The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013226	Salmonella enterica subsp. enterica serovar Anatum strain GT-38 chromosome, complete genome	4830607	85066	94237	4830607	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|85066_86014_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824854.1|85997_86729_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|86709_86817_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|86876_87608_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_023243038.1|87830_89516_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.9e-278
WP_000598637.1|89512_90232_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|90278_90746_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197951.1|90802_91333_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|91504_91963_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|92203_94237_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 2
NZ_CP013226	Salmonella enterica subsp. enterica serovar Anatum strain GT-38 chromosome, complete genome	4830607	162332	168629	4830607		Enterobacteria_phage(50.0%)	6	NA	NA
WP_023244537.1|162332_163736_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981469.1|163913_164807_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|165183_166269_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023662.1|166268_167168_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_023243995.1|167215_168094_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	2.3e-107
WP_001100808.1|168098_168629_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.1	4.8e-52
>prophage 3
NZ_CP013226	Salmonella enterica subsp. enterica serovar Anatum strain GT-38 chromosome, complete genome	4830607	274674	286042	4830607	integrase	Stenotrophomonas_phage(25.0%)	12	260562:260577	276099:276114
260562:260577	attL	TGGCTCCTCTGACTGG	NA	NA	NA	NA
WP_023244267.1|274674_275937_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.3	1.5e-75
WP_023243861.1|276582_276873_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	49.1	1.8e-08
276099:276114	attR	TGGCTCCTCTGACTGG	NA	NA	NA	NA
WP_000598920.1|277244_278042_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000500830.1|278522_278684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023243860.1|278810_279230_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457663.1|279232_280501_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.9	9.3e-227
WP_000208509.1|280955_281168_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131163.1|281178_281367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144441058.1|281626_282796_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.8	5.0e-110
WP_000107435.1|283451_283763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023243859.1|283842_284538_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_023243858.1|284611_286042_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 4
NZ_CP013226	Salmonella enterica subsp. enterica serovar Anatum strain GT-38 chromosome, complete genome	4830607	389294	397057	4830607	integrase	Enterobacteria_phage(28.57%)	12	391504:391526	403365:403387
WP_000856224.1|389294_389525_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|389662_390037_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_072101102.1|390037_390913_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|390929_391283_+	YebY family protein	NA	NA	NA	NA	NA
391504:391526	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_020438172.1|391654_392734_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.0	6.3e-99
WP_023244250.1|392730_393837_-	exodeoxyribonuclease 8	NA	Q9QF34	Lambdoid_phage	65.0	1.4e-53
WP_001013467.1|393867_394098_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_060588443.1|394151_394685_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	41.9	5.4e-11
WP_000789530.1|394941_395109_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|395173_395362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348541.1|395416_395908_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	7.1e-42
WP_023244117.1|396460_397057_+	hypothetical protein	NA	Q1MVL8	Enterobacteria_phage	43.1	7.8e-35
403365:403387	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 5
NZ_CP013226	Salmonella enterica subsp. enterica serovar Anatum strain GT-38 chromosome, complete genome	4830607	1010880	1082531	4830607	integrase,plate,tail,tRNA,head,holin	Salmonella_phage(66.0%)	93	1031518:1031534	1082050:1082066
WP_023893413.1|1010880_1011399_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_000272239.1|1011395_1011503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000460698.1|1011708_1012155_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_000579793.1|1012134_1012929_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000205341.1|1013029_1014214_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_001222527.1|1014332_1014680_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_000487135.1|1014665_1014977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000673492.1|1015045_1015297_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001589065.1|1015492_1015591_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_000512149.1|1015729_1015978_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_001532438.1|1016291_1016933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000513733.1|1017162_1017345_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_001248993.1|1017347_1017710_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000457190.1|1017882_1018521_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_000617985.1|1018716_1019262_-	chorismate mutase	NA	NA	NA	NA	NA
