The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011965	Bifidobacterium longum subsp. longum strain CCUG30698 chromosome, complete genome	2458004	49140	122345	2458004	protease,transposase,tRNA,integrase	uncultured_Mediterranean_phage(15.38%)	56	117634:117693	123621:123719
WP_003827911.1|49140_50232_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_007054547.1|50365_50755_+	DUF3073 domain-containing protein	NA	NA	NA	NA	NA
WP_162491406.1|50860_51280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007051721.1|51487_53935_+	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	39.1	2.3e-11
WP_007054546.1|54148_54367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007054545.1|54471_55317_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_007056840.1|55949_56426_-	cell division protein CrgA	NA	NA	NA	NA	NA
WP_007056838.1|56509_57310_+	DUF881 domain-containing protein	NA	NA	NA	NA	NA
WP_012472056.1|57306_58545_+	class E sortase	NA	NA	NA	NA	NA
WP_007055904.1|58595_59240_+	glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	38.9	1.4e-32
WP_008783610.1|59463_61536_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	L7RGQ5	Acanthamoeba_polyphaga_moumouvirus	33.8	6.8e-17
WP_058060620.1|61539_62289_-	serine/threonine protein kinase	NA	T2AWK4	Cannes_8_virus	32.7	1.5e-14
WP_058060621.1|62285_63752_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_058060622.1|63748_65410_-	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_021975436.1|65406_67101_-	phosphoprotein phosphatase	NA	NA	NA	NA	NA
WP_007056826.1|67105_67636_-	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_007051707.1|67665_68367_-	DUF3662 domain-containing protein	NA	NA	NA	NA	NA
WP_032685011.1|68551_70996_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_162491399.1|71105_72206_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_022527189.1|72348_73437_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_007055915.1|73436_73757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032682819.1|73757_74156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157821724.1|74167_74506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032742152.1|74667_74862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007055934.1|75077_75932_+	toxic anion resistance protein	NA	A0A1S6UAV6	Serratia_phage	28.5	2.3e-19
WP_007055906.1|76312_76816_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_008783747.1|76950_78222_-|transposase	IS30-like element ISBlo4 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	3.5e-40
WP_007051697.1|78546_79503_+	drug/metabolite DMT transporter permease	NA	NA	NA	NA	NA
WP_007055928.1|79632_79866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007055909.1|80326_81709_+	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_058060624.1|81705_84279_+	DUF2156 domain-containing protein	NA	NA	NA	NA	NA
WP_022527194.1|84874_85849_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_058060625.1|86136_89343_-	DEAD/DEAH box helicase	NA	U3PFS7	Lactobacillus_phage	27.9	1.6e-20
WP_007055916.1|89415_89829_-	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_058061114.1|90891_91224_+	putative heavy metal-binding protein	NA	NA	NA	NA	NA
WP_058060626.1|91285_92143_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_007054515.1|92246_92483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047379135.1|93388_94702_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	32.7	4.8e-53
WP_058060627.1|95119_97153_+	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	27.5	1.0e-17
WP_032747056.1|97561_99721_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	26.3	2.7e-45
WP_058060628.1|100102_100903_-	DUF4143 domain-containing protein	NA	NA	NA	NA	NA
WP_008783677.1|101033_102485_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_007054509.1|102659_103598_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_011068538.1|103808_104876_-	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_013582320.1|105091_106378_+	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	35.0	1.3e-66
WP_007051667.1|106401_107985_+	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
WP_058061115.1|108171_109266_+	CrcB family protein	NA	NA	NA	NA	NA
WP_058060629.1|109265_109661_+	CrcB family protein	NA	NA	NA	NA	NA
WP_007051663.1|109935_111021_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_058060630.1|111229_113014_+	potassium transporter Kup	NA	A7J6G4	Paramecium_bursaria_Chlorella_virus	33.4	1.1e-42
WP_007051661.1|113430_114978_+	alpha-L-arabinofuranosidase	NA	NA	NA	NA	NA
WP_008783486.1|115161_116184_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_007051659.1|116269_117277_-	hypothetical protein	NA	NA	NA	NA	NA
117634:117693	attL	TCCGATTAAGCCGGGTTTGTTGTTAAGCCGGGGAACGGTTCGGGGTCTTGGTGGCTGGCC	NA	NA	NA	NA
