The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012805	Streptococcus anginosus strain J4211 chromosome, complete genome	1924513	120142	210726	1924513	head,tail,tRNA,capsid,terminase,portal,holin,protease,integrase	Streptococcus_phage(77.55%)	91	120700:120759	153460:153673
WP_003027329.1|120142_120679_+	transcription termination/antitermination protein NusG	NA	F5B3X4	Synechococcus_phage	29.5	1.2e-10
120700:120759	attL	ATAGACCGATTGTTTGTATAAAAAGCCATGAAAATAGAAATAAATACTTTGCAAAAAATA	NA	NA	NA	NA
WP_057489509.1|120967_122035_-|integrase	site-specific integrase	integrase	A0A1P8VVR7	Streptococcus_phage	91.6	7.4e-185
WP_057489510.1|122158_122446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057489511.1|122457_122853_-	peptidase	NA	A0A141DZH4	Streptococcus_phage	55.8	3.1e-32
WP_057489512.1|123056_123752_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_057489513.1|123744_124119_-	helix-turn-helix transcriptional regulator	NA	A0A126GGL0	Streptococcus_phage	70.9	1.2e-44
WP_057489514.1|124406_124676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057489515.1|124661_125060_-	DUF2513 domain-containing protein	NA	A0A1Q1PVT8	Staphylococcus_phage	36.7	1.1e-13
WP_057489516.1|125113_125326_+	helix-turn-helix transcriptional regulator	NA	Q7Y4L6	Streptococcus_phage	88.4	3.3e-28
WP_057489517.1|125445_125760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057489518.1|125759_126179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057489519.1|126235_126601_+	hypothetical protein	NA	A0A1P8VVU1	Streptococcus_phage	71.4	4.3e-36
WP_057489520.1|126622_126907_+	hypothetical protein	NA	B3GVX8	Streptococcus_phage	86.2	1.3e-43
WP_057489521.1|126930_127149_+	hypothetical protein	NA	A0A1P8VVV1	Streptococcus_phage	69.4	1.1e-18
WP_057489522.1|127157_128498_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	84.2	1.1e-206
WP_057489523.1|128490_129237_+	conserved phage C-terminal domain-containing protein	NA	Q9MCM7	Streptococcus_virus	55.1	2.4e-25
WP_057489524.1|129237_130059_+	ATP-binding protein	NA	A0A1P8VVV9	Streptococcus_phage	86.4	2.3e-138
WP_057489525.1|130744_131002_+	hypothetical protein	NA	A0A1S5S9S3	Streptococcus_phage	69.2	6.4e-18
WP_057489526.1|130994_131177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057489527.1|131169_131661_+	MazG-like family protein	NA	A0A1P8VVP1	Streptococcus_phage	79.1	6.2e-70
WP_081026668.1|131681_131978_+	DUF1372 family protein	NA	A0A1P8VVQ5	Streptococcus_phage	52.7	3.2e-21
WP_057489530.1|132155_132539_+	hypothetical protein	NA	C5J998	Streptococcus_phage	54.4	4.0e-32
WP_057489531.1|132531_133050_+	hypothetical protein	NA	A0A1P8VVV2	Streptococcus_phage	43.2	5.6e-05
WP_057489532.1|133040_133220_+	hypothetical protein	NA	A0A1J0MGB9	Staphylococcus_phage	54.3	4.3e-05
WP_158471996.1|133216_133357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057489533.1|133530_133935_+	transcriptional regulator	NA	A0A1S5SER4	Streptococcus_phage	49.3	3.2e-24
WP_057489534.1|134121_134664_+|integrase	site-specific integrase	integrase	A0A1S5S9C2	Streptococcus_phage	98.9	7.7e-98
WP_057489535.1|134844_135285_+	hypothetical protein	NA	A0A1S5S9X0	Streptococcus_phage	38.8	1.3e-18
WP_057489536.1|135404_135737_+	hypothetical protein	NA	A0A141E0N9	Streptococcus_phage	82.1	5.3e-49
WP_057489537.1|135907_136297_+|terminase	P27 family phage terminase small subunit	terminase	A0A1S5S8F2	Streptococcus_phage	87.3	2.6e-55
WP_057489538.1|136289_138065_+|terminase	terminase large subunit	terminase	C5J959	Streptococcus_phage	90.6	0.0e+00
WP_057489539.1|138072_138291_+	hypothetical protein	NA	C5J960	Streptococcus_phage	73.6	3.0e-24
WP_057489540.1|138308_139511_+|portal	phage portal protein	portal	C5J961	Streptococcus_phage	81.0	8.0e-188
WP_057489541.1|139497_140076_+|head,protease	HK97 family phage prohead protease	head,protease	C5J962	Streptococcus_phage	86.5	3.0e-92