WP_000908466.1|1019344_1019500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000208086.1|1019578_1019827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000190263.1|1020081_1020930_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001682351.1|1020998_1021592_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000175797.1|1021736_1022525_-	cryptic aminoglycoside nucleotidyltransferase ANT(3'')/ANT(9)	NA	NA	NA	NA	NA
WP_001537483.1|1022632_1023280_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001183699.1|1023476_1023803_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_001618317.1|1023996_1025130_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_000947459.1|1025211_1025802_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_000950212.1|1025795_1026593_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	2.8e-11
WP_000966637.1|1026586_1027399_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001748353.1|1027388_1028363_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000946091.1|1028362_1029997_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000182479.1|1030678_1030993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929973.1|1031141_1031672_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	70.5	2.8e-36
1031518:1031534	attL	CAGATAGCGCCCTAAAA	NA	NA	NA	NA
WP_021000256.1|1031754_1032798_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_001218120.1|1033136_1033604_-	Hsp20 family protein	NA	NA	NA	NA	NA
WP_000927827.1|1033756_1034029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000758947.1|1034228_1034354_-	lipoprotein	NA	NA	NA	NA	NA
WP_000977725.1|1034731_1035076_+	c-type lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000789471.1|1036297_1036855_-	virulence membrane protein PagC	NA	Q9LA63	Enterobacterial_phage	33.0	1.0e-15
WP_001535993.1|1037666_1037930_+	virulence protein PagD	NA	NA	NA	NA	NA
WP_001537306.1|1038061_1038274_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_001520581.1|1038688_1039210_+	ricin-type beta-trefoil lectin domain protein	NA	NA	NA	NA	NA
WP_000497451.1|1039400_1039640_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_001033398.1|1040129_1040918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021000253.1|1041806_1042931_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_012218897.1|1043378_1043591_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	2.5e-20
WP_000334550.1|1043844_1044516_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.3	1.8e-80
WP_023171144.1|1044508_1045777_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	96.0	7.3e-240
WP_023171145.1|1045779_1046199_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	59.1	3.8e-36
WP_077909836.1|1046535_1046748_-	hypothetical protein	NA	A0A1B0V844	Salmonella_phage	62.9	9.3e-07
WP_060619018.1|1046872_1048006_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	32.7	1.4e-35
WP_023171149.1|1048043_1048256_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	60.9	1.6e-11
WP_094445164.1|1048245_1048851_-|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	93.1	1.4e-100
WP_023244258.1|1048820_1050074_-	hypothetical protein	NA	A0A1S6KZZ0	Salmonella_phage	95.6	4.6e-178
WP_023171039.1|1050060_1050648_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	99.0	1.4e-113
WP_023215805.1|1050650_1051730_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.2	1.2e-203
WP_000605051.1|1051722_1052136_-	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	100.0	3.1e-75
WP_001273648.1|1052140_1052674_-|plate	phage baseplate assembly protein	plate	A0A192Y8K5	Salmonella_phage	100.0	8.4e-97
WP_001066631.1|1052673_1053732_-	hypothetical protein	NA	A0A192Y7L7	Salmonella_phage	99.7	6.6e-202
WP_023171041.1|1053728_1055069_-|tail	tail/DNA circulation protein	tail	A0A192Y5U9	Salmonella_phage	99.3	1.1e-249
WP_023171042.1|1055102_1057031_-|tail	phage tail tape measure protein	tail	A0A192Y6D8	Salmonella_phage	99.1	0.0e+00
WP_000588852.1|1057115_1057442_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515952.1|1057438_1057795_-|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007994.1|1057794_1059291_-|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	99.4	3.0e-277
WP_000497755.1|1059280_1059445_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	96.3	8.4e-24
WP_001241332.1|1059466_1060012_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	84.7	3.6e-87
WP_023171043.1|1060008_1060521_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	87.1	6.2e-81
WP_023171044.1|1060492_1060906_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	74.8	6.0e-50
WP_000886224.1|1060917_1061241_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	57.4	2.2e-31
WP_023171053.1|1061356_1061971_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.1	1.4e-108
WP_000250465.1|1061970_1062252_-|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	51.1	8.2e-19
WP_023171055.1|1062238_1062625_-	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	92.2	8.9e-56
WP_023171056.1|1062775_1063699_+	hypothetical protein	NA	A0A1B5FPA3	Escherichia_phage	56.4	1.6e-42
WP_023171057.1|1063805_1064636_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	43.3	5.0e-56
WP_024147207.1|1064666_1065656_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	98.8	1.5e-192
