The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013067	Aeromonas schubertii strain WL1483 chromosome, complete genome	4400034	33043	98619	4400034	tRNA,protease,transposase	Bacillus_phage(25.0%)	53	NA	NA
WP_060583260.1|33043_34084_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	41.8	6.3e-72
WP_144431304.1|34156_34945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144431437.1|34933_36138_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	70.5	3.5e-114
WP_144431305.1|36395_36836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060583269.1|38239_38746_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_060583270.1|38766_39201_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_082634732.1|39639_41847_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_050665360.1|41996_42212_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_060583272.1|42309_43743_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_050665362.1|43920_45165_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_060583275.1|45218_46493_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	25.6	2.4e-12
WP_060583277.1|46496_47204_-	two-component system response regulator RstA	NA	W8CYM9	Bacillus_phage	31.7	2.2e-28
WP_060583279.1|47273_48518_-	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_060583281.1|48520_49966_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_050665367.1|49962_50688_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.9	5.8e-32
WP_060583283.1|50899_52063_-	acetyl-CoA C-acyltransferase FadA	NA	NA	NA	NA	NA
WP_060583285.1|52084_54232_-	fatty acid oxidation complex subunit alpha FadB	NA	NA	NA	NA	NA
WP_060583287.1|54437_56378_-	acetoacetate--CoA ligase	NA	NA	NA	NA	NA
WP_050665371.1|56566_57889_+	Xaa-Pro dipeptidase	NA	NA	NA	NA	NA
WP_060583290.1|57885_58497_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.5	7.3e-20
WP_050665373.1|58528_59986_+	potassium transporter	NA	NA	NA	NA	NA
WP_050665374.1|59994_60519_+	menaquinone-dependent protoporphyrinogen IX dehydrogenase	NA	NA	NA	NA	NA
WP_060583292.1|66246_68814_-	bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_060583294.1|68964_70020_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_060583297.1|70016_71279_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_050665647.1|71347_72604_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_050665646.1|72640_72928_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_060583299.1|72942_73386_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_050665644.1|73620_74640_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.3	5.9e-22
WP_060588185.1|74938_75214_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_144431437.1|75234_76439_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	70.5	3.5e-114
WP_060583301.1|76854_77277_-	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_050665652.1|77421_77952_+	chorismate lyase	NA	NA	NA	NA	NA
WP_060583302.1|77948_78818_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_060583303.1|78854_79685_-|protease	rhomboid family intramembrane serine protease GlpG	protease	NA	NA	NA	NA
WP_060583305.1|79681_80005_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_060583306.1|80092_80794_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	1.2e-13
WP_060583308.1|80804_81581_-	ABC transporter ATP-binding protein	NA	A0A1M7XV31	Cedratvirus	25.7	1.3e-10
WP_060583310.1|81577_82846_-	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_050665636.1|82845_83772_-	high-affinity branched-chain amino acid ABC transporter permease LivH	NA	NA	NA	NA	NA
WP_050665635.1|83838_84960_-	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_060583312.1|85377_86382_+	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	33.2	1.2e-32
WP_060583314.1|86438_86966_-	cobalamin adenosyltransferase	NA	NA	NA	NA	NA
WP_158453510.1|87030_87933_-	DUF5610 domain-containg protein	NA	NA	NA	NA	NA
WP_060583316.1|88645_88909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162491591.1|89064_90159_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_060583320.1|90388_91597_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_082634733.1|91603_92293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060583321.1|92381_92759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060583324.1|92934_94149_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_060583326.1|94630_95578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144431307.1|97212_97497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060583260.1|97578_98619_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	41.8	6.3e-72
>prophage 2
NZ_CP013067	Aeromonas schubertii strain WL1483 chromosome, complete genome	4400034	638709	645729	4400034		uncultured_Mediterranean_phage(33.33%)	11	NA	NA
WP_060588208.1|638709_639456_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	56.5	3.7e-74
WP_060584074.1|639460_640078_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	47.0	2.1e-35