WP_057489542.1|140072_141230_+|capsid	phage major capsid protein	capsid	A0A141E0N4	Streptococcus_phage	59.1	1.0e-107
WP_057489543.1|141241_141541_+	hypothetical protein	NA	C5J964	Streptococcus_phage	53.5	3.5e-15
WP_057489544.1|141543_141816_+	hypothetical protein	NA	C5J965	Streptococcus_phage	79.3	1.1e-33
WP_057489545.1|141812_142031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057489546.1|142017_142344_+|head	phage head closure protein	head	A0A1S5S9T0	Streptococcus_phage	50.0	4.9e-23
WP_039677494.1|142333_142687_+	HK97 gp10 family phage protein	NA	A0A1S5SFC4	Streptococcus_phage	44.4	1.9e-20
WP_081026657.1|142683_143010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057489547.1|143020_143605_+|tail	phage tail protein	tail	Q6DMT5	Streptococcus_phage	53.5	1.2e-48
WP_057489548.1|143607_144021_+	hypothetical protein	NA	C5J970	Streptococcus_phage	48.9	3.3e-32
WP_057489549.1|144245_147314_+|tail	phage tail tape measure protein	tail	Q6DMT2	Streptococcus_phage	53.2	1.7e-170
WP_057489550.1|147313_148036_+	hypothetical protein	NA	A0A1S5SA78	Streptococcus_phage	56.7	1.2e-74
WP_057489551.1|148035_149280_+|tail	phage tail protein	tail	A0A1S5S9Z5	Streptococcus_phage	55.6	5.9e-125
WP_057489552.1|149279_151400_+	SGNH/GDSL hydrolase family protein	NA	A0A1S5SAB2	Streptococcus_phage	75.6	0.0e+00
WP_049507630.1|151424_151730_+	hypothetical protein	NA	A0A286QSD3	Streptococcus_phage	56.6	4.9e-25
WP_057489553.1|151741_152074_+|holin	phage holin	holin	A0A1S5SCK0	Streptococcus_phage	64.5	4.2e-30
WP_057489554.1|152075_152816_+	SH3 domain-containing protein	NA	F8HGP2	Streptococcus_phage	77.7	2.1e-109
WP_039677487.1|153246_153426_+	hypothetical protein	NA	Q3BLW4	Phage_SK137	68.5	7.3e-13
WP_022526394.1|153742_153982_-	hypothetical protein	NA	NA	NA	NA	NA
153460:153673	attR	ATAGACCGATTGTTTGTATAAAAAGCCATGAAAATAGAAATAAATACTTTGCAAAAAATAAGGCAGGAAAAACAGTCCGCCCCAAATTCGCCCCAAAATATTTTTAAAGTTAGCCTGATTTAACCTGACATAAAATCAAAAAAGCCCGACTTTACGGGCTTTTCATTCGGTTAATTCCTGTTAAATTAGGTACTGAAAGGCGGTAGACGGATTT	NA	NA	NA	NA
WP_003027150.1|162404_162662_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A1X9I6A0	Streptococcus_phage	74.1	1.2e-27
WP_003027145.1|163386_163767_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_003027142.1|164048_164303_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_003027139.1|164295_164562_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_021001204.1|165078_166476_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_057489555.1|166501_172612_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003027132.1|173002_173731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021001206.1|173743_174418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037607385.1|175024_175756_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021001208.1|175809_176982_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	53.0	9.4e-16
WP_003032083.1|177127_177622_+	DUF536 domain-containing protein	NA	NA	NA	NA	NA
WP_041784077.1|177670_178474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021001210.1|178488_180246_+	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_021001211.1|180300_180600_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_021001212.1|180636_182916_-	Xaa-Pro dipeptidyl-peptidase	NA	NA	NA	NA	NA
WP_003033015.1|183024_183876_+	aquaporin family protein	NA	M1HJ77	Paramecium_bursaria_Chlorella_virus	26.8	1.7e-14
WP_057489556.1|184092_185358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021001214.1|185439_186180_+	proteinase	NA	NA	NA	NA	NA
WP_021001215.1|186176_187112_+	serine hydrolase	NA	NA	NA	NA	NA
WP_003027089.1|187277_188156_+	mevalonate kinase	NA	NA	NA	NA	NA
