	NA	NA	NA	NA
WP_012211852.1|1154117_1155722_-	ATP-binding cassette domain-containing protein	NA	A0A076FI99	Aureococcus_anophage	21.6	1.7e-15
WP_014563668.1|1155894_1156245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023060950.1|1156787_1157000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020829158.1|1157005_1158292_-	peptidase T	NA	NA	NA	NA	NA
WP_054607387.1|1158450_1159785_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_014563671.1|1159833_1161039_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_014563672.1|1161120_1161678_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_054607674.1|1161677_1162505_-	pyridoxamine kinase	NA	NA	NA	NA	NA
WP_054607388.1|1162571_1163669_-	serine hydrolase	NA	NA	NA	NA	NA
WP_014563675.1|1163793_1164408_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_054607389.1|1164508_1165141_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_014563677.1|1165369_1165819_-	Trp operon repressor	NA	NA	NA	NA	NA
WP_023060825.1|1165927_1167700_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	38.4	1.1e-76
WP_054607390.1|1167809_1169159_+	ATP synthase subunit J	NA	NA	NA	NA	NA
WP_012211842.1|1169816_1171076_-	methionine gamma-lyase family protein	NA	NA	NA	NA	NA
WP_054607391.1|1171092_1173189_-	putative ornithine decarboxylase	NA	NA	NA	NA	NA
WP_099046782.1|1175840_1176173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003628346.1|1177863_1178241_-	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_041809534.1|1178242_1178626_-	CrcB family protein	NA	A0A2H4PQR0	Staphylococcus_phage	38.3	2.4e-08
WP_012211833.1|1180306_1181122_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_014563689.1|1182472_1183372_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
1183013:1183029	attR	ATTATTCATCAAATTAT	NA	NA	NA	NA
WP_014563690.1|1183524_1184928_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IB03	Erwinia_phage	25.1	2.6e-28
WP_003628338.1|1184938_1185463_-	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
WP_014563691.1|1185471_1186380_-	tyrosine recombinase	NA	A0A1P8DJJ6	Virus_Rctr41k	25.1	2.3e-14
WP_054607392.1|1186379_1187696_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_023061818.1|1187717_1189832_-	type I DNA topoisomerase	NA	E3T4K4	Cafeteria_roenbergensis_virus	37.2	6.7e-97
WP_003628334.1|1189903_1190752_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	36.8	4.9e-30
WP_012211825.1|1190812_1191565_-	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	38.6	1.3e-26
WP_014563695.1|1191554_1192406_-	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_054607393.1|1192429_1194022_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_003626511.1|1194069_1194300_-	YozE family protein	NA	NA	NA	NA	NA
WP_041809948.1|1194302_1195133_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	45.9	5.3e-21
WP_003628329.1|1195249_1195942_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_054607394.1|1196119_1197379_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.2	6.8e-12
WP_081008683.1|1197616_1198846_+|transposase	IS110-like element ISLhe4 family transposase	transposase	A0A1X9I619	Streptococcus_phage	39.1	1.5e-67
WP_012211821.1|1199115_1200315_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	34.1	8.6e-49
WP_054607396.1|1200406_1201294_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	36.1	1.2e-50
WP_054607397.1|1201441_1203157_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.7	2.3e-87
>prophage 8
NZ_CP012381	Lactobacillus helveticus strain CAUH18 chromosome, complete genome	2160583	1229775	1305774	2160583	tRNA,transposase	Lactobacillus_phage(15.79%)	60	NA	NA
WP_054607402.1|1229775_1230825_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.7	1.7e-48
WP_014563724.1|1231618_1233004_+	amino acid permease	NA	NA	NA	NA	NA
WP_042753906.1|1235960_1237154_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.2	3.9e-41
WP_014563727.1|1237585_1238770_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_054607403.1|1238858_1240712_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	24.1	8.5e-11
WP_023060781.1|1240717_1242004_-|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L6G5	Tupanvirus	25.3	1.8e-20
WP_014563730.1|1242328_1242766_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_054607404.1|1242765_1245006_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	38.0	1.7e-10
WP_020829139.1|1245020_1245383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014563732.1|1245438_1246386_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_054607405.1|1246446_1246956_+|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
WP_054607406.1|1247414_1248593_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_054607407.1|1249040_1250423_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.3	3.4e-57
WP_003628193.1|1250463_1250970_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_014563737.1|1251072_1252419_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_014563738.1|1252588_1253542_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_014563739.1|1253543_1253939_+	hypothetical protein	NA	A0A0P0I7G8	Lactobacillus_phage	45.1	1.5e-18
WP_012211781.1|1254130_1254511_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_054607408.1|1254642_1255200_+	ECF-type riboflavin transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_054607409.1|1255212_1256922_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.6	6.0e-19
