The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022503	Salmonella enterica subsp. enterica serovar Hvittingfoss str. SA20014981 chromosome, complete genome	4940239	544276	553447	4940239	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|544276_545224_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824855.1|545207_545939_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|545919_546027_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|546086_546818_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|547040_548726_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|548722_549442_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|549488_549956_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197951.1|550012_550543_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|550714_551173_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195330.1|551413_553447_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 2
NZ_CP022503	Salmonella enterica subsp. enterica serovar Hvittingfoss str. SA20014981 chromosome, complete genome	4940239	639699	650972	4940239		Tupanvirus(12.5%)	10	NA	NA
WP_001618440.1|639699_640722_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	48.0	2.6e-86
WP_058107095.1|640790_641792_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_001606067.1|641810_642932_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	65.4	1.3e-128
WP_001618438.1|642935_643898_+	GDP-L-fucose synthase	NA	M1I5W5	Acanthocystis_turfacea_Chlorella_virus	51.1	6.4e-87
WP_001606059.1|643907_644354_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_001606058.1|644363_645758_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	32.2	7.4e-60
WP_058107096.1|645860_646625_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	34.7	1.3e-10
WP_058107097.1|646621_647992_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.5	2.9e-32
WP_000043532.1|648162_649569_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.2e-36
WP_021294061.1|649805_650972_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	53.2	7.0e-112
>prophage 3
NZ_CP022503	Salmonella enterica subsp. enterica serovar Hvittingfoss str. SA20014981 chromosome, complete genome	4940239	742318	753609	4940239	integrase	Burkholderia_phage(25.0%)	12	736351:736366	750920:750935
736351:736366	attL	GAACAGGTGGATAAGG	NA	NA	NA	NA
WP_058107120.1|742318_743500_+	AAA family ATPase	NA	C7BGE8	Burkholderia_phage	26.9	2.4e-35
WP_023226633.1|743500_744247_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_001617732.1|744348_745605_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	41.3	1.5e-80
WP_000500830.1|746072_746234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394196.1|746360_746780_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_058107121.1|746782_748051_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.9	2.1e-226
WP_000208509.1|748505_748718_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|748728_748917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080661.1|749174_750368_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.2	3.0e-110
WP_000107434.1|751018_751330_+	hypothetical protein	NA	NA	NA	NA	NA
750920:750935	attR	GAACAGGTGGATAAGG	NA	NA	NA	NA
WP_000377042.1|751409_752105_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001157314.1|752178_753609_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	7.8e-105
>prophage 4
NZ_CP022503	Salmonella enterica subsp. enterica serovar Hvittingfoss str. SA20014981 chromosome, complete genome	4940239	1657462	1758126	4940239	portal,protease,terminase,tRNA,capsid,lysis,integrase,transposase,holin,head,tail	Enterobacteria_phage(32.69%)	98	1681555:1681574	1755199:1755218
WP_058107043.1|1657462_1658143_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	9.8e-82
WP_000374046.1|1658762_1659422_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000904446.1|1659508_1659838_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|1659834_1660116_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548091.1|1660164_1660944_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000859416.1|1660969_1661518_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|1661732_1662944_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|1663001_1663319_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000975203.1|1663363_1663780_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|1663950_1664613_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|1664707_1665166_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_058107044.1|1665201_1667256_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001617378.1|1667379_1667826_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950876.1|1667844_1669998_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|1669984_1670590_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|1670806_1671316_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001670727.1|1671672_1672725_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|1672796_1673249_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156459.1|1673434_1675195_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|1675263_1675782_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|1675881_1676049_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|1676304_1676868_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433416.1|1676864_1678505_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|1678509_1679763_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_001617362.1|1679777_1681685_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1681555:1681574	attL	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_001086485.1|1681697_1683806_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224073.1|1683904_1685014_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|1685010_1685553_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|1685718_1686729_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193775.1|1686936_1689549_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	3.7e-20
WP_000497440.1|1689975_1690182_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	100.0	1.8e-31
WP_001536069.1|1690657_1691458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010835411.1|1692025_1693516_+	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	98.6	1.6e-254