WP_003027084.1|188137_189082_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_021001216.1|189074_190079_+	phosphomevalonate kinase	NA	NA	NA	NA	NA
WP_003027078.1|190071_191088_+	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_003027073.1|191116_192397_-	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_003027070.1|192398_193571_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_003027068.1|193704_194154_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_003027066.1|194157_194934_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_003027063.1|195034_197350_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	32.7	1.1e-113
WP_021001217.1|197599_198667_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_021001218.1|200368_201400_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_021001219.1|201493_201937_+	dUTP diphosphatase	NA	Q332E8	Clostridium_botulinum_C_phage	50.0	8.7e-31
WP_041783983.1|201917_203315_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_021001221.1|203522_204980_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L0I5	Tupanvirus	24.8	1.1e-10
WP_021001222.1|205244_205943_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase	NA	NA	NA	NA	NA
WP_021001223.1|205955_207086_+	N-acetyldiaminopimelate deacetylase	NA	NA	NA	NA	NA
WP_003027033.1|207130_207658_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_057489557.1|207650_208331_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_021001225.1|208388_209225_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_021001226.1|209469_210726_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	40.3	1.6e-77
>prophage 2
NZ_CP012805	Streptococcus anginosus strain J4211 chromosome, complete genome	1924513	240252	263424	1924513	tRNA,protease,integrase	Streptococcus_phage(90.0%)	24	230298:230314	243464:243480
230298:230314	attL	CAATTTCAATCAATGCT	NA	NA	NA	NA
WP_001291561.1|240252_241470_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5SEW7	Streptococcus_phage	100.0	3.7e-233
WP_000814511.1|241551_241755_-	excisionase	NA	A0A1S5SF07	Streptococcus_phage	100.0	4.0e-31
WP_000857133.1|242215_242446_-	helix-turn-helix domain-containing protein	NA	A0A1S5SEX1	Streptococcus_phage	100.0	2.7e-36
WP_000804885.1|242442_242865_-	sigma-70 family RNA polymerase sigma factor	NA	A0A1S5SEW0	Streptococcus_phage	100.0	2.5e-72
WP_001227347.1|243368_243722_+	helix-turn-helix domain-containing protein	NA	A0A1S5SFA6	Streptococcus_phage	100.0	1.3e-58
243464:243480	attR	AGCATTGATTGAAATTG	NA	NA	NA	NA
WP_000336323.1|243781_243949_-	cysteine-rich KTR domain-containing protein	NA	D0R0F6	Streptococcus_phage	68.0	1.6e-14
WP_000691736.1|244067_245987_-	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A1S5SF82	Streptococcus_phage	99.5	0.0e+00
WP_001791010.1|246002_246119_-	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_001224320.1|246363_247299_-	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	99.0	7.7e-170
WP_020999616.1|247295_248297_-	bifunctional lysozyme/C40 family peptidase	NA	A0A1S5SEZ8	Streptococcus_phage	99.7	3.2e-190
WP_000804748.1|248293_250471_-	membrane protein	NA	A0A1S5SF30	Streptococcus_phage	100.0	0.0e+00
WP_000331160.1|250473_252921_-	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	100.0	0.0e+00
WP_000506270.1|252904_253411_-	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	100.0	8.6e-91
WP_000342539.1|253385_253883_-	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	100.0	1.7e-91
WP_001009056.1|253999_254221_-	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	100.0	4.3e-31
WP_000398284.1|254263_255469_-	replication initiation factor domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	100.0	2.8e-233
WP_000879507.1|255491_255644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813488.1|255646_257032_-	DNA translocase FtsK	NA	A0A1S5SFB5	Streptococcus_phage	100.0	1.1e-265