WP_050667357.1|640074_640656_+	DedA family protein	NA	NA	NA	NA	NA
WP_050667358.1|640665_641520_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	34.1	4.8e-09
WP_060584075.1|641560_642544_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.2	1.7e-34
WP_005351739.1|642760_643033_+	DNA-binding protein HU-alpha	NA	A0A249Y2G7	Serratia_phage	46.5	7.2e-12
WP_050667360.1|643140_643557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050667361.1|643608_644028_-	DUF4426 domain-containing protein	NA	NA	NA	NA	NA
WP_060584082.1|644056_644347_-	YggU family protein	NA	NA	NA	NA	NA
WP_050667363.1|644346_644898_-	YggT family protein	NA	NA	NA	NA	NA
WP_060584084.1|644907_645729_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	30.9	6.2e-22
>prophage 3
NZ_CP013067	Aeromonas schubertii strain WL1483 chromosome, complete genome	4400034	1046497	1055958	4400034	protease	Hokovirus(16.67%)	8	NA	NA
WP_060584552.1|1046497_1049257_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	34.7	1.5e-43
WP_060584554.1|1049258_1049723_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_050666073.1|1049897_1051151_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	52.7	7.3e-99
WP_050666074.1|1051268_1051718_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_060584560.1|1051717_1052827_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.2	1.7e-46
WP_060584562.1|1052828_1053476_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	37.0	2.7e-20
WP_060584564.1|1053548_1054658_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	40.3	2.7e-65
WP_082634765.1|1054710_1055958_-|protease	serine protease	protease	V5LS29	Emiliania_huxleyi_virus	27.6	1.5e-08
>prophage 4
NZ_CP013067	Aeromonas schubertii strain WL1483 chromosome, complete genome	4400034	2453412	2509501	4400034	transposase,bacteriocin,protease,tRNA	uncultured_Mediterranean_phage(10.53%)	53	NA	NA
WP_060586467.1|2453412_2454171_-|tRNA	tRNA hydroxylase	tRNA	NA	NA	NA	NA
WP_050665570.1|2454282_2455803_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	1.2e-90
WP_060586469.1|2455821_2456313_-|bacteriocin	bacteriocin production protein	bacteriocin	NA	NA	NA	NA
WP_050665568.1|2456502_2457798_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	49.9	4.0e-92
WP_060586471.1|2457948_2459286_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	41.7	4.7e-80
WP_050665566.1|2459293_2459905_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_060586472.1|2459950_2462473_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.9	6.6e-91
WP_005363787.1|2462591_2463083_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_050665564.1|2463234_2464350_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_144431376.1|2464390_2465410_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.1	1.5e-25
WP_144431377.1|2465337_2465976_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	57.2	2.3e-40
WP_050665562.1|2466161_2466362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050665561.1|2466448_2466649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060586473.1|2466701_2468141_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	28.5	1.2e-49
WP_060586475.1|2468240_2469110_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060586477.1|2469180_2469663_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_060586479.1|2469694_2470225_+	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	45.8	1.5e-24
WP_082634829.1|2470149_2470818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060588274.1|2472168_2472507_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_060583260.1|2472604_2473645_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	41.8	6.3e-72
WP_158453496.1|2473947_2474166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060586481.1|2474200_2475106_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	57.1	3.2e-96
WP_144431437.1|2475461_2476665_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	70.5	3.5e-114
WP_060586485.1|2476746_2477109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144431378.1|2477717_2478677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005354108.1|2479562_2480117_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_060586487.1|2480217_2482065_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_050665552.1|2482124_2482769_-	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_060586491.1|2482986_2483748_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005354121.1|2483744_2483933_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_060586494.1|2483937_2484903_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_050665549.1|2484902_2486657_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.9	3.9e-58
WP_060586496.1|2486688_2488902_-	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_060586498.1|2488990_2489488_+	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_050665547.1|2489557_2490085_+	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_050665546.1|2490203_2490860_+	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	50.7	3.7e-46