WP_023171059.1|1065663_1066524_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	98.6	2.7e-161
WP_023171060.1|1066540_1066930_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	97.7	7.1e-69
WP_023171061.1|1066926_1067820_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	93.9	8.7e-163
WP_023171062.1|1067819_1068302_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	98.8	1.6e-86
WP_000104924.1|1068303_1069263_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	80.9	1.6e-117
WP_000620702.1|1069259_1069484_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_023244168.1|1069480_1070623_-	antirepressor	NA	A0A1C9IHV9	Salmonella_phage	87.4	6.3e-182
WP_000509731.1|1070619_1071174_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|1071202_1071427_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020640.1|1071524_1072220_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	4.6e-127
WP_000997190.1|1073034_1073406_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_023171064.1|1073463_1074291_+	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	98.5	4.1e-151
WP_000008351.1|1074427_1074967_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_023171066.1|1075768_1076242_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	78.8	2.1e-67
WP_000089141.1|1077002_1077239_+	excisionase	NA	NA	NA	NA	NA
WP_000741325.1|1077228_1078371_+|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	80.3	8.2e-174
WP_000444509.1|1078484_1079735_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	6.7e-20
WP_001249412.1|1079906_1080572_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000825957.1|1080568_1080898_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_023227248.1|1080909_1081371_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000004540.1|1081424_1082531_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
1082050:1082066	attR	TTTTAGGGCGCTATCTG	NA	NA	NA	NA
>prophage 6
NZ_CP013226	Salmonella enterica subsp. enterica serovar Anatum strain GT-38 chromosome, complete genome	4830607	1232342	1279500	4830607	protease,head,integrase,tail	Salmonella_phage(59.09%)	48	1231790:1231805	1250416:1250431
1231790:1231805	attL	TTATTGAAGCACGCAG	NA	NA	NA	NA
WP_000533596.1|1232342_1233362_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	53.5	1.2e-91
WP_000374046.1|1233949_1234609_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000904446.1|1234695_1235025_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_023243627.1|1235021_1235303_-	acylphosphatase	NA	NA	NA	NA	NA
WP_060588464.1|1235351_1236131_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000859416.1|1236156_1236705_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|1236919_1238131_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|1238188_1238506_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001537782.1|1238550_1238964_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847732.1|1239137_1239800_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|1239894_1240353_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_024155604.1|1240388_1242443_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
WP_023243628.1|1242566_1243013_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950869.1|1243031_1245185_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|1245171_1245777_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|1245993_1246503_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001670727.1|1246859_1247912_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|1247983_1248436_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156448.1|1248621_1250382_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|1250450_1250969_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
1250416:1250431	attR	CTGCGTGCTTCAATAA	NA	NA	NA	NA
WP_001537784.1|1251068_1251236_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|1251491_1252055_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433416.1|1252051_1253692_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|1253696_1254950_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|1254964_1256872_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086481.1|1256884_1258993_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224073.1|1259091_1260201_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|1260197_1260740_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|1260905_1261916_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_023242979.1|1262123_1264736_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000497440.1|1265162_1265369_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	100.0	1.8e-31
WP_065312638.1|1265575_1266706_-|tail	tail fiber domain-containing protein	tail	S4TSP4	Salmonella_phage	99.5	1.2e-201
WP_001113925.1|1266716_1267676_-	hypothetical protein	NA	H6WRW5	Salmonella_phage	100.0	9.6e-184
WP_001110473.1|1267684_1270405_-	DUF1983 domain-containing protein	NA	S4TTF5	Salmonella_phage	100.0	0.0e+00
WP_000682267.1|1270404_1270803_-	hypothetical protein	NA	S4TR39	Salmonella_phage	100.0	8.8e-75
WP_000967282.1|1270809_1271394_-	hypothetical protein	NA	S4TND4	Salmonella_phage	100.0	1.5e-107
WP_023216677.1|1271393_1271987_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	99.0	5.7e-110
WP_088730722.1|1272149_1272371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001552342.1|1272338_1272695_-	hypothetical protein	NA	S4TNM6	Salmonella_phage	100.0	1.1e-57