WP_058060631.1|117728_118784_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U4IH55	Gordonia_phage	26.7	1.0e-05
WP_007053138.1|118780_119746_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_058060632.1|120842_122345_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
123621:123719	attR	GGCCAGCCACCAAGACCCCGAACCGTTCCCCGGCTTAACAACAAACCCGGCTTAATCGGAATGGATGATTGGATGTTCCCCGTCCCTGAGCGTGGCGAC	NA	NA	NA	NA
>prophage 2
NZ_CP011965	Bifidobacterium longum subsp. longum strain CCUG30698 chromosome, complete genome	2458004	434253	473983	2458004	transposase	Staphylococcus_phage(25.0%)	27	NA	NA
WP_008783747.1|434253_435525_-|transposase	IS30-like element ISBlo4 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	3.5e-40
WP_007055690.1|436166_437516_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_081040251.1|437801_438698_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_162010164.1|438715_439708_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_058060685.1|439894_442027_+	beta-galactosidase	NA	NA	NA	NA	NA
WP_008782891.1|442070_443126_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_058060686.1|443321_446015_+	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_010081186.1|446650_447520_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_058060687.1|447523_448267_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_015512406.1|448270_449641_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_080825724.1|449930_451298_+	Mn(2+) uptake NRAMP transporter MntH	NA	NA	NA	NA	NA
WP_058061120.1|451396_452986_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_007055716.1|453570_455136_+	DUF4012 domain-containing protein	NA	NA	NA	NA	NA
WP_058060688.1|456289_457792_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_007057038.1|457788_458574_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	39.2	6.7e-34
WP_148639063.1|458736_459174_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_050495931.1|459121_459796_-|transposase	DDE transposase	transposase	NA	NA	NA	NA
WP_080574323.1|462706_463132_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_117651171.1|464237_465785_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_058060690.1|465781_466543_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	38.3	6.9e-36
WP_007055288.1|467438_467801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007055293.1|467810_468020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007055289.1|468230_468665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007055290.1|468942_469503_-	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
WP_007055292.1|469731_469923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007055772.1|470777_472535_-	DUF4012 domain-containing protein	NA	NA	NA	NA	NA
WP_032682413.1|473449_473983_+|transposase	transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	53.5	2.0e-34
>prophage 3
NZ_CP011965	Bifidobacterium longum subsp. longum strain CCUG30698 chromosome, complete genome	2458004	1330689	1375601	2458004	tRNA,integrase,holin,portal,tail,coat,terminase	Bifidobacterium_phage(45.0%)	60	1325405:1325422	1365250:1365267
1325405:1325422	attL	ACGCCGCCGGCCTGACCA	NA	NA	NA	NA
WP_007054284.1|1330689_1332723_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	36.1	6.3e-108
WP_058060909.1|1333542_1334376_+	PAC2 family protein	NA	NA	NA	NA	NA
WP_007055147.1|1334590_1335475_-	undecaprenyl-diphosphatase UppP	NA	NA	NA	NA	NA
WP_058060910.1|1335619_1336411_+	phosphotransferase	NA	NA	NA	NA	NA
WP_007055127.1|1336533_1337709_-|integrase	site-specific integrase	integrase	A0A0E3XBN7	Gordonia_phage	38.5	2.6e-58
WP_007052846.1|1337846_1338026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007058648.1|1338102_1338561_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_053495711.1|1338685_1339465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050388393.1|1339474_1339798_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_032741621.1|1339854_1340202_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_058060911.1|1340291_1340561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049136816.1|1340792_1341125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058060912.1|1341199_1341979_+	phage antirepressor KilAC domain-containing protein	NA	A0A0A8WIG2	Clostridium_phage	49.3	1.0e-50
WP_058060913.1|1341978_1342218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058060914.1|1342323_1342722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058060915.1|1342718_1342982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023658371.1|1342965_1343439_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1B1IWV6	uncultured_Mediterranean_phage	37.1	1.2e-09