WP_060586500.1|2490989_2493098_+	TIGR01666 family membrane protein	NA	H9YQA8	environmental_Halophage	26.6	4.6e-05
WP_050665544.1|2493134_2493470_+	TusE/DsrC/DsvC family sulfur relay protein	NA	NA	NA	NA	NA
WP_060586502.1|2493514_2494252_-	cell division protein DedD	NA	NA	NA	NA	NA
WP_060586504.1|2494251_2495508_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_050665541.1|2495510_2496374_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_050665540.1|2496491_2497304_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_060586507.1|2497409_2499437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060586509.1|2499629_2500640_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_060586511.1|2500708_2501881_-	4-phosphoerythronate dehydrogenase	NA	A0A285PXZ1	Cedratvirus	31.3	2.2e-17
WP_060586513.1|2501975_2502686_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_050665535.1|2502785_2503736_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.8	3.7e-63
WP_060586515.1|2503792_2505034_+	response regulator	NA	A0A127AWB9	Bacillus_phage	34.3	1.2e-16
WP_060586517.1|2505115_2505826_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_050665532.1|2505818_2506535_+	arginyltransferase	NA	NA	NA	NA	NA
WP_005300033.1|2506603_2506822_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_060586519.1|2506876_2509132_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.4	1.9e-169
WP_050665530.1|2509183_2509501_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	46.9	5.3e-14
>prophage 5
NZ_CP013067	Aeromonas schubertii strain WL1483 chromosome, complete genome	4400034	2524300	2580206	4400034	integrase,protease,transposase	Planktothrix_phage(11.11%)	42	2518253:2518267	2552705:2552719
2518253:2518267	attL	TCAACACCCCGCTCA	NA	NA	NA	NA
WP_060586538.1|2524300_2524786_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_060586540.1|2524955_2525996_+	lipopolysaccharide heptosyltransferase family protein	NA	NA	NA	NA	NA
WP_060586542.1|2525992_2526883_-	DMT family transporter	NA	NA	NA	NA	NA
WP_060586545.1|2526998_2527580_+	electron transport complex subunit RsxA	NA	NA	NA	NA	NA
WP_050665513.1|2527584_2528142_+	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_082634831.1|2528144_2530442_+	electron transport complex subunit RsxC	NA	NA	NA	NA	NA
WP_082634832.1|2530441_2531503_+	electron transport complex subunit RsxD	NA	NA	NA	NA	NA
WP_060586551.1|2531499_2532135_+	electron transport complex subunit RsxG	NA	NA	NA	NA	NA
WP_050665509.1|2532137_2532839_+	electron transport complex subunit E	NA	NA	NA	NA	NA
WP_060586553.1|2532848_2533490_+	endonuclease III	NA	NA	NA	NA	NA
WP_060586555.1|2533493_2533907_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_060586558.1|2534012_2534324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060586563.1|2534323_2535109_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_060586564.1|2535169_2535880_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_005363598.1|2535911_2536730_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.9	1.5e-23
WP_060586565.1|2536756_2538406_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_060586566.1|2538423_2540661_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_060586567.1|2541274_2541919_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_060586569.1|2541918_2542929_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.7	6.0e-27
WP_144431472.1|2543737_2544628_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_060586571.1|2544648_2545464_-	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_060586574.1|2546708_2547515_+	UTRA domain-containing protein	NA	NA	NA	NA	NA
WP_082634833.1|2548226_2549435_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	32.2	3.9e-41
WP_082634834.1|2551308_2552862_-	EAL domain-containing protein	NA	NA	NA	NA	NA
2552705:2552719	attR	TCAACACCCCGCTCA	NA	NA	NA	NA
WP_162491594.1|2552912_2553767_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_082634836.1|2554001_2554277_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060584132.1|2554405_2555323_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	57.9	1.0e-97
WP_162491595.1|2556745_2557195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144431379.1|2559204_2560284_+|transposase	IS481-like element ISAs19 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	40.9	1.0e-72
WP_019706001.1|2560327_2561275_+|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
WP_060586586.1|2561837_2563040_-	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_060586587.1|2563032_2564862_-	aconitase	NA	NA	NA	NA	NA
WP_060588279.1|2564833_2566039_-	MFS transporter	NA	NA	NA	NA	NA
WP_060586589.1|2566045_2567863_-	siderophore synthetase	NA	NA	NA	NA	NA
WP_060586592.1|2567859_2569071_-	carboxylate--amine ligase	NA	NA	NA	NA	NA
