The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013222	Salmonella enterica subsp. enterica serovar Anatum strain GT-01 chromosome, complete genome	4879815	84990	94161	4879815	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|84990_85938_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824854.1|85921_86653_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|86633_86741_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|86800_87532_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_023243038.1|87754_89440_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.9e-278
WP_000598637.1|89436_90156_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|90202_90670_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197951.1|90726_91257_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|91428_91887_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|92127_94161_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 2
NZ_CP013222	Salmonella enterica subsp. enterica serovar Anatum strain GT-01 chromosome, complete genome	4879815	162143	168380	4879815		Enterobacteria_phage(50.0%)	6	NA	NA
WP_023244537.1|162143_163547_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981469.1|163724_164618_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|164994_166080_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023662.1|166079_166979_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_023243995.1|167026_167905_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	2.3e-107
WP_060588437.1|167909_168380_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	60.0	8.3e-48
>prophage 3
NZ_CP013222	Salmonella enterica subsp. enterica serovar Anatum strain GT-01 chromosome, complete genome	4879815	276634	284480	4879815		Morganella_phage(33.33%)	9	NA	NA
WP_023243860.1|276634_277054_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_077950107.1|278603_278729_+	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_000208509.1|279183_279396_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131163.1|279406_279595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080661.1|279854_281048_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.2	3.0e-110
WP_000107435.1|281438_281750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023243859.1|281829_282525_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_023243858.1|282598_284029_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000785978.1|284009_284480_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
>prophage 4
NZ_CP013222	Salmonella enterica subsp. enterica serovar Anatum strain GT-01 chromosome, complete genome	4879815	387245	395008	4879815	integrase	Enterobacteria_phage(28.57%)	12	389459:389477	401051:401069
WP_000856224.1|387245_387476_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|387613_387988_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_072101102.1|387988_388864_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|388880_389234_+	YebY family protein	NA	NA	NA	NA	NA
389459:389477	attL	TCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_020438172.1|389605_390685_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.0	6.3e-99
WP_023244250.1|390681_391788_-	exodeoxyribonuclease 8	NA	Q9QF34	Lambdoid_phage	65.0	1.4e-53
WP_001013467.1|391818_392049_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_060588443.1|392102_392636_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	41.9	5.4e-11
WP_000789530.1|392892_393060_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|393124_393313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348541.1|393367_393859_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	7.1e-42
WP_023244117.1|394411_395008_+	hypothetical protein	NA	Q1MVL8	Enterobacteria_phage	43.1	7.8e-35
401051:401069	attR	TCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 5
NZ_CP013222	Salmonella enterica subsp. enterica serovar Anatum strain GT-01 chromosome, complete genome	4879815	1052542	1070921	4879815	holin,integrase	Salmonella_phage(68.18%)	23	1058499:1058513	1076692:1076706
WP_023171053.1|1052542_1053157_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.1	1.4e-108
WP_000250465.1|1053156_1053438_-|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	51.1	8.2e-19
WP_023171055.1|1053424_1053811_-	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	92.2	8.9e-56
WP_023171056.1|1053961_1054885_+	hypothetical protein	NA	A0A1B5FPA3	Escherichia_phage	56.4	1.6e-42
WP_023171057.1|1054991_1055822_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	43.3	5.0e-56
WP_024147207.1|1055852_1056842_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	98.8	1.5e-192
WP_023171059.1|1056849_1057710_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	98.6	2.7e-161
WP_023171060.1|1057726_1058116_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	97.7	7.1e-69
WP_023171061.1|1058112_1059006_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	93.9	8.7e-163
1058499:1058513	attL	CAAAGAAAGCACCAG	NA	NA	NA	NA