WP_041809549.1|1256914_1257748_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_023061841.1|1257769_1257928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025005797.1|1257958_1258414_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_054607410.1|1258659_1259175_-	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_014563748.1|1259203_1259542_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_054607411.1|1260949_1262509_-	citrate lyase subunit alpha	NA	NA	NA	NA	NA
WP_054607412.1|1262480_1263395_-	citrate (pro-3S)-lyase subunit beta	NA	NA	NA	NA	NA
WP_003628158.1|1263395_1263689_-	citrate lyase acyl carrier protein	NA	NA	NA	NA	NA
WP_054607413.1|1263678_1264731_-	[citrate (pro-3S)-lyase] ligase	NA	NA	NA	NA	NA
WP_054607414.1|1264821_1265613_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_023061849.1|1265691_1267158_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_003626619.1|1267477_1268791_-	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	32.3	8.5e-58
WP_023061851.1|1269390_1269918_-	surface protein	NA	NA	NA	NA	NA
WP_081008686.1|1270078_1272046_-	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_054607416.1|1272497_1273424_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_054607417.1|1274023_1274857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041809553.1|1274843_1275380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014563760.1|1275675_1277052_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	32.3	1.3e-56
WP_012211762.1|1277063_1278467_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_003626652.1|1278654_1278879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041809555.1|1278970_1280194_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_054607418.1|1280343_1281045_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_054607419.1|1281037_1282099_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	3.6e-30
WP_054607420.1|1282111_1282972_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_054607421.1|1283322_1285740_-	HAD-IC family P-type ATPase	NA	E4ZFI9	Streptococcus_phage	20.2	1.2e-17
WP_041809559.1|1286357_1286876_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	39.5	2.2e-25
WP_014563767.1|1286890_1287847_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	60.5	4.7e-114
WP_079227905.1|1289792_1289864_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_014563769.1|1289885_1290347_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0K2CYJ8	Paenibacillus_phage	37.2	1.0e-10
WP_054607422.1|1290719_1291898_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_003626680.1|1293047_1293623_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_042753891.1|1293670_1294504_-	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	40.2	1.3e-48
WP_014563773.1|1294726_1296013_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	51.4	4.4e-107
WP_014563774.1|1296088_1296691_-	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_012211749.1|1296843_1297332_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_014563776.1|1298494_1299877_+	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_054607423.1|1299876_1300815_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_054607424.1|1300974_1302216_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	57.2	4.8e-119
WP_012211746.1|1302970_1303693_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054607425.1|1304391_1305774_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.7	2.0e-57
>prophage 9
NZ_CP012381	Lactobacillus helveticus strain CAUH18 chromosome, complete genome	2160583	1424640	1495912	2160583	tRNA,transposase	Streptococcus_phage(28.57%)	60	NA	NA
WP_054607470.1|1424640_1425819_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_054607471.1|1427437_1428697_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.4	4.4e-11
WP_014563885.1|1430506_1431847_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_003626132.1|1431922_1432537_-	VanZ family protein	NA	NA	NA	NA	NA
WP_054607472.1|1432661_1434851_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	43.8	1.2e-152
WP_014563888.1|1434900_1436358_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	33.8	3.6e-33
WP_014563889.1|1436357_1437080_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.3	9.2e-38
WP_014563890.1|1437079_1437472_-	SdpI family protein	NA	NA	NA	NA	NA
WP_054607473.1|1437506_1438472_-	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_041809593.1|1438564_1439722_-	putative C-S lyase	NA	NA	NA	NA	NA
WP_023060959.1|1441114_1442299_-	acetate kinase	NA	NA	NA	NA	NA
WP_023060958.1|1442345_1443347_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_023060957.1|1443516_1444017_-	ComGF family competence protein	NA	NA	NA	NA	NA
WP_003626116.1|1444024_1444294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003626115.1|1444290_1444722_-	type II secretion system protein	NA	NA	NA	NA	NA
WP_003626112.1|1444690_1445041_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_041809968.1|1445052_1446054_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_041809595.1|1446022_1446997_-	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_003626106.1|1447144_1447873_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003626104.1|1447963_1448479_-	VanZ family protein	NA	NA	NA	NA	NA
WP_003626102.1|1448573_1448759_-	type Z 30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_157749090.1|1448857_1450087_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	58.5	2.0e-125
WP_023060885.1|1450186_1451785_+	APC family permease	NA	NA	NA	NA	NA