WP_060586594.1|2569292_2571329_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_060586595.1|2571458_2573603_+	TonB-dependent siderophore receptor	NA	A0A0P0I887	Acinetobacter_phage	27.1	4.7e-05
WP_060586597.1|2573689_2574613_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_060586598.1|2574609_2575647_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_060586600.1|2575643_2576615_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_060586603.1|2576617_2577382_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.1	6.3e-13
WP_144431437.1|2579001_2580206_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	70.5	3.5e-114
>prophage 6
NZ_CP013067	Aeromonas schubertii strain WL1483 chromosome, complete genome	4400034	2588969	2639689	4400034	integrase,transposase	Shigella_phage(14.29%)	47	2626611:2626634	2640163:2640186
WP_060586635.1|2588969_2589932_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_144431380.1|2590082_2590826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060586642.1|2590954_2592250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144431475.1|2592272_2593477_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	69.8	5.0e-113
WP_060586646.1|2593552_2594896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060586647.1|2594953_2595994_+|transposase	IS481-like element ISAs19 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	42.5	1.3e-72
WP_060586648.1|2596019_2596616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060586650.1|2596789_2597707_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_060586652.1|2598314_2598767_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_060584132.1|2599352_2600270_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	57.9	1.0e-97
WP_060586657.1|2601417_2602782_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_060586659.1|2602830_2603508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144431476.1|2603566_2604304_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_060586663.1|2604497_2604905_+	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_050665998.1|2605000_2605591_+	transcriptional regulator UhpA	NA	NA	NA	NA	NA
WP_060586665.1|2605590_2607096_+	signal transduction histidine-protein kinase/phosphatase UhpB	NA	NA	NA	NA	NA
WP_060586667.1|2607095_2608418_+	MFS transporter	NA	NA	NA	NA	NA
WP_060586670.1|2608432_2609578_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_060586672.1|2609789_2610662_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_060586674.1|2610679_2611393_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_060586675.1|2611477_2613379_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.4	2.8e-62
WP_060586677.1|2613560_2614001_-	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_060586679.1|2614031_2614517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060586681.1|2614516_2617564_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_060586682.1|2617777_2618692_+	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_060586683.1|2618800_2620099_+	sphingomyelin phosphodiesterase	NA	A0A1P8L6H7	Staphylococcus_phage	33.5	1.5e-30
WP_082634839.1|2620095_2620857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060586684.1|2620996_2622103_+	alkene reductase	NA	NA	NA	NA	NA
WP_060586686.1|2622157_2623054_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060586689.1|2623160_2624225_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_060586691.1|2624221_2625217_+	DUF2955 domain-containing protein	NA	NA	NA	NA	NA
WP_060586694.1|2625297_2626473_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
2626611:2626634	attL	AGAAATGGAGGCGGCCCCACCAGC	NA	NA	NA	NA
WP_060586696.1|2626726_2627143_-	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_082634840.1|2627189_2627423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158453498.1|2628445_2628607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060583260.1|2628858_2629899_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	41.8	6.3e-72
WP_060586698.1|2630101_2631124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144431382.1|2631146_2631479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144431383.1|2631479_2631824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060586700.1|2632422_2634078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158453499.1|2634388_2634535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060586703.1|2635076_2635544_-	hypothetical protein	NA	L0AQZ0	Klebsiella_phage	38.9	2.8e-19
WP_060586705.1|2635574_2635820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082634841.1|2636023_2636674_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144431384.1|2636811_2637009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144431385.1|2637997_2638480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082634931.1|2638867_2639689_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
2640163:2640186	attR	AGAAATGGAGGCGGCCCCACCAGC	NA	NA	NA	NA
>prophage 7
NZ_CP013067	Aeromonas schubertii strain WL1483 chromosome, complete genome	4400034	2727172	2757254	4400034	capsid,transposase	Aeromonas_phage(82.35%)	21	NA	NA