WP_000985015.1|257060_257447_-	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	100.0	3.0e-64
WP_000420682.1|257462_257777_-	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	100.0	5.2e-54
WP_021001238.1|258254_259004_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	43.2	2.3e-23
WP_003026966.1|259012_259816_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_021001239.1|260255_261527_+|protease	RIP metalloprotease	protease	NA	NA	NA	NA
WP_021001240.1|261564_263424_+|tRNA	proline--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	22.3	5.3e-05
>prophage 3
NZ_CP012805	Streptococcus anginosus strain J4211 chromosome, complete genome	1924513	501985	510781	1924513		Streptococcus_phage(81.82%)	12	NA	NA
WP_021001402.1|501985_502750_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	1.4e-15
WP_003032369.1|502749_503460_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.2	1.8e-14
WP_003025613.1|503605_504262_+	CBS domain-containing protein	NA	M1NSC5	Streptococcus_phage	72.2	3.5e-84
WP_003025610.1|504331_505195_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	57.5	3.1e-93
WP_057489585.1|505349_505988_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	66.2	6.4e-75
WP_021001404.1|505984_506878_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	56.5	6.8e-83
WP_003025601.1|506912_507230_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	62.9	8.1e-31
WP_021001405.1|507232_508099_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	73.6	6.8e-112
WP_021001406.1|508101_508608_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	64.0	3.4e-55
WP_021001407.1|508627_508981_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	65.0	3.2e-36
WP_021001408.1|509304_509928_+	endonuclease III	NA	NA	NA	NA	NA
WP_021001409.1|509953_510781_-	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	75.5	3.4e-121
>prophage 4
NZ_CP012805	Streptococcus anginosus strain J4211 chromosome, complete genome	1924513	514463	569210	1924513	tRNA,protease,bacteriocin	Tupanvirus(11.11%)	55	NA	NA
WP_021001412.1|514463_516458_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	35.5	1.0e-86
WP_021001413.1|516767_517949_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_021001414.1|518042_518729_+	response regulator transcription factor	NA	A0A220YL79	Alteromonas_virus	25.0	4.4e-05
WP_021001415.1|518712_519693_+	sensor histidine kinase	NA	A0A2K9L0Z8	Tupanvirus	33.7	3.7e-05
WP_021001416.1|519815_520574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021001418.1|520778_521558_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.8	1.0e-26
WP_021001419.1|521538_523518_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_021001420.1|523670_524537_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	32.2	7.4e-18
WP_021001421.1|524538_525402_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003025554.1|525445_525883_+	LytTR family transcriptional regulator DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_021001422.1|525895_526300_+	DUF3021 domain-containing protein	NA	NA	NA	NA	NA
WP_003040243.1|526460_527228_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.8	1.0e-26
WP_057489586.1|527220_529209_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_021001424.1|529355_530744_+	amino acid permease	NA	NA	NA	NA	NA
WP_037613156.1|530811_531240_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_037613154.1|531252_531714_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_021001427.1|531710_532376_+	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_003032129.1|532725_532929_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	83.1	3.3e-25
WP_021001428.1|533200_534022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003025500.1|534087_534324_+	DUF2829 domain-containing protein	NA	G3MBC9	Bacillus_virus	38.6	1.1e-05