WP_023061646.1|1451833_1452790_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_054607475.1|1456625_1457459_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_012211646.1|1457674_1458829_+	glycerate kinase	NA	NA	NA	NA	NA
WP_054607476.1|1458833_1459301_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_023061651.1|1459304_1459982_-	Conserved protein	NA	NA	NA	NA	NA
WP_012211358.1|1460119_1461298_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_014563907.1|1461414_1462230_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_023061652.1|1462239_1463055_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_054607477.1|1463149_1464502_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_054607478.1|1464532_1465492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003633493.1|1465488_1466331_-	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_003626069.1|1466388_1467462_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003626068.1|1467458_1468274_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_023061656.1|1468270_1469083_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_023061657.1|1469072_1470170_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	40.7	1.6e-33
WP_012211637.1|1470235_1471132_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_012211636.1|1471229_1471763_+	exonuclease	NA	M1PFD8	Streptococcus_phage	36.6	6.8e-22
WP_003626063.1|1471769_1472270_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_003633483.1|1472269_1473259_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_003626058.1|1473270_1473969_-	uracil-DNA glycosylase	NA	A0A0B5IW78	Pandoravirus	42.6	7.8e-42
WP_014563920.1|1474037_1474919_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_012211631.1|1474925_1475447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023061659.1|1475776_1476535_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_003633479.1|1476560_1477772_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_014563923.1|1477884_1478901_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_014563924.1|1478956_1479988_-	central glycolytic genes regulator	NA	NA	NA	NA	NA
WP_054607479.1|1481986_1483420_+	amino acid permease	NA	NA	NA	NA	NA
WP_157749091.1|1483452_1484313_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_014563927.1|1484381_1486007_-	SH3-like domain-containing protein	NA	NA	NA	NA	NA
WP_054607480.1|1486128_1487307_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_005718663.1|1487573_1488158_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	54.4	1.1e-52
WP_054607481.1|1488241_1489477_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	47.7	7.5e-56
WP_012211624.1|1489517_1490453_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	35.2	1.4e-46
WP_023061825.1|1490445_1491489_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	50.5	4.8e-88
WP_023061826.1|1491499_1492375_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.3	4.1e-08
WP_054607482.1|1492464_1493007_-	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_023061828.1|1493071_1495912_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.9	7.2e-304
>prophage 10
NZ_CP012381	Lactobacillus helveticus strain CAUH18 chromosome, complete genome	2160583	1510025	1569144	2160583	protease,tRNA,transposase	Streptococcus_phage(28.57%)	54	NA	NA
WP_054607484.1|1510025_1511285_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.3	6.4e-10
WP_013854585.1|1511522_1512752_+|transposase	IS110-like element ISLhe4 family transposase	transposase	A0A1X9I619	Streptococcus_phage	38.4	1.8e-65
WP_054607485.1|1513087_1514353_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.9	6.4e-10
WP_003626023.1|1514421_1515441_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_042753872.1|1515518_1516322_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_014563939.1|1516314_1517283_-	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_014563940.1|1517299_1517578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155244806.1|1517585_1518702_-	peptide chain release factor 2	NA	B5LLF2	Mycobacterium_phage	35.2	9.3e-05
WP_014563942.1|1518769_1521169_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_023060691.1|1521308_1521854_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_054607486.1|1521935_1522631_-	ComF family protein	NA	NA	NA	NA	NA
WP_054607487.1|1522627_1523914_-	DEAD/DEAH box helicase family protein	NA	A0A1X9I5S6	Streptococcus_phage	43.8	1.7e-82
WP_014563946.1|1523958_1524621_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	43.8	4.5e-39
WP_014563947.1|1524647_1525805_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_054607488.1|1525911_1527543_-	ribonuclease Y	NA	NA	NA	NA	NA
WP_014563949.1|1527661_1528759_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	62.4	2.5e-119
WP_012211604.1|1528942_1529503_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_054607489.1|1529525_1530644_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023060697.1|1530711_1531440_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_054607490.1|1531440_1532697_-	insulinase family protein	NA	A0A2P1EIE5	Megavirus	27.5	2.3e-12
WP_042753875.1|1532693_1533908_-	insulinase family protein	NA	NA	NA	NA	NA
WP_014563954.1|1533894_1536312_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	45.2	3.7e-83
WP_003625992.1|1536332_1536722_-	DUF1149 family protein	NA	NA	NA	NA	NA
WP_014563955.1|1536721_1537282_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_003625987.1|1537333_1538533_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_023060700.1|1538549_1538930_-	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_054607491.1|1539000_1541757_-	cation-transporting P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	30.1	5.0e-76