WP_060583260.1|2727172_2728213_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	41.8	6.3e-72
WP_060586763.1|2729030_2734970_-	hypothetical protein	NA	A0A1I9KFG8	Aeromonas_phage	28.7	2.2e-28
WP_060586764.1|2735103_2736600_-	hypothetical protein	NA	A0A1I9KFD9	Aeromonas_phage	47.3	4.2e-93
WP_029301107.1|2736609_2736846_-	hypothetical protein	NA	A0A1I9KFI4	Aeromonas_phage	54.5	1.4e-08
WP_029301108.1|2736845_2737226_-	hypothetical protein	NA	A0A1I9KFD7	Aeromonas_phage	80.8	2.0e-47
WP_060586765.1|2737237_2737861_-	hypothetical protein	NA	A0A1I9KFE8	Aeromonas_phage	70.8	9.0e-74
WP_029301110.1|2737869_2738241_-	hypothetical protein	NA	A0A1I9KFI0	Aeromonas_phage	74.1	5.5e-47
WP_050490269.1|2738219_2738633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060586766.1|2738629_2740111_-	DUF1983 domain-containing protein	NA	A0A1I9KGC4	Aeromonas_phage	51.4	1.9e-45
WP_060586767.1|2740107_2741718_-	hypothetical protein	NA	A0A1I9KFD2	Aeromonas_phage	65.0	1.0e-209
WP_144431477.1|2741960_2743165_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	70.1	2.6e-114
WP_060586769.1|2743952_2744396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060586770.1|2744392_2745922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060586771.1|2745924_2746584_-	hypothetical protein	NA	A0A1I9KFD0	Aeromonas_phage	42.2	1.8e-40
WP_060586772.1|2746595_2747225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060586773.1|2747224_2747659_-	hypothetical protein	NA	A0A1I9KFH0	Aeromonas_phage	64.5	6.5e-31
WP_029301119.1|2747725_2748115_-	hypothetical protein	NA	A0A1I9KGB3	Aeromonas_phage	75.2	4.5e-47
WP_060586774.1|2748170_2749388_-|capsid	N4-gp56 family major capsid protein	capsid	A0A1I9KFC6	Aeromonas_phage	82.7	7.1e-200
WP_060586775.1|2749451_2750411_-	hypothetical protein	NA	A0A1I9KFD1	Aeromonas_phage	47.5	1.6e-58
WP_060586776.1|2750609_2752736_-	hypothetical protein	NA	A0A1I9KFF7	Aeromonas_phage	70.0	5.1e-262
WP_060586777.1|2755265_2757254_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	26.8	4.8e-20
>prophage 8
NZ_CP013067	Aeromonas schubertii strain WL1483 chromosome, complete genome	4400034	3755066	3822938	4400034	head,capsid,transposase,terminase,holin,integrase,tail,portal	Aeromonas_virus(87.5%)	84	3754951:3754997	3824596:3824642
3754951:3754997	attL	CCGGGGTCGGACTCGAACCGACACGGTTTTACCCGGCGGATTTTGAA	NA	NA	NA	NA
WP_060587421.1|3755066_3756119_-|integrase	site-specific integrase	integrase	A5X9F3	Aeromonas_virus	80.9	4.3e-161
WP_060587422.1|3756688_3757291_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_060587423.1|3757334_3758273_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_060587424.1|3758335_3759004_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	43.1	4.1e-40
WP_060587425.1|3759133_3759319_+	Cro/Cl family transcriptional regulator	NA	K7PHB1	Enterobacterial_phage	50.9	2.3e-09
WP_060587426.1|3759330_3759618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080891445.1|3759553_3760129_+	hypothetical protein	NA	A5X9F7	Aeromonas_virus	55.7	2.5e-38
WP_042067315.1|3760142_3760568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017412429.1|3760604_3760790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044801236.1|3760813_3761080_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_029300943.1|3761793_3762078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082634894.1|3762077_3764843_+	replication endonuclease	NA	A5X9G4	Aeromonas_virus	37.0	6.5e-124
WP_060587428.1|3764954_3765224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144431437.1|3765424_3766628_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	70.5	3.5e-114
WP_144431419.1|3766701_3766959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082634895.1|3767371_3767626_-	ogr/Delta-like zinc finger family protein	NA	A5X9H0	Aeromonas_virus	67.5	1.7e-26
WP_082634896.1|3767682_3768498_-|portal	phage portal protein	portal	A5X9H1	Aeromonas_virus	76.6	2.1e-115
WP_082634897.1|3768415_3770536_-|terminase	terminase	terminase	A5X9H3	Aeromonas_virus	67.5	1.1e-243
WP_082634898.1|3770713_3771631_+|capsid	capsid protein	capsid	A5X9H4	Aeromonas_virus	49.5	1.8e-70
WP_060587431.1|3771641_3772721_+|capsid	phage major capsid protein, P2 family	capsid	A5X9H5	Aeromonas_virus	69.3	3.6e-139
WP_060587432.1|3772723_3773449_+|terminase	terminase	terminase	A5X9H6	Aeromonas_virus	74.9	5.0e-100
WP_060588335.1|3773554_3774016_+|head	head completion/stabilization protein	head	A5X9H7	Aeromonas_virus	69.3	3.0e-50
WP_060587433.1|3774012_3774543_+	hypothetical protein	NA	A5X9H8	Aeromonas_virus	58.2	1.0e-54
WP_060587434.1|3774555_3775680_+	DUF2586 family protein	NA	A5X9I0	Aeromonas_virus	86.1	2.0e-185
WP_060587435.1|3775683_3776139_+	DUF2597 family protein	NA	A5X9I1	Aeromonas_virus	84.0	2.4e-68
WP_060587436.1|3776149_3776359_+	TraR/DksA family transcriptional regulator	NA	A5X9I2	Aeromonas_virus	85.5	2.5e-28