WP_021001429.1|534316_535015_+	3-oxoacyl-ACP reductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.7	3.8e-12
WP_021001430.1|535028_536234_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_021001431.1|536683_538063_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0G2Y8M0	Acanthamoeba_polyphaga_mimivirus	32.9	3.2e-31
WP_021001432.1|538071_538623_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003025491.1|538633_538942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021001433.1|538993_539686_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_021001434.1|539700_540009_+	DUF898 family protein	NA	S5MNN8	Brevibacillus_phage	66.0	6.3e-12
WP_021001435.1|540120_541662_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	27.2	5.9e-50
WP_021001436.1|541862_542666_-	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	36.4	1.5e-17
WP_021001437.1|542906_543350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022525195.1|543458_543668_+	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_021001439.1|543754_546052_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	50.4	8.4e-85
WP_021001440.1|546249_548601_+	HAD-IC family P-type ATPase	NA	A0A218MNH6	uncultured_virus	21.8	6.3e-19
WP_003025469.1|548645_548999_-	DUF3397 family protein	NA	NA	NA	NA	NA
WP_003025466.1|549161_549587_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_003025463.1|549677_550367_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_021001442.1|550602_553272_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_021001443.1|553268_554387_+	citrate synthase	NA	NA	NA	NA	NA
WP_021001444.1|554388_555576_+	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_003025453.1|555799_556540_+	UMP kinase	NA	NA	NA	NA	NA
WP_003034284.1|556543_557101_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_003025448.1|557447_558302_+	RNA-binding virulence regulatory protein CvfB	NA	NA	NA	NA	NA
WP_021001445.1|558382_559420_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_021001446.1|559490_560096_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	56.2	1.7e-61
WP_037590248.1|560158_560533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003025436.1|561013_563164_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.6	7.2e-38
WP_021001448.1|563174_564536_+|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
WP_003025431.1|564628_564778_+|bacteriocin	ComC/BlpC family leader-containing pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
WP_021001449.1|564822_566130_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_003025426.1|566134_566887_-	response regulator transcription factor	NA	A0A1V0E029	Clostridioides_phage	24.2	1.5e-14
WP_021001450.1|567049_567763_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003025424.1|567994_568219_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003037422.1|568306_568627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003025420.1|568634_568868_+|bacteriocin	garvicin Q family class II bacteriocin	bacteriocin	NA	NA	NA	NA
WP_021001453.1|568919_569210_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 5
NZ_CP012805	Streptococcus anginosus strain J4211 chromosome, complete genome	1924513	802502	811862	1924513	protease	Bacillus_phage(57.14%)	8	NA	NA
WP_003024910.1|802502_803720_+	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	51.0	6.8e-94
WP_021001588.1|803805_804645_+	thymidylate synthase	NA	U5J9N5	Bacillus_phage	56.4	1.1e-85
WP_021001589.1|804829_805342_+	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	38.5	2.4e-24
WP_021001590.1|805553_806786_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.7	1.1e-131
WP_057489627.1|806797_807385_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_003027979.1|807507_808215_+	glucosaminidase domain-containing protein	NA	Q9ZXE4	Bacillus_phage	42.3	7.4e-16