WP_023060702.1|1541909_1542938_+	lactonase family protein	NA	NA	NA	NA	NA
WP_014563960.1|1543772_1545548_-	oleate hydratase	NA	NA	NA	NA	NA
WP_023060705.1|1545666_1546563_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	30.1	2.3e-06
WP_012211595.1|1546546_1547359_-	NAD kinase	NA	NA	NA	NA	NA
WP_014563962.1|1547355_1547988_-	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_023060706.1|1548111_1548726_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_014563964.1|1548804_1549422_+	DsbA family protein	NA	NA	NA	NA	NA
WP_041809629.1|1549430_1550279_-	competence protein	NA	NA	NA	NA	NA
WP_014563966.1|1550356_1551097_-	adaptor protein MecA	NA	NA	NA	NA	NA
WP_012211591.1|1551188_1551587_-	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_014563967.1|1551819_1553553_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_005718606.1|1553552_1553819_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_014563968.1|1553932_1554127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014563969.1|1554304_1556494_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A1C3S747	Escherichia_phage	40.3	3.3e-123
WP_014563970.1|1556596_1556878_+	DUF1827 family protein	NA	NA	NA	NA	NA
WP_003633365.1|1556945_1558517_-	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	26.0	7.1e-35
WP_014563971.1|1558516_1559389_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_003627789.1|1559494_1559956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003627790.1|1559957_1560440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023061807.1|1560449_1561262_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_014563973.1|1561384_1562767_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	33.6	1.0e-69
WP_023061349.1|1563283_1564141_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_081008690.1|1564137_1564797_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_023061809.1|1565052_1565562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054607493.1|1565922_1566915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023061810.1|1567042_1567219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054607494.1|1567965_1569144_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP012381	Lactobacillus helveticus strain CAUH18 chromosome, complete genome	2160583	1604538	1666154	2160583	bacteriocin,transposase	Bacillus_phage(15.38%)	50	NA	NA
WP_014564003.1|1604538_1604904_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_014564004.1|1604990_1605314_-	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_014564005.1|1605313_1606717_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_014564006.1|1606709_1607171_-	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_012211560.1|1607157_1608396_-	SufS family cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.8	4.7e-98
WP_014564007.1|1608370_1609648_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_054607504.1|1609659_1610454_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	27.7	7.3e-12
WP_081008692.1|1610523_1611357_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_014564010.1|1611566_1612385_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_054607506.1|1613450_1614008_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014564013.1|1614082_1614808_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012211554.1|1614807_1615734_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_014564014.1|1615851_1617867_-	KUP/HAK/KT family potassium transporter	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	36.2	1.0e-65
WP_014564015.1|1617927_1618620_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_023061243.1|1618619_1619546_-	ribokinase	NA	A0A2H4N7X4	Lake_Baikal_phage	37.5	6.3e-07
WP_023061244.1|1619629_1620433_-	DUF4931 domain-containing protein	NA	NA	NA	NA	NA
WP_014564018.1|1620586_1621888_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_014564020.1|1622263_1623247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054607507.1|1623261_1624293_-	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_054607508.1|1624322_1625117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054607509.1|1625255_1626173_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_014564024.1|1626248_1626902_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_014564025.1|1626916_1627558_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_014564026.1|1627557_1628376_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014564027.1|1628386_1629127_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.9	3.6e-37
WP_041809649.1|1631307_1631772_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	47.4	7.0e-31
WP_054607510.1|1634029_1634608_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_054607511.1|1634775_1636545_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.5	4.1e-55
WP_014564032.1|1636544_1638275_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.1	5.8e-30
WP_054607512.1|1638253_1638715_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014564034.1|1638856_1639675_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012211534.1|1639717_1640386_-	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_080553195.1|1640398_1641070_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_054607513.1|1641345_1642968_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	27.6	7.1e-54
WP_054607514.1|1643071_1644154_-	M42 family peptidase	NA	NA	NA	NA	NA