WP_058060916.1|1343435_1343765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077384384.1|1343757_1343940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058060917.1|1343926_1344319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058060918.1|1344315_1344714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058060919.1|1344700_1345711_+	hypothetical protein	NA	A0A221J769	Mycobacterium_phage	32.2	5.8e-22
WP_058061140.1|1345727_1346636_+	hypothetical protein	NA	A0A0M5M7K2	Mycobacterium_phage	37.6	6.2e-15
WP_058060920.1|1346904_1349199_+	AAA family ATPase	NA	A7IYC5	Corynebacterium_phage	30.5	5.3e-31
WP_007057112.1|1349405_1349777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058060921.1|1349773_1349998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007058831.1|1350001_1350196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007057067.1|1350176_1350419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032742459.1|1350541_1350922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058060922.1|1350945_1351722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016462988.1|1351776_1351980_-	hypothetical protein	NA	I3NLB0	Bifidobacterium_phage	93.8	1.1e-28
WP_058060923.1|1353029_1353566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015713624.1|1353558_1354683_+	hypothetical protein	NA	A0A1C9EHW4	Gordonia_phage	54.5	1.0e-107
WP_007056596.1|1354669_1355326_+|terminase	terminase	terminase	A0A1C9EHV3	Gordonia_phage	55.1	3.8e-59
WP_058060924.1|1355325_1356819_+|portal	phage portal protein	portal	D7NW49	Streptomyces_phage	31.7	3.0e-59
WP_058060925.1|1356760_1357921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058060926.1|1357944_1358559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058060927.1|1358575_1359433_+|coat	coat protein	coat	A0A1L2JY55	Aeribacillus_phage	49.6	1.7e-62
WP_058060928.1|1359498_1360083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058060929.1|1360079_1360502_+	hypothetical protein	NA	I3NL96	Bifidobacterium_phage	85.2	2.4e-38
WP_081040309.1|1360503_1360893_+	hypothetical protein	NA	I3NL95	Bifidobacterium_phage	62.3	2.7e-36
WP_058060931.1|1360889_1361306_+	hypothetical protein	NA	I3NL94	Bifidobacterium_phage	62.3	2.1e-42
WP_015713633.1|1361345_1361873_+	hypothetical protein	NA	I3NL93	Bifidobacterium_phage	87.4	3.1e-83
WP_015713634.1|1361972_1362467_+	hypothetical protein	NA	I3NL92	Bifidobacterium_phage	70.6	1.3e-56
WP_058060932.1|1362538_1362835_+	hypothetical protein	NA	I3NL91	Bifidobacterium_phage	68.4	7.8e-36
WP_058060933.1|1362854_1366196_+|tail	phage tail tape measure protein	tail	I3NL90	Bifidobacterium_phage	54.9	1.4e-253
1365250:1365267	attR	ACGCCGCCGGCCTGACCA	NA	NA	NA	NA
WP_058060934.1|1366192_1367029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032737238.1|1367019_1368003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007056600.1|1368012_1368261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058061141.1|1368785_1369067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058060935.1|1369088_1369385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032737922.1|1369436_1369709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058060936.1|1369766_1370060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058060937.1|1371051_1371357_+	hypothetical protein	NA	I3NL84	Bifidobacterium_phage	63.8	7.6e-18
WP_058060938.1|1371507_1372374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058060939.1|1372376_1372922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058060940.1|1373077_1373587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058061142.1|1373765_1373984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058060941.1|1374102_1375212_+	glycoside hydrolase	NA	NA	NA	NA	NA
WP_058061143.1|1375343_1375601_+|holin	holin	holin	NA	NA	NA	NA
>prophage 4
NZ_CP011965	Bifidobacterium longum subsp. longum strain CCUG30698 chromosome, complete genome	2458004	2421524	2431470	2458004		Mycobacterium_phage(33.33%)	9	NA	NA
WP_007051809.1|2421524_2422652_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.8	2.9e-22
WP_058061103.1|2423010_2424207_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_007051806.1|2424270_2425263_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	77.9	1.2e-141
WP_058061104.1|2425573_2427769_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	47.3	1.4e-185
WP_007056564.1|2427884_2428343_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	31.7	8.8e-10
WP_007051803.1|2428339_2428606_-	glutaredoxin family protein	NA	V5R9U9	Mycobacterium_phage	41.8	3.9e-10
WP_007054640.1|2429193_2429844_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_007054641.1|2429827_2430508_-	DUF3990 domain-containing protein	NA	NA	NA	NA	NA
WP_022527161.1|2430702_2431470_+	ion transport family protein	NA	A0A2I7SA68	Vibrio_phage	27.2	6.4e-05