WP_053533436.1|1272740_1276031_-|tail	phage tail tape measure protein	tail	K7PKG1	Enterobacteria_phage	66.5	0.0e+00
WP_001805532.1|1276063_1276519_-	hypothetical protein	NA	A0A0S2SY43	Pseudomonas_phage	40.8	8.1e-08
WP_024134502.1|1276572_1276851_-	DUF4035 domain-containing protein	NA	S4TND7	Salmonella_phage	100.0	1.9e-44
WP_001129939.1|1276874_1277246_-|tail	phage tail protein	tail	S4TSQ0	Salmonella_phage	94.2	3.0e-61
WP_060588465.1|1277273_1277978_-	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	72.2	7.0e-91
WP_060588466.1|1278035_1278383_-	DUF3168 domain-containing protein	NA	S4TTG3	Salmonella_phage	78.3	1.7e-45
WP_000573486.1|1278379_1278829_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	95.3	2.1e-72
WP_020898872.1|1278825_1279164_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	70.5	6.6e-39
WP_001648719.1|1279173_1279500_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	85.2	5.2e-49
>prophage 7
NZ_CP013226	Salmonella enterica subsp. enterica serovar Anatum strain GT-38 chromosome, complete genome	4830607	1283813	1305443	4830607	terminase,integrase,holin	Salmonella_phage(75.86%)	31	1278507:1278521	1313258:1313272
1278507:1278521	attL	TCAACAAACCGCCAG	NA	NA	NA	NA
WP_000348541.1|1283813_1284305_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	7.1e-42
WP_001521334.1|1284359_1284548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|1284612_1284780_+	lytic enzyme	NA	NA	NA	NA	NA
WP_077946200.1|1285036_1286485_-	DUF2514 family protein	NA	A0A0U2C138	Paracoccus_phage	46.1	2.7e-113
WP_000919036.1|1286717_1287182_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.7	7.4e-49
WP_023137451.1|1287314_1287659_-	HNH endonuclease	NA	K7P7P6	Enterobacteria_phage	73.9	3.9e-47
WP_000495546.1|1287726_1288104_-	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	66.1	1.2e-41
WP_060619020.1|1288146_1288686_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	46.6	3.7e-07
WP_052920998.1|1288682_1289297_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.6	1.9e-108
WP_162491380.1|1289299_1289641_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	80.4	1.6e-45
WP_001047630.1|1290045_1290843_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	4.0e-151
WP_052920997.1|1290832_1290979_-	YlcG family protein	NA	H6WRZ0	Salmonella_phage	97.9	3.3e-19
WP_052920995.1|1290975_1291587_-	protein ninG	NA	A0A0M4RU10	Salmonella_phage	97.0	1.0e-90
WP_000929790.1|1291795_1292398_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_001217670.1|1292731_1292971_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
WP_000208070.1|1293490_1294300_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	100.0	4.5e-158
WP_060588467.1|1294296_1294749_-	ead/Ea22-like family protein	NA	S4TNP2	Salmonella_phage	99.3	8.5e-74
WP_000065341.1|1294745_1295147_-	ParB/RepB/Spo0J family partition protein	NA	S4TTI6	Salmonella_phage	100.0	2.9e-73
WP_000113621.1|1295143_1295491_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	98.3	1.5e-57
WP_000800012.1|1295501_1296251_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
WP_001669125.1|1296253_1297237_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	99.7	7.3e-163
WP_001538023.1|1297321_1297696_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	100.0	3.0e-64
WP_000869364.1|1297661_1297898_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
WP_001009038.1|1298027_1298432_+	transcriptional regulator	NA	H6WRX4	Salmonella_phage	100.0	4.2e-72
WP_000917564.1|1298830_1298989_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_001669126.1|1299010_1299361_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	100.0	7.5e-62
WP_052920986.1|1299487_1302415_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.9	0.0e+00
WP_001539618.1|1302377_1303535_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_001237031.1|1303577_1303817_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|1303857_1304106_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262307.1|1304150_1305443_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	100.0	3.4e-253
1313258:1313272	attR	CTGGCGGTTTGTTGA	NA	NA	NA	NA
>prophage 8
NZ_CP013226	Salmonella enterica subsp. enterica serovar Anatum strain GT-38 chromosome, complete genome	4830607	1397770	1406808	4830607	protease,integrase	Ralstonia_phage(16.67%)	7	1396163:1396175	1415305:1415317
1396163:1396175	attL	CTGTTTTACCTTA	NA	NA	NA	NA
WP_024155556.1|1397770_1399012_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	40.7	2.5e-75
WP_001117984.1|1400034_1400232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|1400444_1402721_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|1402751_1403072_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|1403395_1403617_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_060588471.1|1403746_1405693_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_023202044.1|1405689_1406808_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
1415305:1415317	attR	TAAGGTAAAACAG	NA	NA	NA	NA
>prophage 9
NZ_CP013226	Salmonella enterica subsp. enterica serovar Anatum strain GT-38 chromosome, complete genome	4830607	2750797	2795575	4830607	plate,tRNA,tail	Burkholderia_phage(40.91%)	47	NA	NA