WP_060587437.1|3776382_3776709_+|holin	phage holin, lambda family	holin	A5X9I3	Aeromonas_virus	59.4	5.2e-25
WP_060587438.1|3776695_3777157_+	glycoside hydrolase family 104 protein	NA	A5X9I5	Aeromonas_virus	87.6	1.3e-77
WP_060587439.1|3777153_3777588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060587440.1|3777711_3777978_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	1.2e-22
WP_158453505.1|3778022_3778163_+	hypothetical protein	NA	A5X9I8	Aeromonas_virus	69.6	7.0e-11
WP_060587441.1|3778166_3780221_+|tail	phage tail tape measure protein	tail	A5X9I9	Aeromonas_virus	58.8	1.3e-201
WP_060587442.1|3780217_3780541_+	DUF2590 family protein	NA	A5X9J0	Aeromonas_virus	88.8	6.7e-49
WP_060587443.1|3780537_3781725_+	hypothetical protein	NA	A5X9J1	Aeromonas_virus	83.7	3.0e-187
WP_060587444.1|3781717_3782410_+	hypothetical protein	NA	A5X9J2	Aeromonas_virus	57.6	3.4e-50
WP_060587445.1|3782394_3783177_+	permease	NA	G0ZT38	Aeromonas_phage	77.9	4.8e-56
WP_060587446.1|3784030_3784249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060587447.1|3784245_3785127_+	hypothetical protein	NA	A5X9J6	Aeromonas_virus	74.0	4.2e-117
WP_060587448.1|3785123_3785675_+	hypothetical protein	NA	A5X9J7	Aeromonas_virus	73.2	5.7e-64
WP_060587449.1|3785671_3787285_+	hypothetical protein	NA	A5X9J8	Aeromonas_virus	84.5	1.2e-271
WP_060587450.1|3787295_3787994_+	phage virion morphogenesis protein	NA	NA	NA	NA	NA
WP_051773369.1|3788731_3789190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060587451.1|3789575_3790628_-|integrase	site-specific integrase	integrase	A5X9F3	Aeromonas_virus	84.6	3.4e-174
WP_060587452.1|3790608_3791460_-	hypothetical protein	NA	A5X9F4	Aeromonas_virus	82.1	5.5e-82
WP_060587453.1|3791469_3792186_-	LexA family transcriptional regulator	NA	A5X9F5	Aeromonas_virus	76.9	1.5e-104
WP_060587454.1|3792324_3792540_+	hypothetical protein	NA	A5X9F6	Aeromonas_virus	93.0	6.7e-29
WP_060587455.1|3792569_3793079_+	hypothetical protein	NA	A5X9F7	Aeromonas_virus	84.6	5.1e-75
WP_060587456.1|3793089_3793548_+	hypothetical protein	NA	A5X9F8	Aeromonas_virus	73.0	8.9e-55
WP_060587457.1|3793963_3794155_+	hypothetical protein	NA	A5X9G0	Aeromonas_virus	74.2	7.3e-19
WP_060587458.1|3794151_3794361_+	hypothetical protein	NA	A5X9G1	Aeromonas_virus	92.6	1.0e-26
WP_060587459.1|3794357_3794666_+	hypothetical protein	NA	A5X9G2	Aeromonas_virus	60.6	2.1e-31
WP_060587460.1|3794662_3794920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060587461.1|3794916_3797202_+	replication endonuclease	NA	A5X9G4	Aeromonas_virus	78.5	0.0e+00
WP_060587462.1|3797182_3797677_+	hypothetical protein	NA	A5X9G5	Aeromonas_virus	64.2	4.6e-49
WP_060587463.1|3797740_3798076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060587464.1|3798096_3798315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144431421.1|3798499_3799423_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_144431422.1|3799432_3799960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060587465.1|3800024_3801299_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	56.8	1.6e-130
WP_060587466.1|3801295_3801718_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	49.6	1.7e-31
WP_060587468.1|3802607_3802859_-	ogr/Delta-like zinc finger family protein	NA	A5X9H0	Aeromonas_virus	88.0	1.2e-37
WP_060587470.1|3802924_3803944_-|portal	phage portal protein	portal	A5X9H1	Aeromonas_virus	77.4	3.9e-151
WP_060587479.1|3805939_3806827_+|capsid	capsid protein	capsid	A5X9H4	Aeromonas_virus	56.2	9.8e-82
WP_060587481.1|3806839_3807904_+|capsid	phage major capsid protein, P2 family	capsid	A5X9H5	Aeromonas_virus	80.8	1.2e-158
WP_060587483.1|3807907_3808618_+|terminase	terminase	terminase	A5X9H6	Aeromonas_virus	69.0	2.3e-89
WP_060587485.1|3808728_3809190_+|head	head completion/stabilization protein	head	A5X9H7	Aeromonas_virus	65.6	2.9e-45
WP_060587488.1|3809186_3809690_+	hypothetical protein	NA	A5X9H8	Aeromonas_virus	62.6	7.3e-58
WP_060587491.1|3809686_3810370_+	virion morphogenesis protein	NA	A5X9H9	Aeromonas_virus	70.4	1.8e-83
WP_060587493.1|3810374_3811487_+	DUF2586 family protein	NA	A5X9I0	Aeromonas_virus	81.4	1.6e-174
WP_060587495.1|3811490_3811946_+	DUF2597 family protein	NA	A5X9I1	Aeromonas_virus	76.2	2.5e-65
WP_060587497.1|3811955_3812165_+	TraR/DksA family transcriptional regulator	NA	A5X9I2	Aeromonas_virus	76.8	3.5e-22
WP_060588336.1|3812189_3812513_+|holin	phage holin, lambda family	holin	A5X9I3	Aeromonas_virus	63.8	1.6e-26
WP_060587500.1|3812502_3812964_+	glycoside hydrolase family 104 protein	NA	G0ZT35	Aeromonas_phage	78.4	9.9e-70
WP_060587502.1|3812960_3813395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060587504.1|3813518_3813776_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	75.6	8.0e-29
WP_060587506.1|3813966_3815862_+|tail	phage tail tape measure protein	tail	A5X9I9	Aeromonas_virus	74.1	3.0e-253
WP_060587509.1|3815858_3816179_+	DUF2590 family protein	NA	A5X9J0	Aeromonas_virus	80.6	1.5e-40
WP_082634944.1|3816199_3817354_+	hypothetical protein	NA	A5X9J1	Aeromonas_virus	64.5	3.9e-139