WP_049533337.1|808387_810133_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.8	7.9e-43
WP_057489628.1|810113_811862_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.2	2.7e-51
>prophage 6
NZ_CP012805	Streptococcus anginosus strain J4211 chromosome, complete genome	1924513	827485	835017	1924513		Streptococcus_phage(28.57%)	8	NA	NA
WP_021001604.1|827485_827908_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	44.5	5.4e-22
WP_021001605.1|828059_828950_+	RNase adapter RapZ	NA	A0A2D1GP35	Streptomyces_phage	33.6	1.1e-08
WP_021001606.1|828946_829924_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	83.7	3.5e-157
WP_021001607.1|829920_830832_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	70.3	1.5e-114
WP_021001608.1|831113_831635_+	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_003024843.1|831639_832908_+	uracil transporter	NA	Q9KX94	Enterobacteria_phage	35.4	3.3e-59
WP_003024841.1|832966_833890_+	aspartate carbamoyltransferase catalytic subunit	NA	M1HGA5	Paramecium_bursaria_Chlorella_virus	31.7	7.9e-26
WP_003024839.1|833928_835017_+	carbamoyl phosphate synthase small subunit	NA	R4TGJ8	Halovirus	36.8	4.6e-57
>prophage 7
NZ_CP012805	Streptococcus anginosus strain J4211 chromosome, complete genome	1924513	1328342	1408655	1924513	tRNA,tail,head,capsid,terminase,portal,integrase	Streptococcus_phage(57.14%)	91	1377444:1377460	1408697:1408713
WP_057489730.1|1328342_1329089_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_057489731.1|1329078_1329336_+	GIY-YIG nuclease family protein	NA	W8W2G4	Invertebrate_iridovirus	36.5	3.3e-06
WP_057489732.1|1329370_1331599_-	glycosyl hydrolase 53 family protein	NA	NA	NA	NA	NA
WP_057489733.1|1331711_1333367_-	PTS lactose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_021001913.1|1333371_1333695_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_021001914.1|1333708_1335109_-	6-phospho-beta-galactosidase	NA	A0A0B5JD41	Pandoravirus	30.5	5.9e-49
WP_021001915.1|1335119_1335956_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_021001916.1|1336210_1336744_-	isoprenylcysteine carboxyl methyltransferase family protein	NA	NA	NA	NA	NA
WP_021001917.1|1336842_1337775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003023771.1|1337854_1339330_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_003023769.1|1339460_1339766_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003023767.1|1339789_1340269_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_021001918.1|1340433_1340865_+	galactose-6-phosphate isomerase subunit LacA	NA	NA	NA	NA	NA
WP_003023763.1|1340883_1341402_+	galactose-6-phosphate isomerase subunit LacB	NA	NA	NA	NA	NA
WP_003023761.1|1341535_1342282_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	32.0	1.9e-25
WP_003023759.1|1342452_1343403_+	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_041784025.1|1343467_1345024_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.8	4.9e-60
WP_057489734.1|1345342_1346251_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_021001921.1|1346898_1348443_-	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	28.7	2.3e-38
WP_021001922.1|1348632_1348953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003023750.1|1348964_1349372_-	helix-turn-helix transcriptional regulator	NA	A0A0A7S0F1	Clostridium_phage	42.0	3.6e-07
WP_003023749.1|1349504_1350188_-	TIGR02206 family membrane protein	NA	NA	NA	NA	NA
WP_003023748.1|1350191_1350890_-	TIGR02206 family membrane protein	NA	NA	NA	NA	NA
WP_021001923.1|1350893_1351445_-	DUF1697 domain-containing protein	NA	NA	NA	NA	NA