WP_001182228.1|2750797_2751796_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_023242904.1|2751883_2753194_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|2753440_2753956_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|2754055_2754265_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|2754286_2754400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128113.1|2754396_2755722_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|2755900_2756509_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002900.1|2756617_2756986_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|2757156_2759577_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|2759675_2760548_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|2760561_2761059_-	chorismate lyase	NA	NA	NA	NA	NA
WP_001749156.1|2761239_2762157_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973681.1|2762320_2763679_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|2763767_2764877_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|2765238_2766429_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_023242906.1|2766560_2768105_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_020845801.1|2768119_2769010_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982752.1|2769175_2769586_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_060588497.1|2769728_2771825_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977959.1|2771824_2772562_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_122821798.1|2772558_2773227_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|2773260_2773503_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790028.1|2773946_2775596_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136394.1|2775940_2777290_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|2777420_2777768_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226440.1|2778343_2778631_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	5.1e-16
WP_001270438.1|2778633_2779239_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	60.4	6.5e-61
WP_000777266.1|2779251_2779566_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|2779725_2780181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023242908.1|2780177_2780375_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	6.6e-07
WP_023242909.1|2780364_2781792_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	71.2	8.1e-195
WP_000907495.1|2781791_2782316_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003640.1|2782367_2782685_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|2782644_2782773_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_023242910.1|2782869_2785224_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	3.1e-66
WP_023242911.1|2785223_2786177_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	51.5	7.9e-37
WP_001269716.1|2786176_2786386_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_023244444.1|2786373_2787417_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	4.2e-76
WP_000679393.1|2787426_2788149_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000593182.1|2788476_2788839_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703633.1|2788835_2789765_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	1.4e-150
WP_000632053.1|2789764_2791312_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	3.8e-49
WP_001093501.1|2791475_2791835_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001749150.1|2791825_2792941_+	bacteriophage protein	NA	Q6QI99	Burkholderia_phage	52.0	4.1e-101
WP_001749149.1|2792933_2793566_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	55.6	1.9e-23
WP_000368203.1|2793568_2795050_+|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	51.7	1.3e-51
WP_023244443.1|2795059_2795575_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	41.2	1.3e-33
>prophage 10
NZ_CP013226	Salmonella enterica subsp. enterica serovar Anatum strain GT-38 chromosome, complete genome	4830607	3796774	3832944	4830607	integrase,tail,head,portal,capsid,terminase,holin	Cronobacter_phage(70.27%)	44	3790840:3790860	3838839:3838859
3790840:3790860	attL	GATAAGCGCAGCGCCATCAGG	NA	NA	NA	NA
WP_023243707.1|3796774_3798340_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.9	5.8e-13
WP_095470797.1|3798336_3798984_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000213678.1|3799215_3799983_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_001145216.1|3800193_3801231_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	64.7	6.6e-122
WP_000568369.1|3801234_3801801_-	hypothetical protein	NA	Q4ZA70	Staphylococcus_virus	35.0	3.0e-20
WP_000102874.1|3801817_3802399_-	phage repressor protein CI	NA	F1BUS8	Erwinia_phage	39.8	2.5e-33
WP_001247709.1|3802534_3802756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460877.1|3802786_3803290_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_000643375.1|3803299_3803527_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_000996838.1|3803516_3803942_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	50.4	7.6e-24
WP_000022787.1|3803941_3804343_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.2	3.2e-48
WP_071601531.1|3804488_3804665_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000422609.1|3804655_3805252_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	72.3	3.8e-74
WP_000153510.1|3805248_3805578_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	44.0	2.5e-11
WP_000279405.1|3805567_3806428_+	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	82.7	1.3e-131
WP_000170880.1|3806424_3808446_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.8	9.4e-298
WP_000353141.1|3808565_3808772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001552031.1|3808745_3809069_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_000038207.1|3809065_3810127_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.1	5.1e-162