WP_060587513.1|3817346_3818030_+	hypothetical protein	NA	A5X9J2	Aeromonas_virus	53.4	2.0e-42
WP_060587515.1|3818014_3818785_+	permease	NA	G0ZT38	Aeromonas_phage	77.2	1.7e-53
WP_060587520.1|3819671_3819899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082634945.1|3819964_3820771_+	hypothetical protein	NA	A5X9J6	Aeromonas_virus	46.5	5.1e-61
WP_060587525.1|3820767_3821328_+	hypothetical protein	NA	A5X9J7	Aeromonas_virus	73.0	5.2e-65
WP_060587528.1|3821324_3822938_+	hypothetical protein	NA	A5X9J8	Aeromonas_virus	71.3	1.0e-222
3824596:3824642	attR	CCGGGGTCGGACTCGAACCGACACGGTTTTACCCGGCGGATTTTGAA	NA	NA	NA	NA
>prophage 9
NZ_CP013067	Aeromonas schubertii strain WL1483 chromosome, complete genome	4400034	3902690	3914751	4400034	tRNA	Caulobacter_phage(33.33%)	8	NA	NA
WP_060587612.1|3902690_3904550_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.1	1.2e-36
WP_060587615.1|3904776_3906567_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	40.6	3.7e-72
WP_060587618.1|3906641_3907085_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	50.7	3.1e-28
WP_005350755.1|3907100_3907316_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_060587621.1|3907496_3908510_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	4.8e-109
WP_050667578.1|3909167_3909701_-	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	30.3	4.1e-19
WP_060587624.1|3909836_3911102_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_060587628.1|3911178_3914751_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	24.1	7.6e-16
>prophage 10
NZ_CP013067	Aeromonas schubertii strain WL1483 chromosome, complete genome	4400034	4114743	4185029	4400034	tRNA,holin,protease,transposase	Bacillus_phage(17.65%)	59	NA	NA
WP_060583260.1|4114743_4115784_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	41.8	6.3e-72
WP_082634908.1|4115834_4116368_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_144431427.1|4117645_4118062_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_144431428.1|4119390_4119999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060587877.1|4120945_4121842_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.4	4.2e-40
WP_060587878.1|4121988_4125696_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	80.3	3.3e-22
WP_050666978.1|4125864_4127142_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	39.8	2.2e-42
WP_050666977.1|4127199_4128009_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_050666987.1|4128005_4128563_-	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_060587881.1|4128686_4129355_+	GMP/IMP nucleotidase	NA	NA	NA	NA	NA
WP_060588345.1|4129391_4130003_-	LysE family translocator	NA	NA	NA	NA	NA
WP_060587882.1|4131237_4132143_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060587884.1|4132137_4133403_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1S6UA79	Serratia_phage	42.0	9.0e-81
WP_060587886.1|4133531_4134320_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060587888.1|4134363_4135122_-	type II secretion system protein N	NA	NA	NA	NA	NA
WP_050666970.1|4135118_4135610_-	type II secretion system protein M	NA	NA	NA	NA	NA
WP_060587890.1|4135606_4136782_-	GspL family type II secretion system protein ExeL	NA	NA	NA	NA	NA
WP_050666985.1|4136792_4137812_-	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_050666968.1|4137825_4138455_-	GspJ family T2SS minor pseudopilin variant ExeJ	NA	NA	NA	NA	NA
WP_082178010.1|4138451_4138811_-	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_060588346.1|4138807_4139350_-	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_050666967.1|4139407_4139839_-	GspG family T2SS major pseudopilin variant ExeG	NA	NA	NA	NA	NA
WP_060587892.1|4139989_4141210_-	GspF family T2SS innner membrane protein variant ExeF	NA	NA	NA	NA	NA
WP_060587894.1|4141211_4142717_-	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_060587896.1|4142713_4144753_-	GspD family T2SS secretin variant ExeD	NA	R9TEZ5	Vibrio_phage	34.7	1.2e-29
WP_162491607.1|4144775_4145606_-	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_060587900.1|4145847_4146246_+	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_060587902.1|4146298_4147180_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_060587904.1|4147328_4148954_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	51.0	2.1e-143
WP_060587906.1|4149011_4150322_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	25.6	3.1e-15
WP_050666958.1|4150318_4151038_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	2.8e-34
WP_060587909.1|4151686_4152163_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_060587912.1|4152179_4154495_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_060587914.1|4154545_4155154_-	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_050666954.1|4155222_4156200_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_060587916.1|4156253_4157687_-	cytochrome c oxidase accessory protein CcoG	NA	NA	NA	NA	NA