WP_023171062.1|1059005_1059488_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	98.8	1.6e-86
WP_000104924.1|1059489_1060449_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	80.9	1.6e-117
WP_000620702.1|1060445_1060670_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_023244168.1|1060666_1061809_-	antirepressor	NA	A0A1C9IHV9	Salmonella_phage	87.4	6.3e-182
WP_000509731.1|1061805_1062360_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|1062388_1062613_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020640.1|1062710_1063406_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	4.6e-127
WP_000997190.1|1064220_1064592_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_023171064.1|1064649_1065477_+	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	98.5	4.1e-151
WP_000008351.1|1065613_1066153_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_023171066.1|1066954_1067428_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	78.8	2.1e-67
WP_000089141.1|1068188_1068425_+	excisionase	NA	NA	NA	NA	NA
WP_000741325.1|1068414_1069557_+|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	80.3	8.2e-174
WP_000444509.1|1069670_1070921_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	6.7e-20
1076692:1076706	attR	CTGGTGCTTTCTTTG	NA	NA	NA	NA
>prophage 6
NZ_CP013222	Salmonella enterica subsp. enterica serovar Anatum strain GT-01 chromosome, complete genome	4879815	1217803	1257960	4879815	integrase,lysis,tail,capsid,protease	Salmonella_phage(60.0%)	54	1241421:1241434	1260653:1260666
WP_000938188.1|1217803_1218484_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	72.4	1.6e-84
WP_000421108.1|1218635_1219154_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	53.8	2.0e-47
WP_001670454.1|1219168_1220701_-	hypothetical protein	NA	S4TP62	Salmonella_phage	66.2	1.4e-128
WP_000049939.1|1220700_1221381_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	96.0	5.5e-125
WP_001197089.1|1221377_1222577_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	96.7	5.5e-213
WP_001270641.1|1222577_1222931_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	95.7	3.0e-58
WP_060588463.1|1222930_1223686_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	69.5	1.4e-89
WP_000931859.1|1223804_1224260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000819157.1|1224343_1224676_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	69.1	1.7e-23
WP_000081749.1|1224672_1225740_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	91.5	2.0e-174
WP_000155111.1|1225742_1226045_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	100.0	4.2e-53
WP_000353826.1|1226044_1226620_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	100.0	2.4e-97
WP_000990866.1|1226619_1228629_-	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	95.2	0.0e+00
WP_000389049.1|1228806_1229259_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	78.7	1.3e-61
WP_000535992.1|1229262_1229706_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.5	1.0e-55
WP_001135539.1|1229718_1230864_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	75.3	1.2e-164
WP_001670724.1|1230867_1231431_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	78.7	2.1e-82
WP_001121925.1|1231405_1231795_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	2.1e-68
WP_000008738.1|1231781_1232336_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	99.5	1.4e-94
WP_001125672.1|1232332_1232740_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	96.3	3.0e-70
WP_001040693.1|1232705_1233095_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	62.0	4.0e-32
WP_000627463.1|1233136_1234078_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	99.7	3.1e-179
WP_000128057.1|1234089_1234587_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
WP_000873181.1|1234591_1235824_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	99.3	3.7e-228
WP_137911068.1|1235827_1236574_-|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	91.2	3.1e-97
WP_000113503.1|1236458_1237928_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.3e-280
WP_001130808.1|1237927_1239550_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	99.4	0.0e+00
WP_001118126.1|1239552_1240182_-	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	98.1	1.5e-108
WP_086374239.1|1240682_1241138_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	76.8	1.3e-53
1241421:1241434	attL	GTCATTTTTTGGTG	NA	NA	NA	NA
WP_000951228.1|1241455_1241995_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	74.1	4.0e-78
WP_001525456.1|1241972_1242275_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000658037.1|1242477_1242666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000640103.1|1243058_1243637_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	52.0	2.4e-44
WP_000717784.1|1243633_1243927_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	65.3	2.1e-33
WP_000090037.1|1243923_1244520_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	73.7	1.5e-81