WP_001151944.1|3810123_3811899_-	hypothetical protein	NA	F1BUM5	Cronobacter_phage	83.1	2.2e-290
WP_000018798.1|3812059_3812860_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	54.8	3.2e-76
WP_000550496.1|3812921_3813944_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
WP_001218534.1|3813947_3814652_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	67.4	1.0e-86
WP_000398492.1|3814655_3814850_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	58.6	3.3e-11
WP_000447490.1|3814910_3815399_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	81.3	4.3e-63
WP_000084220.1|3815395_3815902_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.8	5.2e-64
WP_000560081.1|3815898_3816606_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.5	3.4e-101
WP_000220205.1|3816602_3817730_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.7	3.3e-175
WP_000166743.1|3817726_3818182_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_001154425.1|3818191_3818485_+|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000175560.1|3818481_3818823_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_000376374.1|3818822_3819155_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.0	2.0e-35
WP_000411340.1|3819301_3819559_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_000811089.1|3819746_3821717_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	67.4	1.6e-254
WP_001002797.1|3821713_3822043_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000136922.1|3822039_3823224_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.1	2.0e-178
WP_001001827.1|3823216_3823804_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	81.5	2.1e-88
WP_000083767.1|3823813_3825826_+|tail	tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
WP_001215677.1|3825828_3826359_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
WP_000267951.1|3826348_3827074_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	6.6e-68
WP_000200796.1|3827045_3827591_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	1.4e-59
WP_024132237.1|3827593_3829294_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	2.2e-223
WP_000237776.1|3830466_3830973_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001519776.1|3831096_3832944_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
3838839:3838859	attR	GATAAGCGCAGCGCCATCAGG	NA	NA	NA	NA
>prophage 1
NZ_CP013224	Salmonella enterica subsp. enterica serovar Anatum strain GT-38 plasmid PDM04, complete sequence	112176	18166	55696	112176	transposase,integrase	Enterobacteria_phage(21.43%)	35	51054:51067	58846:58859
WP_000487119.1|18166_19177_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.8	4.9e-21
WP_000079928.1|19569_19839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000969996.1|19835_20117_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001057996.1|20156_21005_+	3'-5' exonuclease	NA	K7RFY5	Vibrio_phage	40.1	3.5e-28
WP_000896475.1|21322_22972_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000344784.1|22974_23835_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001324342.1|23936_25460_+|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
WP_001163403.1|25449_26232_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
WP_000376623.1|26407_26908_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|27035_27875_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|27868_28216_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001137513.1|28433_29669_-|transposase	IS256-like element ISEc58 family transposase	transposase	A0A218MNI5	uncultured_virus	42.8	2.8e-42
WP_001137772.1|29936_31466_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|32011_32872_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|33054_33612_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001143760.1|33775_36781_+|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
WP_000535481.1|38302_38623_-	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	47.9	1.0e-17
WP_139324384.1|38829_39717_-	aminoglycoside N-acetyltransferase AAC(3)-VIa	NA	NA	NA	NA	NA
WP_001206316.1|39883_40675_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000845048.1|40823_41837_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|42039_42390_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|42515_43076_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_001138064.1|43078_46045_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_031610367.1|46053_46470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000627831.1|46953_47220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001442119.1|47219_47714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000517689.1|47769_48372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132019.1|48725_50072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001283356.1|50350_52231_+	colicin	NA	NA	NA	NA	NA
51054:51067	attL	AACAGGCCCGTCTG	NA	NA	NA	NA
WP_000762580.1|52248_52596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000142424.1|52714_53062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194561.1|53079_53670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000343102.1|53666_53927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000465034.1|54495_54909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001164192.1|54910_55696_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	96.5	4.0e-55
58846:58859	attR	AACAGGCCCGTCTG	NA	NA	NA	NA