WP_050666952.1|4157846_4158110_-	YihD family protein	NA	NA	NA	NA	NA
WP_050666951.1|4158137_4159292_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_050666950.1|4159423_4159813_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_060587917.1|4159827_4162191_-	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.0	1.2e-107
WP_050666948.1|4162289_4162478_-|holin	holin	holin	NA	NA	NA	NA
WP_060587918.1|4162858_4164508_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_050666946.1|4164682_4164880_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	43.1	3.9e-07
WP_060587920.1|4164963_4165251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050666944.1|4165362_4165863_-	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_060587922.1|4165935_4166277_-	ligand-binding protein SH3	NA	NA	NA	NA	NA
WP_060584132.1|4167821_4168739_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	57.9	1.0e-97
WP_144431431.1|4169697_4170159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060587930.1|4170749_4172921_-	DNA helicase II	NA	A7KV33	Bacillus_phage	35.7	1.5e-112
WP_060587933.1|4172999_4174097_-	FUSC family protein	NA	NA	NA	NA	NA
WP_060587935.1|4174183_4176175_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	26.4	5.1e-30
WP_060587938.1|4176468_4177053_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060587941.1|4177049_4178093_+	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_060587944.1|4178094_4178658_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
WP_060587946.1|4178936_4180682_+|tRNA	arginine--tRNA ligase	tRNA	A0A1V0SIS8	Klosneuvirus	35.2	1.0e-82
WP_060587948.1|4180685_4181483_+	cell division protein	NA	NA	NA	NA	NA
WP_050667409.1|4181611_4182145_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_050667410.1|4182200_4183529_+	HslU--HslV peptidase ATPase subunit	NA	A0A173GFL6	Erwinia_phage	28.7	6.4e-45
WP_144431437.1|4183825_4185029_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	70.5	3.5e-114
>prophage 11
NZ_CP013067	Aeromonas schubertii strain WL1483 chromosome, complete genome	4400034	4199668	4223687	4400034	transposase,plate,tail,tRNA	Vibrio_phage(72.22%)	31	NA	NA
WP_050665414.1|4199668_4200982_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	26.5	8.9e-15
WP_050665401.1|4201026_4201500_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_060587963.1|4202776_4203520_-	transcriptional regulator	NA	A0A2I7S9A5	Vibrio_phage	62.7	3.5e-85
WP_060587966.1|4203688_4203919_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	75.3	3.5e-23
WP_060587969.1|4203923_4205909_+	DDE endonuclease	NA	A0A2I7S9A8	Vibrio_phage	60.7	2.7e-225
WP_060587970.1|4205932_4206175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060587971.1|4206248_4207181_+	AAA family ATPase	NA	A0A2I7S9C3	Vibrio_phage	64.2	1.7e-108
WP_060587973.1|4207184_4207379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060587975.1|4207375_4207582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043849593.1|4207600_4207924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005301788.1|4207938_4208547_+	DUF3164 family protein	NA	A0A2I7S9B0	Vibrio_phage	58.0	2.1e-59
WP_060587977.1|4208555_4209062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060588347.1|4209051_4209333_+	hypothetical protein	NA	M1PJ71	Vibrio_phage	55.2	2.6e-20
WP_060587979.1|4209325_4209568_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060587980.1|4209567_4210032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060587982.1|4210139_4210352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060587985.1|4210462_4210717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060587987.1|4210936_4211182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060587988.1|4211174_4211678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060587991.1|4211667_4212300_+	regulatory protein GemA	NA	A0A2I7S9B8	Vibrio_phage	47.8	6.4e-35
WP_060587995.1|4213110_4215078_+	hypothetical protein	NA	A0A2P9JZK0	Alteromonadaceae_phage	39.3	4.4e-82
WP_060587998.1|4215089_4216496_+	multidrug DMT transporter permease	NA	A0A2I7S9E8	Vibrio_phage	47.9	2.7e-110
WP_060588001.1|4216488_4217568_+|tail	phage tail protein	tail	M1PVV2	Vibrio_phage	49.3	9.7e-92
WP_060588003.1|4217561_4218116_+|plate	phage baseplate assembly protein	plate	M4MCP6	Vibrio_phage	48.8	1.1e-38
WP_060588006.1|4218122_4218575_+	hypothetical protein	NA	M4MB61	Vibrio_phage	55.6	1.4e-31
WP_060588007.1|4218564_4219632_+|plate	baseplate J/gp47 family protein	plate	M4MHE1	Vibrio_phage	62.0	3.6e-123
WP_060588009.1|4219616_4220138_+	DUF2313 domain-containing protein	NA	A0A2I7S9L6	Vibrio_phage	53.2	4.0e-43
WP_060588012.1|4220139_4220655_+	hypothetical protein	NA	A0A0C4UQS2	Shigella_phage	41.3	2.5e-13
WP_144431437.1|4220957_4222162_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	70.5	3.5e-114
WP_144431433.1|4222523_4222793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060588016.1|4223063_4223687_-	repressor LexA	NA	U5P451	Shigella_phage	46.2	2.8e-11