WP_000474096.1|1244588_1244780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001129735.1|1244963_1245302_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	86.6	3.7e-50
WP_000180135.1|1245301_1245472_-	hypothetical protein	NA	I6S1S6	Salmonella_phage	87.5	6.3e-06
WP_001037052.1|1245468_1246071_-	adenine methylase	NA	G9L699	Escherichia_phage	87.3	1.7e-98
WP_000918617.1|1246063_1246312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000130738.1|1246315_1246996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000074839.1|1247033_1248422_-	DNA helicase	NA	Q76H51	Enterobacteria_phage	47.1	1.2e-105
WP_000063056.1|1248418_1249399_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	80.6	2.3e-44
WP_001195066.1|1249401_1249626_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	44.7	1.0e-08
WP_001643782.1|1249648_1250095_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	50.4	5.5e-25
WP_000467661.1|1250491_1250956_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	51.7	2.7e-35
WP_000387662.1|1251640_1251964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001192832.1|1251971_1252217_+	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	53.8	3.5e-13
WP_023223248.1|1252246_1254520_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.9	3.6e-104
WP_000205292.1|1254516_1255071_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	59.3	1.3e-47
WP_000916251.1|1255073_1255256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000196402.1|1255468_1255693_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533596.1|1255693_1256713_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	53.5	1.2e-91
WP_000374046.1|1257300_1257960_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
1260653:1260666	attR	GTCATTTTTTGGTG	NA	NA	NA	NA
>prophage 7
NZ_CP013222	Salmonella enterica subsp. enterica serovar Anatum strain GT-01 chromosome, complete genome	4879815	1271972	1323127	4879815	holin,integrase,tail,head,terminase,protease	Salmonella_phage(73.91%)	57	1288194:1288208	1323162:1323176
WP_000156448.1|1271972_1273733_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|1273801_1274320_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|1274419_1274587_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|1274842_1275406_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433416.1|1275402_1277043_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|1277047_1278301_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|1278315_1280223_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086481.1|1280235_1282344_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224073.1|1282442_1283552_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|1283548_1284091_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|1284256_1285267_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_023242979.1|1285474_1288087_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
1288194:1288208	attL	GCTACATTTTTATAA	NA	NA	NA	NA
WP_000497440.1|1288513_1288720_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	100.0	1.8e-31
WP_065312638.1|1288926_1290057_-|tail	tail fiber domain-containing protein	tail	S4TSP4	Salmonella_phage	99.5	1.2e-201
WP_001113925.1|1290067_1291027_-	hypothetical protein	NA	H6WRW5	Salmonella_phage	100.0	9.6e-184
WP_001110473.1|1291035_1293756_-	DUF1983 domain-containing protein	NA	S4TTF5	Salmonella_phage	100.0	0.0e+00
WP_000682267.1|1293755_1294154_-	hypothetical protein	NA	S4TR39	Salmonella_phage	100.0	8.8e-75
WP_000967282.1|1294160_1294745_-	hypothetical protein	NA	S4TND4	Salmonella_phage	100.0	1.5e-107
WP_023216677.1|1294744_1295338_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	99.0	5.7e-110
WP_088730722.1|1295500_1295722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001552342.1|1295689_1296046_-	hypothetical protein	NA	S4TNM6	Salmonella_phage	100.0	1.1e-57
WP_053533436.1|1296091_1299382_-|tail	phage tail tape measure protein	tail	K7PKG1	Enterobacteria_phage	66.5	0.0e+00
WP_001805532.1|1299414_1299870_-	hypothetical protein	NA	A0A0S2SY43	Pseudomonas_phage	40.8	8.1e-08
WP_024134502.1|1299923_1300202_-	DUF4035 domain-containing protein	NA	S4TND7	Salmonella_phage	100.0	1.9e-44
WP_001129939.1|1300225_1300597_-|tail	phage tail protein	tail	S4TSQ0	Salmonella_phage	94.2	3.0e-61
WP_060588465.1|1300624_1301329_-	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	72.2	7.0e-91
WP_060588466.1|1301386_1301734_-	DUF3168 domain-containing protein	NA	S4TTG3	Salmonella_phage	78.3	1.7e-45
WP_000573486.1|1301730_1302180_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	95.3	2.1e-72
WP_020898872.1|1302176_1302515_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	70.5	6.6e-39
WP_001648719.1|1302524_1302851_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	85.2	5.2e-49
WP_000919036.1|1304401_1304866_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.7	7.4e-49
WP_023137451.1|1304998_1305343_-	HNH endonuclease	NA	K7P7P6	Enterobacteria_phage	73.9	3.9e-47
WP_000495546.1|1305410_1305788_-	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	66.1	1.2e-41