WP_054607515.1|1645496_1646966_-	MFS transporter	NA	NA	NA	NA	NA
WP_023060907.1|1647256_1647787_+	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_023060908.1|1647799_1649128_+	NCS family uracil:cation symporter	NA	Q9KX94	Enterobacteria_phage	35.9	3.4e-62
WP_014564041.1|1649182_1650019_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	36.4	5.1e-48
WP_054607679.1|1652013_1652829_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_014564044.1|1652868_1653345_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013854589.1|1655809_1656322_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054607516.1|1656329_1657796_-	MFS transporter	NA	NA	NA	NA	NA
WP_003633097.1|1658291_1658792_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_054607517.1|1659466_1660873_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_054607518.1|1660997_1661381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014563294.1|1662609_1663788_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_148224876.1|1663848_1664193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014564049.1|1664527_1664728_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.4	6.3e-21
WP_014564050.1|1664822_1666154_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.9	9.3e-52
>prophage 12
NZ_CP012381	Lactobacillus helveticus strain CAUH18 chromosome, complete genome	2160583	1732377	1852921	2160583	transposase,protease,capsid,tRNA,holin	Lactobacillus_phage(18.18%)	95	NA	NA
WP_023061029.1|1732377_1732491_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_003626988.1|1732674_1732968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014564097.1|1733042_1734854_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q76DQ7	Chlorella_virus	37.4	1.6e-91
WP_054607533.1|1735048_1737673_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_023061031.1|1737985_1739359_+	amino acid permease	NA	NA	NA	NA	NA
WP_014564099.1|1739332_1739887_-	acetyltransferase	NA	NA	NA	NA	NA
WP_012211481.1|1740946_1741315_-	DUF956 family protein	NA	NA	NA	NA	NA
WP_014564102.1|1741318_1742239_-	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_003632508.1|1742267_1743080_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_054607534.1|1743098_1744109_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_054607535.1|1748330_1749584_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	26.1	9.1e-09
WP_014918044.1|1753811_1753997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054607536.1|1756123_1757431_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.1	8.1e-93
WP_014564108.1|1757654_1758206_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014564109.1|1758205_1758814_-	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	38.0	2.6e-33
WP_023060924.1|1758943_1759741_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_041810741.1|1759896_1760598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054607537.1|1760681_1762064_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_054607538.1|1762109_1763144_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_054607539.1|1763302_1766743_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_014564115.1|1766747_1767320_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014564116.1|1767455_1768406_-	serine hydrolase	NA	NA	NA	NA	NA
WP_023060927.1|1768418_1769336_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_054607540.1|1769474_1770776_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_014564119.1|1770826_1772122_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_014564120.1|1772105_1772930_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_054607541.1|1772933_1773800_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_054607542.1|1773799_1774885_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.3	1.1e-26
WP_014564123.1|1775138_1776566_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_054607543.1|1776606_1777461_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_054607544.1|1777551_1778505_-	ribonuclease H-like domain-containing protein	NA	A0A0K2SUJ2	Clostridium_phage	31.5	1.5e-11
WP_014564125.1|1778513_1779335_-	NAD-dependent protein deacetylase SIR2 family	NA	NA	NA	NA	NA
WP_042753976.1|1779604_1779802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041809686.1|1779785_1780136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023061699.1|1781141_1781432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167541415.1|1782597_1783248_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	50.5	3.9e-56
WP_003606447.1|1783532_1783781_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_054607546.1|1783910_1784627_-|capsid	minor capsid protein	capsid	NA	NA	NA	NA
WP_041809692.1|1786795_1787800_-	lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	32.1	4.5e-35
WP_014564135.1|1788520_1789363_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	99.3	3.0e-157
WP_003590074.1|1789548_1789668_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	92.3	1.3e-13
WP_054607549.1|1790712_1791990_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	2.1e-13
WP_054607550.1|1792080_1793358_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.6	8.4e-10
WP_023061546.1|1793418_1793925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014564139.1|1793914_1794196_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_080553177.1|1795285_1796308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023061541.1|1796614_1797628_-	Protein I/II V-region	NA	NA	NA	NA	NA
