The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013133	Rickettsia rhipicephali strain HJ#5, complete genome	1406075	616083	690981	1406075	tRNA,transposase,integrase	Wolbachia_phage(20.0%)	57	660355:660375	707548:707568
WP_057700020.1|616083_617076_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_057700022.1|619173_620235_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_057700023.1|620231_621221_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_155813862.1|621391_621577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057700025.1|624102_624312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057700026.1|625845_626859_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_057700027.1|626971_627763_+	RMD1 family protein	NA	NA	NA	NA	NA
WP_057700028.1|627772_628618_+	ribonuclease D	NA	NA	NA	NA	NA
WP_057700391.1|628669_628900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057700029.1|629012_629534_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_057700030.1|629826_631206_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.8	3.8e-48
WP_082623613.1|631359_632163_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_081498429.1|633044_633383_-	hypothetical protein	NA	M1HZJ7	Paramecium_bursaria_Chlorella_virus	36.5	9.6e-06
WP_148194411.1|633714_633852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014408713.1|633767_633980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057700033.1|634091_634658_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_081497593.1|634654_634831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014408711.1|634974_635460_-	DUF2532 domain-containing protein	NA	NA	NA	NA	NA
WP_057700392.1|635464_636307_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_057700034.1|636409_636886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014408707.1|637290_637503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012152884.1|637811_637937_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_081498428.1|637937_638072_-	palindromic element RPE5 domain-containing protein	NA	NA	NA	NA	NA
WP_057700393.1|638147_638909_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_057700035.1|638905_639652_+	NTP transferase domain-containing protein	NA	A0A0G2Y8M0	Acanthamoeba_polyphaga_mimivirus	36.7	1.9e-30
WP_057700036.1|642208_642679_+	DUF2608 domain-containing protein	NA	NA	NA	NA	NA
WP_041405515.1|643774_644011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156405180.1|644152_644419_+	DUF1016 family protein	NA	Q9JMM6	Wolbachia_phage	54.5	1.1e-20
WP_081498427.1|644457_644976_+	DUF1016 family protein	NA	Q9JMP5	Wolbachia_phage	49.7	1.6e-44
WP_082623614.1|645040_645433_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014408694.1|646036_647065_-	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_082623615.1|647301_647970_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	58.7	1.0e-19
WP_057700039.1|650072_656762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057700040.1|656774_659177_-	hypothetical protein	NA	NA	NA	NA	NA
660355:660375	attL	CTGGCATTTAAGCCTATTTTA	NA	NA	NA	NA
WP_057700041.1|663527_664709_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	24.5	1.2e-13
WP_057700394.1|665209_665518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057700042.1|665517_666075_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_057700043.1|666071_666533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156405203.1|666612_666861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057700045.1|666930_668370_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_057700395.1|668378_668645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057700046.1|668634_671154_+	TraC family protein	NA	NA	NA	NA	NA
WP_057700047.1|671150_671789_+	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_057700396.1|672128_673097_+	conjugal transfer pilus assembly protein TraU	NA	NA	NA	NA	NA
WP_057700048.1|673118_673508_+	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_082623664.1|673575_675300_+	conjugal transfer protein TraN	NA	NA	NA	NA	NA
WP_057700049.1|675335_676223_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_057700050.1|676191_677517_+	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_057700051.1|677562_680280_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_057700052.1|680290_681466_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_057700053.1|681482_683186_+	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_057700054.1|683654_684656_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	36.9	1.4e-28
WP_082623616.1|684694_686479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057700056.1|686599_687064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057700057.1|687333_687774_-|transposase	IS200/IS605 family transposase	transposase	W0UUZ0	Sulfolobus_monocaudavirus	43.2	1.7e-23
WP_082623617.1|687808_689704_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_057700058.1|690543_690981_-|transposase	IS200/IS605 family transposase	transposase	G9CU69	Helicobacter_phage	39.4	3.4e-19
707548:707568	attR	CTGGCATTTAAGCCTATTTTA	NA	NA	NA	NA
>prophage 2
NZ_CP013133	Rickettsia rhipicephali strain HJ#5, complete genome	1406075	725984	762808	1406075	transposase,integrase	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(33.33%)	29	743722:743737	767091:767106
WP_057700072.1|725984_727409_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_045798999.1|727823_728867_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	35.5	3.3e-28
WP_057700073.1|728911_733060_-	AAA family ATPase	NA	A0A2K5B264	Erysipelothrix_phage	24.4	7.0e-05
WP_008579929.1|733586_733880_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_057700074.1|734064_735129_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	68.0	2.5e-140
WP_057700075.1|735253_735943_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	33.8	2.7e-10
WP_057700076.1|735854_737195_-	MFS transporter	NA	NA	NA	NA	NA
WP_057700077.1|737712_738450_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_057700078.1|738517_739600_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	64.6	7.6e-129
WP_057700079.1|739708_741079_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_008579926.1|741228_742917_-	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_008579924.1|742921_744115_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
743722:743737	attL	TATTATTATAGGCTTC	NA	NA	NA	NA
WP_008579923.1|744101_746819_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_008579921.1|746896_748231_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_011477109.1|748220_749123_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_045798998.1|749124_750936_-	conjugal transfer protein TraN	NA	NA	NA	NA	NA
WP_008579918.1|750932_751367_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_008579917.1|751411_752380_-	conjugal transfer pilus assembly protein TraU	NA	NA	NA	NA	NA
WP_008579916.1|752382_752589_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_037214304.1|752654_753338_-	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_012152046.1|753590_756122_-	TraC family protein	NA	NA	NA	NA	NA
WP_008579913.1|756105_756360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008579912.1|756359_757778_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_057700080.1|757803_758136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011477114.1|758095_758551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008579909.1|758550_759102_-	conjugative transfer protein	NA	NA	NA	NA	NA
WP_008579908.1|759101_759410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008579905.1|759817_761602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008579904.1|761641_762808_-|integrase	site-specific integrase	integrase	A0A0M3LQN1	Mannheimia_phage	27.1	5.0e-17
767091:767106	attR	GAAGCCTATAATAATA	NA	NA	NA	NA