WP_001050802.1|1305830_1306370_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	46.6	3.7e-07
WP_052920998.1|1306366_1306981_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.6	1.9e-108
WP_162491380.1|1306983_1307325_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	80.4	1.6e-45
WP_001047630.1|1307729_1308527_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	4.0e-151
WP_052920997.1|1308516_1308663_-	YlcG family protein	NA	H6WRZ0	Salmonella_phage	97.9	3.3e-19
WP_052920995.1|1308659_1309271_-	protein ninG	NA	A0A0M4RU10	Salmonella_phage	97.0	1.0e-90
WP_000929790.1|1309479_1310082_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_001217670.1|1310415_1310655_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
WP_000208070.1|1311174_1311984_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	100.0	4.5e-158
WP_060588467.1|1311980_1312433_-	ead/Ea22-like family protein	NA	S4TNP2	Salmonella_phage	99.3	8.5e-74
WP_000065341.1|1312429_1312831_-	ParB/RepB/Spo0J family partition protein	NA	S4TTI6	Salmonella_phage	100.0	2.9e-73
WP_000113621.1|1312827_1313175_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	98.3	1.5e-57
WP_000800012.1|1313185_1313935_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
WP_001669125.1|1313937_1314921_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	99.7	7.3e-163
WP_001538023.1|1315005_1315380_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	100.0	3.0e-64
WP_000869364.1|1315345_1315582_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
WP_001009038.1|1315711_1316116_+	transcriptional regulator	NA	H6WRX4	Salmonella_phage	100.0	4.2e-72
WP_000917564.1|1316514_1316673_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_001669126.1|1316694_1317045_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	100.0	7.5e-62
WP_052920986.1|1317171_1320099_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.9	0.0e+00
WP_001539618.1|1320061_1321219_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_001237031.1|1321261_1321501_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|1321541_1321790_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262307.1|1321834_1323127_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	100.0	3.4e-253
1323162:1323176	attR	GCTACATTTTTATAA	NA	NA	NA	NA
>prophage 8
NZ_CP013222	Salmonella enterica subsp. enterica serovar Anatum strain GT-01 chromosome, complete genome	4879815	1413447	1422515	4879815	integrase,protease	Ralstonia_phage(16.67%)	8	1411840:1411852	1431012:1431024
1411840:1411852	attL	CTGTTTTACCTTA	NA	NA	NA	NA
WP_024155556.1|1413447_1414689_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	40.7	2.5e-75
WP_023243338.1|1415215_1415593_+|integrase	phage integrase	integrase	NA	NA	NA	NA
WP_001117984.1|1415741_1415939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|1416151_1418428_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|1418458_1418779_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|1419102_1419324_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_060588471.1|1419453_1421400_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_023202044.1|1421396_1422515_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
1431012:1431024	attR	TAAGGTAAAACAG	NA	NA	NA	NA
>prophage 9
NZ_CP013222	Salmonella enterica subsp. enterica serovar Anatum strain GT-01 chromosome, complete genome	4879815	2742754	2787531	4879815	plate,tRNA,tail	Burkholderia_phage(40.91%)	47	NA	NA
WP_001182228.1|2742754_2743753_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_023242904.1|2743840_2745151_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|2745397_2745913_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|2746012_2746222_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|2746243_2746357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128113.1|2746353_2747679_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|2747857_2748466_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002900.1|2748574_2748943_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|2749113_2751534_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|2751632_2752505_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|2752518_2753016_-	chorismate lyase	NA	NA	NA	NA	NA
WP_001749156.1|2753196_2754114_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973681.1|2754277_2755636_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|2755724_2756834_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|2757195_2758386_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_023242906.1|2758517_2760062_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_020845801.1|2760076_2760967_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982752.1|2761132_2761543_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_060588497.1|2761685_2763782_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977959.1|2763781_2764519_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_122821798.1|2764515_2765184_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|2765217_2765460_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790028.1|2765903_2767553_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136394.1|2767897_2769247_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|2769377_2769725_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226440.1|2770299_2770587_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	5.1e-16