WP_021001924.1|1351434_1352805_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_021001925.1|1352936_1353983_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_021001926.1|1354115_1354712_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_041784026.1|1354722_1356771_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_003023737.1|1357319_1358525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003023736.1|1358546_1358843_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003023734.1|1358832_1359198_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_106079412.1|1359472_1359652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003023729.1|1360674_1361367_-	phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_021001929.1|1361507_1361969_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_057489735.1|1362415_1363717_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0S2MYF3	Enterococcus_phage	59.1	9.8e-139
WP_057489736.1|1363694_1363979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057489737.1|1363980_1364211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057489738.1|1364224_1364773_-	hypothetical protein	NA	A0A2H4J9Y8	uncultured_Caudovirales_phage	54.8	5.0e-52
WP_057489739.1|1364762_1364990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057489740.1|1368632_1368983_-	hypothetical protein	NA	A0A141E1W7	Streptococcus_phage	78.4	4.3e-49
WP_057489741.1|1368991_1372264_-	hypothetical protein	NA	A0A1S5SC25	Streptococcus_phage	57.8	1.4e-197
WP_057489742.1|1372247_1372601_-	hypothetical protein	NA	A0A141E1S6	Streptococcus_phage	67.6	3.0e-34
WP_057489743.1|1372651_1373026_-	hypothetical protein	NA	E8ZDE4	Streptococcus_phage	63.7	7.3e-39
WP_049476260.1|1373030_1373447_-|tail	tail protein	tail	E8ZDZ9	Streptococcus_phage	72.5	1.6e-50
WP_048800703.1|1373451_1373820_-	hypothetical protein	NA	M1NSH7	Streptococcus_phage	73.0	3.2e-47
WP_057489744.1|1373816_1374320_-	HK97 gp10 family phage protein	NA	A0A1S5SFD9	Streptococcus_phage	62.0	1.1e-50
WP_081026665.1|1374306_1374642_-	hypothetical protein	NA	M1PLI4	Streptococcus_phage	62.5	1.4e-28
WP_057489746.1|1374622_1374931_-|head,tail	phage head-tail connector protein	head,tail	A0A1X9I6G0	Streptococcus_phage	74.5	3.9e-30
WP_057489747.1|1374939_1375143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057489748.1|1375153_1376170_-	sugar-binding protein	NA	E8ZD37	Streptococcus_phage	86.6	1.5e-166
WP_057489749.1|1376194_1376734_-	DUF4355 domain-containing protein	NA	A0A060QST4	Streptococcus_phage	71.3	8.1e-39
WP_057489750.1|1376934_1377186_-	hypothetical protein	NA	A0A1S5SBY0	Streptococcus_phage	97.6	1.3e-39
WP_057489751.1|1377188_1377452_-	hypothetical protein	NA	A0A141E1N9	Streptococcus_phage	87.4	2.2e-37
1377444:1377460	attL	GTATTTCATTTTTTCAA	NA	NA	NA	NA
WP_057489752.1|1377647_1377932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081026671.1|1377924_1379610_-|capsid	minor capsid protein	capsid	A0A1S5SDJ1	Streptococcus_phage	62.1	1.2e-120
WP_057489754.1|1379656_1381045_-|portal	phage portal protein	portal	A0A1S5SEU5	Streptococcus_phage	76.1	2.4e-199
WP_057489755.1|1381056_1382334_-|terminase	PBSX family phage terminase large subunit	terminase	A0A097PAV9	Streptococcus_pyogenes_phage	73.9	4.2e-179
WP_057489756.1|1382323_1382761_-|terminase	terminase small subunit	terminase	A0A141DZP6	Streptococcus_phage	55.8	7.8e-32
WP_057489757.1|1383058_1383478_-	hypothetical protein	NA	A0A1X9I5N8	Streptococcus_phage	44.4	7.5e-24
WP_057489759.1|1383842_1384067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057489760.1|1384057_1384456_-	RusA family crossover junction endodeoxyribonuclease	NA	Q5YA86	Bacillus_phage	63.4	3.4e-42
WP_057489761.1|1384475_1385030_-	hypothetical protein	NA	V9VD50	Lactococcus_phage	47.6	1.8e-41
WP_057489762.1|1385331_1387584_-	AAA family ATPase	NA	Q5YA88	Bacillus_phage	66.0	2.3e-284
WP_057489763.1|1387595_1389179_-	DEAD/DEAH box helicase	NA	A0A097BY72	Enterococcus_phage	76.0	6.8e-235