WP_081008698.1|1797602_1798664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023061539.1|1798857_1799598_-	nicotinamide mononucleotide transporter	NA	A0A0A7NTY4	Lactobacillus_phage	84.5	1.4e-121
WP_014564142.1|1799938_1800094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054607551.1|1800194_1801436_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	57.2	4.8e-119
WP_054607552.1|1802041_1803295_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	55.4	1.0e-113
WP_023061490.1|1803427_1805032_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.3	9.9e-16
WP_003627833.1|1805153_1806068_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_014564146.1|1806157_1807159_+	adenosine deaminase	NA	NA	NA	NA	NA
WP_054607553.1|1807206_1807710_+	nucleoside 2-deoxyribosyltransferase	NA	NA	NA	NA	NA
WP_081008699.1|1807821_1808466_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_054607555.1|1808504_1809023_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_054607556.1|1809022_1809478_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023061494.1|1809660_1809840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081008700.1|1809821_1810241_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_023061495.1|1810424_1811726_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_014564152.1|1811778_1812351_-	elongation factor P	NA	NA	NA	NA	NA
WP_041809704.1|1812385_1813300_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	33.2	4.7e-31
WP_014564154.1|1813358_1813919_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_023060978.1|1815463_1817770_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_023060979.1|1817919_1818606_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_054607558.1|1818666_1819317_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_157749095.1|1819409_1820639_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	57.9	1.9e-123
WP_157749096.1|1820843_1821041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211358.1|1821117_1822296_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_054607560.1|1823000_1824659_-	aspartate-alanine antiporter	NA	NA	NA	NA	NA
WP_081008702.1|1824676_1825840_-	bifunctional aspartate transaminase/aspartate 4-decarboxylase	NA	NA	NA	NA	NA
WP_023061875.1|1827057_1827408_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	52.6	1.6e-24
WP_003625154.1|1827826_1827967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003680323.1|1827978_1828230_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_014564163.1|1828244_1828787_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_014564164.1|1828814_1829000_-	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_014564165.1|1829011_1829572_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_054607562.1|1829791_1830265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054607563.1|1832681_1834481_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_054607564.1|1834493_1835243_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.4	5.8e-35
WP_014564169.1|1835389_1836661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014564170.1|1836749_1837421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003627805.1|1839586_1839724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014564173.1|1839814_1840819_-	asparaginase	NA	NA	NA	NA	NA
WP_054607567.1|1840830_1841604_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054607568.1|1841727_1843065_-	6-phospho-alpha-glucosidase	NA	NA	NA	NA	NA
WP_099046790.1|1843617_1844055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095662341.1|1844120_1844396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041809720.1|1844868_1845375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014564181.1|1845596_1846472_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	50.0	1.6e-76
WP_054607569.1|1846636_1848742_-	putative ornithine decarboxylase	NA	NA	NA	NA	NA
WP_012212233.1|1848966_1850418_+	APC family permease	NA	NA	NA	NA	NA
WP_054607570.1|1851643_1852921_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.2	5.3e-12
>prophage 13
NZ_CP012381	Lactobacillus helveticus strain CAUH18 chromosome, complete genome	2160583	1873772	1933567	2160583	bacteriocin,transposase	Streptococcus_phage(20.0%)	56	NA	NA
WP_013854585.1|1873772_1875002_+|transposase	IS110-like element ISLhe4 family transposase	transposase	A0A1X9I619	Streptococcus_phage	38.4	1.8e-65
WP_054607582.1|1875337_1876804_-	flippase	NA	NA	NA	NA	NA
WP_157749099.1|1876827_1877793_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_054607585.1|1880532_1881132_-	hypothetical protein	NA	A8ASQ2	Listeria_phage	34.8	8.5e-13
WP_054607586.1|1881135_1881645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157749100.1|1881754_1881928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054607587.1|1881901_1882105_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_054607588.1|1882147_1882657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054607589.1|1882741_1883026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054607590.1|1883034_1883460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054607591.1|1883654_1885076_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_054607681.1|1885152_1886079_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_054607592.1|1886304_1887348_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_054607593.1|1887351_1888467_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	73.1	7.8e-161
WP_054607594.1|1888459_1889803_-	oligosaccharide repeat unit polymerase	NA	NA	NA	NA	NA