WP_001270438.1|2770589_2771195_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	60.4	6.5e-61
WP_000777266.1|2771207_2771522_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|2771681_2772137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023242908.1|2772133_2772331_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	6.6e-07
WP_023242909.1|2772320_2773748_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	71.2	8.1e-195
WP_000907495.1|2773747_2774272_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003640.1|2774323_2774641_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|2774600_2774729_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_023242910.1|2774825_2777180_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	3.1e-66
WP_023242911.1|2777179_2778133_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	51.5	7.9e-37
WP_001269716.1|2778132_2778342_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_023244444.1|2778329_2779373_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	4.2e-76
WP_000679393.1|2779382_2780105_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000593182.1|2780432_2780795_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703633.1|2780791_2781721_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	1.4e-150
WP_000632053.1|2781720_2783268_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	3.8e-49
WP_001093501.1|2783431_2783791_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001749150.1|2783781_2784897_+	bacteriophage protein	NA	Q6QI99	Burkholderia_phage	52.0	4.1e-101
WP_001749149.1|2784889_2785522_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	55.6	1.9e-23
WP_000368203.1|2785524_2787006_+|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	51.7	1.3e-51
WP_023244443.1|2787015_2787531_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	41.2	1.3e-33
>prophage 10
NZ_CP013222	Salmonella enterica subsp. enterica serovar Anatum strain GT-01 chromosome, complete genome	4879815	3016453	3046245	4879815	integrase,tail,head,tRNA,terminase,capsid,portal	Cronobacter_phage(62.96%)	33	3022675:3022734	3046332:3046398
WP_001264394.1|3016453_3017467_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.8e-109
WP_001144069.1|3017694_3017910_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918865.1|3018145_3019891_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
WP_001519776.1|3020040_3021888_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000237776.1|3022011_3022518_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
3022675:3022734	attL	CTCATAATCGCTTGGTCGCTGGTTCAAGTCCAGCAGGGGCCACCAAATTTTAGCTTTAAA	NA	NA	NA	NA
WP_024132237.1|3023690_3025391_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	2.2e-223
WP_000200796.1|3025393_3025939_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	1.4e-59
WP_000267951.1|3025910_3026636_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	6.6e-68
WP_001215677.1|3026625_3027156_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
WP_000560081.1|3029832_3030540_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.5	3.4e-101
WP_000084220.1|3030536_3031043_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.8	5.2e-64
WP_000447490.1|3031039_3031528_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	81.3	4.3e-63
WP_000398492.1|3031588_3031783_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	58.6	3.3e-11
WP_001218534.1|3031786_3032491_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	67.4	1.0e-86
WP_000550496.1|3032494_3033517_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
WP_000018798.1|3033578_3034379_-|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	54.8	3.2e-76
WP_001151944.1|3034539_3036315_+	hypothetical protein	NA	F1BUM5	Cronobacter_phage	83.1	2.2e-290
WP_000038207.1|3036311_3037373_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.1	5.1e-162
WP_001552031.1|3037369_3037693_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_000353141.1|3037666_3037873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000170880.1|3037992_3040014_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.8	9.4e-298
WP_000279405.1|3040010_3040871_-	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	82.7	1.3e-131
WP_000153510.1|3040860_3041190_-	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	44.0	2.5e-11
WP_000422609.1|3041186_3041783_-	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	72.3	3.8e-74
WP_071601531.1|3041773_3041950_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000022787.1|3042095_3042497_-	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.2	3.2e-48