WP_057489764.1|1389189_1389750_-	hypothetical protein	NA	A0A097BY29	Enterococcus_phage	48.3	1.4e-33
WP_057489765.1|1389773_1390511_-	hypothetical protein	NA	U4KJ90	Streptococcus_phage	55.3	3.9e-68
WP_057489766.1|1390513_1390939_-	hypothetical protein	NA	A0A1S5S8P0	Streptococcus_phage	55.6	1.6e-26
WP_057489767.1|1390984_1392118_-	ATP-binding protein	NA	Q5YA96	Bacillus_phage	57.9	3.9e-99
WP_057489768.1|1392121_1393399_-	AAA family ATPase	NA	A0A097BY67	Enterococcus_phage	64.7	3.0e-148
WP_057489769.1|1393423_1393660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057489770.1|1393674_1394466_-	DNA adenine methylase	NA	A0A2H4JFS7	uncultured_Caudovirales_phage	55.1	6.9e-71
WP_057489771.1|1394481_1394835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057489772.1|1394837_1395146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081026666.1|1395142_1395613_-	hypothetical protein	NA	A0A141E1P8	Streptococcus_phage	42.7	3.0e-13
WP_057489774.1|1395566_1396013_-	HNH endonuclease	NA	A0A1S5SA27	Streptococcus_phage	73.6	4.8e-61
WP_057489775.1|1395972_1396233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057489776.1|1396237_1396459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057489777.1|1396460_1396772_-	hypothetical protein	NA	M1Q0Y6	Streptococcus_phage	88.2	1.0e-49
WP_081026672.1|1396890_1397079_-	helix-turn-helix transcriptional regulator	NA	A0A141E205	Streptococcus_phage	90.3	5.3e-22
WP_057489778.1|1397833_1398022_-	helix-turn-helix transcriptional regulator	NA	A0A1S5S8U1	Streptococcus_phage	83.9	5.1e-25
WP_057489779.1|1398221_1398566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057489780.1|1399079_1399850_+	helix-turn-helix transcriptional regulator	NA	E8ZDN4	Streptococcus_phage	54.1	1.1e-68
WP_081026673.1|1400059_1401130_+	hypothetical protein	NA	A0A141E0C6	Streptococcus_phage	89.9	1.0e-181
WP_057489782.1|1401503_1402646_+|integrase	site-specific integrase	integrase	A1EAB7	Streptococcus_phage	85.8	4.0e-189
WP_003023726.1|1402734_1403010_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	70.8	9.8e-25
WP_003023725.1|1403138_1403972_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	35.6	2.4e-13
WP_003023723.1|1404201_1405155_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	39.3	5.6e-59
WP_057489783.1|1405147_1406110_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_021001931.1|1406111_1406864_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	27.7	4.6e-16
WP_003023719.1|1406886_1407861_+	siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_021001932.1|1407923_1408655_-	serine/threonine protein phosphatase	NA	A0A060AL72	Listeria_phage	32.1	1.6e-26
1408697:1408713	attR	GTATTTCATTTTTTCAA	NA	NA	NA	NA
>prophage 8
NZ_CP012805	Streptococcus anginosus strain J4211 chromosome, complete genome	1924513	1902183	1911034	1924513		Streptococcus_phage(33.33%)	9	NA	NA
WP_021002237.1|1902183_1903023_-	energy-coupling factor transporter ATPase	NA	A0A2K9L3Z8	Tupanvirus	33.0	5.2e-16
WP_041784072.1|1903007_1903835_-	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	31.4	4.0e-21
WP_021002239.1|1903836_1904376_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_021002240.1|1904386_1905208_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_021002241.1|1905266_1906562_-	insulinase family protein	NA	A0A1E1EST3	Acanthamoeba_castellanii_mimivirus	28.2	1.6e-19
WP_021002242.1|1906561_1907809_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	50.7	1.3e-111
WP_003026797.1|1907984_1908365_+	S4 domain-containing protein YaaA	NA	A0A1X9I5V8	Streptococcus_phage	65.3	1.2e-20
WP_003026800.1|1908366_1909464_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_003026802.1|1909552_1911034_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.3	9.5e-98