WP_054607595.1|1889832_1890867_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_054607596.1|1890915_1892016_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_054607597.1|1892026_1893121_-	glycosyltransferase	NA	A0A1V0SL50	Klosneuvirus	23.6	2.7e-09
WP_054607682.1|1893145_1893922_-	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_080668584.1|1893943_1894603_-	sugar transferase	NA	NA	NA	NA	NA
WP_054607598.1|1894717_1895488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020828981.1|1895487_1896276_-	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_054607599.1|1896286_1897171_-	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_054607600.1|1897182_1898244_-	LCP family protein	NA	A0A1X9I5X1	Streptococcus_phage	31.1	2.5e-15
WP_054607601.1|1898721_1899987_+	GTPase HflX	NA	NA	NA	NA	NA
WP_157749101.1|1900876_1901680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054607603.1|1901817_1902750_-	C40 family peptidase	NA	M9MUG9	Rhodococcus_phage	36.9	2.0e-13
WP_054607604.1|1902902_1903679_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	46.8	4.6e-19
WP_041810003.1|1903851_1904235_-	ATPase	NA	NA	NA	NA	NA
WP_014564207.1|1904276_1904549_-	ATPase	NA	NA	NA	NA	NA
WP_054607605.1|1904640_1905192_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	43.5	2.8e-18
WP_041809733.1|1905381_1905927_-	AAA family ATPase	NA	A0A218KC48	Bacillus_phage	31.7	9.4e-11
WP_003627299.1|1906021_1906321_+	DUF2187 domain-containing protein	NA	NA	NA	NA	NA
WP_014564210.1|1906413_1907919_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_023061549.1|1907964_1908588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003627304.1|1908713_1909160_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_003627305.1|1909295_1909487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054607606.1|1909755_1910292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054607607.1|1910531_1911773_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	57.2	2.8e-119
WP_014564214.1|1912135_1912621_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_014564215.1|1912623_1913394_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_023061342.1|1913404_1914946_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2H4UUX5	Bodo_saltans_virus	28.2	2.8e-44
WP_014919445.1|1914954_1915332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054607608.1|1915465_1916023_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_054607609.1|1916019_1916715_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_014564219.1|1916783_1918025_-	LCP family protein	NA	NA	NA	NA	NA
WP_054607610.1|1918186_1919983_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_157749102.1|1920857_1922081_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	57.2	6.2e-119
WP_054607612.1|1922298_1922571_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_014564224.1|1924143_1925526_-	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_014564225.1|1925961_1926756_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_014564226.1|1926755_1927403_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.3	5.7e-15
WP_014564227.1|1927434_1928352_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003630183.1|1928638_1928911_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_054607613.1|1929140_1930418_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.1e-12
WP_081008670.1|1932307_1933567_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	58.7	1.6e-125
>prophage 14
NZ_CP012381	Lactobacillus helveticus strain CAUH18 chromosome, complete genome	2160583	1978067	2026492	2160583	transposase	Lactobacillus_virus(16.67%)	35	NA	NA
WP_054607621.1|1978067_1979258_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	55.9	1.5e-117
WP_052541595.1|1979429_1979792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052541596.1|1982393_1983971_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	33.7	5.1e-25
WP_080890103.1|1983986_1986275_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_054607622.1|1987248_1988763_-	ABC-F family ATP-binding cassette domain-containing protein	NA	Q6DMX7	Streptococcus_phage	23.2	7.9e-23
WP_012211358.1|1989393_1990572_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_054607623.1|1990742_1992446_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.9	3.5e-88
WP_014919512.1|1992447_1994616_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0D3MSW9	Lactococcus_phage	47.5	1.9e-171
WP_005726599.1|1994608_1995031_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	J9PTY0	Bacillus_phage	38.3	1.1e-11
WP_014919513.1|1995014_1996022_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A160DHK0	Gordonia_phage	53.7	3.5e-96
WP_003618609.1|1999757_2000231_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_054607624.1|2000384_2002670_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_014919517.1|2002647_2003580_+	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_054607625.1|2003631_2004822_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	56.4	1.9e-117
WP_054607626.1|2005029_2006064_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	1.5e-36
WP_014564290.1|2006279_2007356_+	guanine permease	NA	NA	NA	NA	NA