WP_000996838.1|3042496_3042922_-	hypothetical protein	NA	F1BUN5	Cronobacter_phage	50.4	7.6e-24
WP_000643375.1|3042911_3043139_-	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_000460877.1|3043148_3043652_-	hypothetical protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_001247709.1|3043682_3043904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102874.1|3044039_3044621_+	phage repressor protein CI	NA	F1BUS8	Erwinia_phage	39.8	2.5e-33
WP_000568369.1|3044637_3045204_+	hypothetical protein	NA	Q4ZA70	Staphylococcus_virus	35.0	3.0e-20
WP_001145216.1|3045207_3046245_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	64.7	6.6e-122
3046332:3046398	attR	CTCATAATCGCTTGGTCGCTGGTTCAAGTCCAGCAGGGGCCACCAAATTTTAGCTTTAAAATCATAT	NA	NA	NA	NA
>prophage 11
NZ_CP013222	Salmonella enterica subsp. enterica serovar Anatum strain GT-01 chromosome, complete genome	4879815	3899608	3935798	4879815	holin,integrase,tail,head,terminase,capsid,portal	Cronobacter_phage(70.27%)	44	3902895:3902954	3933098:3933164
WP_023243707.1|3899608_3901174_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.9	5.8e-13
WP_095470797.1|3901170_3901818_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000213678.1|3902049_3902817_+	siderophore-interacting protein	NA	NA	NA	NA	NA
3902895:3902954	attL	ATATGATTTTAAAGCTAAAATTTGGTGGCCCCTGCTGGACTTGAACCAGCGACCAAGCGA	NA	NA	NA	NA
WP_001145216.1|3903047_3904085_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	64.7	6.6e-122
WP_000568369.1|3904088_3904655_-	hypothetical protein	NA	Q4ZA70	Staphylococcus_virus	35.0	3.0e-20
WP_000102874.1|3904671_3905253_-	phage repressor protein CI	NA	F1BUS8	Erwinia_phage	39.8	2.5e-33
WP_001247709.1|3905388_3905610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460877.1|3905640_3906144_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_000643375.1|3906153_3906381_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_000996838.1|3906370_3906796_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	50.4	7.6e-24
WP_000022787.1|3906795_3907197_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.2	3.2e-48
WP_071601531.1|3907342_3907519_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000422609.1|3907509_3908106_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	72.3	3.8e-74
WP_000153510.1|3908102_3908432_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	44.0	2.5e-11
WP_000279405.1|3908421_3909282_+	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	82.7	1.3e-131
WP_000170880.1|3909278_3911300_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.8	9.4e-298
WP_000353141.1|3911419_3911626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001552031.1|3911599_3911923_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_000038207.1|3911919_3912981_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.1	5.1e-162
WP_001151944.1|3912977_3914753_-	hypothetical protein	NA	F1BUM5	Cronobacter_phage	83.1	2.2e-290
WP_000018798.1|3914913_3915714_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	54.8	3.2e-76
WP_000550496.1|3915775_3916798_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
WP_001218534.1|3916801_3917506_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	67.4	1.0e-86
WP_000398492.1|3917509_3917704_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	58.6	3.3e-11
WP_000447490.1|3917764_3918253_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	81.3	4.3e-63
WP_000084220.1|3918249_3918756_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.8	5.2e-64
WP_000560081.1|3918752_3919460_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.5	3.4e-101
WP_000220205.1|3919456_3920584_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.7	3.3e-175
WP_000166743.1|3920580_3921036_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_001154425.1|3921045_3921339_+|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000175560.1|3921335_3921677_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_000376374.1|3921676_3922009_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.0	2.0e-35
WP_000411340.1|3922155_3922413_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_000811089.1|3922600_3924571_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	67.4	1.6e-254
WP_001002797.1|3924567_3924897_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000136922.1|3924893_3926078_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.1	2.0e-178
WP_001001827.1|3926070_3926658_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	81.5	2.1e-88
WP_000083767.1|3926667_3928680_+|tail	tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
WP_001215677.1|3928682_3929213_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
WP_000267951.1|3929202_3929928_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	6.6e-68
WP_000200796.1|3929899_3930445_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	1.4e-59
WP_024132237.1|3930447_3932148_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	2.2e-223
WP_000237776.1|3933320_3933827_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