WP_014564291.1|2007358_2007916_+	adenine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_014919521.1|2009517_2010060_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_003630368.1|2010133_2011123_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_003630369.1|2011170_2011929_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_013855212.1|2011987_2012758_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_014564296.1|2012750_2013593_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_014919523.1|2013573_2014953_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_014919524.1|2014966_2015383_-	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_013855208.1|2015387_2015858_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_014564299.1|2015861_2017091_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_014564300.1|2017112_2017844_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.6	1.8e-12
WP_014919525.1|2017843_2018761_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_013855204.1|2018770_2019013_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_054607628.1|2019071_2020055_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_014564303.1|2020051_2020519_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003625233.1|2020548_2020995_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_023061724.1|2022697_2022946_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_099046791.1|2024613_2025003_+	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	43.4	2.1e-20
WP_041809689.1|2025247_2026492_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.6	2.7e-45
>prophage 15
NZ_CP012381	Lactobacillus helveticus strain CAUH18 chromosome, complete genome	2160583	2083030	2137538	2160583	protease,holin,transposase	Lactobacillus_virus(28.57%)	47	NA	NA
WP_023062082.1|2083030_2085154_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	40.2	3.8e-116
WP_167541416.1|2085517_2086345_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_023062085.1|2086337_2087663_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_023062086.1|2087751_2088453_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-32
WP_041809797.1|2091010_2091247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081008710.1|2091285_2092902_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_054607642.1|2093175_2094138_+	SLAP domain-containing protein	NA	Q6SE63	Lactobacillus_prophage	54.2	2.0e-64
WP_014564355.1|2094203_2094878_-	DUF975 family protein	NA	NA	NA	NA	NA
WP_014564356.1|2095384_2095543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014564359.1|2096006_2096396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023062094.1|2096410_2097118_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_041810775.1|2097166_2097367_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023062096.1|2097578_2098523_-	serine hydrolase	NA	NA	NA	NA	NA
WP_023062097.1|2098522_2099809_-	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
WP_023062098.1|2099801_2100041_-	D-alanine--poly(phosphoribitol) ligase subunit DltC	NA	NA	NA	NA	NA
WP_054607643.1|2100099_2101338_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	27.1	2.9e-23
WP_054607644.1|2101337_2102852_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	28.6	2.0e-34
WP_003630630.1|2102867_2103020_-	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_041809804.1|2103198_2103495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054607645.1|2103514_2104651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054607646.1|2105482_2106736_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	57.2	1.8e-118
WP_054607648.1|2107121_2108978_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	30.6	1.5e-68
WP_023060744.1|2109131_2110301_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_003625002.1|2110429_2110738_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_014564372.1|2110724_2110994_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_023060745.1|2111031_2112600_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	32.0	4.5e-13
WP_054607649.1|2112604_2113234_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_023060747.1|2113325_2114183_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014919635.1|2114179_2114461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101871943.1|2114614_2114710_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_148224885.1|2116820_2116976_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_014564379.1|2117170_2117827_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_014919640.1|2117916_2119020_+	YdcF family protein	NA	NA	NA	NA	NA
WP_014564381.1|2119044_2121381_+	ABC transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	39.8	7.1e-31
WP_054607650.1|2121415_2122021_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_014564383.1|2122127_2122955_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	28.8	2.8e-22
WP_014564384.1|2123072_2123792_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_014564385.1|2123938_2124790_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014564386.1|2124803_2125841_-	DUF871 domain-containing protein	NA	NA	NA	NA	NA
WP_054607651.1|2125909_2127892_-	penicillin binding protein PBP4B	NA	NA	NA	NA	NA
WP_054607652.1|2127945_2128836_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_167541417.1|2128857_2130840_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_014564390.1|2131268_2131916_+	deoxynucleoside kinase	NA	Q5ULP7	Lactobacillus_virus	48.4	1.4e-48
WP_041809814.1|2131940_2132627_+	deoxynucleoside kinase	NA	Q5ULP7	Lactobacillus_virus	50.0	5.4e-56
WP_041809816.1|2132674_2133475_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_014564394.1|2133711_2135019_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.2	6.3e-37
WP_081008711.1|2136278_2137538_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	58.5	5.9e-125