3933098:3933164	attR	ATATGATTTTAAAGCTAAAATTTGGTGGCCCCTGCTGGACTTGAACCAGCGACCAAGCGATTATGAG	NA	NA	NA	NA
WP_001519776.1|3933950_3935798_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
>prophage 12
NZ_CP013222	Salmonella enterica subsp. enterica serovar Anatum strain GT-01 chromosome, complete genome	4879815	4422048	4427852	4879815		Enterobacteria_phage(100.0%)	8	NA	NA
WP_021000674.1|4422048_4424382_-	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	84.5	0.0e+00
WP_000743150.1|4424396_4424717_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_060588513.1|4424740_4424941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023243884.1|4424937_4425489_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	71.3	8.6e-36
WP_001604627.1|4425485_4425752_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	70.5	1.7e-29
WP_039500098.1|4426289_4427027_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	63.6	3.2e-78
WP_000984211.1|4427023_4427269_+	transcriptional regulator	NA	Q7M294	Enterobacteria_phage	76.5	6.3e-31
WP_000210078.1|4427285_4427852_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.7	7.7e-56
>prophage 1
NZ_CP013221	Salmonella enterica subsp. enterica serovar Anatum strain GT-01 plasmid PDM02, complete sequence	112176	38748	82240	112176	integrase,transposase	Enterobacteria_phage(17.65%)	45	66107:66136	90931:90960
WP_000078704.1|38748_39687_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.4	3.6e-66
WP_001247862.1|39751_40018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000218863.1|40111_40546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000117611.1|41274_41775_-	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	27.3	2.4e-05
WP_000977997.1|42236_42833_-	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	55.3	3.4e-14
WP_001276270.1|42829_43549_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001387500.1|43545_43980_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001145485.1|44034_45993_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.4	7.3e-21
WP_000006020.1|46051_46285_-	DUF905 domain-containing protein	NA	A0A096XUX0	Cronobacter_phage	53.2	1.7e-06
WP_001276120.1|46342_46870_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.5	1.6e-47
WP_001434357.1|47253_47568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001027495.1|47638_47830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271705.1|47826_48249_-	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001198939.1|48295_48721_-	antirestriction protein	NA	NA	NA	NA	NA
WP_001668483.1|48693_49266_-	YubH family protein	NA	NA	NA	NA	NA
WP_000274500.1|49960_50395_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001104881.1|50408_50630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000086147.1|50630_51314_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.1e-29
WP_001348079.1|51698_52601_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000272884.1|53281_53674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217836.1|53677_54652_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	45.1	3.1e-73
WP_001394937.1|54890_55094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000312331.1|55264_55897_-	ParA family protein	NA	A0A0K1LMB9	Rhodobacter_phage	39.1	1.4e-29
WP_001164192.1|56480_57266_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	96.5	4.0e-55
WP_000465034.1|57267_57681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000343102.1|58249_58510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194561.1|58506_59097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000142424.1|59114_59462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000762580.1|59580_59928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001283356.1|59945_61826_-	colicin	NA	NA	NA	NA	NA
WP_001132019.1|62104_63451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000517689.1|63804_64407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001442119.1|64462_64957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031610367.1|65706_66123_-	hypothetical protein	NA	NA	NA	NA	NA
66107:66136	attL	CTCAGAAAACGGAAAATAAAGCACGCTAAG	NA	NA	NA	NA
WP_001138064.1|66131_69098_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000147567.1|69100_69661_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|69786_70137_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|70339_71353_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001206316.1|71501_72293_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_139324384.1|72459_73347_+	aminoglycoside N-acetyltransferase AAC(3)-VIa	NA	NA	NA	NA	NA
WP_000535481.1|73553_73874_+	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	47.9	1.0e-17
WP_001143760.1|75395_78401_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
WP_001235713.1|78564_79122_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|79304_80165_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001137772.1|80710_82240_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
90931:90960	attR	CTTAGCGTGCTTTATTTTCCGTTTTCTGAG	NA	NA	NA	NA