WP_000143168.1|1694345_1694927_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.3e-94
WP_024792694.1|1694926_1697128_-|tail	tail protein	tail	E5G6P0	Salmonella_phage	76.1	6.5e-159
WP_000178849.1|1697181_1697424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514902.1|1697462_1700825_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.5	0.0e+00
WP_001750110.1|1700886_1701534_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	78.1	1.6e-89
WP_000662738.1|1701431_1702169_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	84.2	9.8e-128
WP_001152686.1|1702175_1702874_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	75.9	1.6e-103
WP_000447370.1|1702883_1703213_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	71.3	7.3e-43
WP_000372075.1|1703215_1706311_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	61.7	4.8e-277
WP_010989052.1|1706282_1706621_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|1706617_1707013_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971954.1|1707063_1707810_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000033885.1|1707817_1708219_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000677089.1|1708215_1708794_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000817265.1|1708902_1710033_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	98.1	4.0e-213
WP_000083292.1|1710065_1710449_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	1.2e-28
WP_000201486.1|1710459_1710819_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000522566.1|1710876_1711905_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000011260.1|1711959_1712307_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189495.1|1712319_1713816_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.9	3.3e-98
WP_000831820.1|1713805_1715386_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	1.2e-188
WP_000201416.1|1715382_1715586_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	70.8	2.1e-16
WP_000623086.1|1715569_1717501_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.4	2.0e-257
WP_001102153.1|1717472_1718018_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669693.1|1718303_1718705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001533543.1|1718940_1719393_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000984587.1|1719410_1719863_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	5.1e-79
WP_001574216.1|1719846_1720176_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001110788.1|1720451_1721138_+	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM2	Phage_Gifsy-1	98.7	5.1e-131
WP_000798706.1|1721498_1721948_+	lipoprotein	NA	NA	NA	NA	NA
WP_001534733.1|1722083_1722209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047630.1|1722607_1723405_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	4.0e-151
WP_001617856.1|1723394_1723541_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_000784707.1|1723537_1723765_-	DNA breaking-rejoining protein	NA	A0A0M4RU10	Salmonella_phage	76.8	6.6e-19
WP_000940758.1|1723761_1724361_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	6.1e-96
WP_024135617.1|1724424_1724730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100148602.1|1724949_1725330_-	T3SS effector NleG family protein	NA	B6DZB9	Enterobacteria_phage	51.5	7.5e-23
WP_000089413.1|1725870_1726266_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	39.3	2.0e-18
WP_000788952.1|1726283_1727036_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	77.0	1.7e-103
WP_046376811.1|1727042_1727912_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	58.5	1.2e-31
WP_001669257.1|1727956_1728451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001033909.1|1728437_1728692_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	59.4	1.2e-16
WP_001224472.1|1728788_1729214_+	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	56.3	1.2e-13
WP_024135615.1|1729657_1729837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000613375.1|1730267_1730552_+	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	53.2	1.7e-08
WP_000799631.1|1730626_1730962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000023724.1|1731091_1734271_+	DNA breaking-rejoining protein	NA	H6WRX1	Salmonella_phage	68.2	0.0e+00
WP_077906096.1|1734233_1735391_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	98.7	6.7e-216
WP_001237031.1|1735433_1735673_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|1735713_1735962_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262314.1|1736006_1737299_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.5	1.3e-252
WP_000191413.1|1737493_1738696_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_058107045.1|1738776_1740210_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000544857.1|1740455_1741670_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000762343.1|1741987_1742449_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117867.1|1742649_1744050_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.8	4.5e-81
WP_000977709.1|1744655_1745747_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	1.7e-99
WP_000462653.1|1745931_1747122_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_001109471.1|1747183_1747831_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000357052.1|1747858_1748407_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_017465608.1|1748664_1750512_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_058107046.1|1750856_1755323_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
1755199:1755218	attR	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_000060025.1|1755322_1756027_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288828.1|1756007_1757330_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001154028.1|1757322_1758126_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP022503	Salmonella enterica subsp. enterica serovar Hvittingfoss str. SA20014981 chromosome, complete genome	4940239	2167259	2205198	4940239	portal,coat,lysis,integrase,tail	Salmonella_phage(59.65%)	60	2165738:2165784	2205212:2205258
2165738:2165784	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGACCCACGGCTTAGAAG	NA	NA	NA	NA
WP_072158466.1|2167259_2169116_-|tail	phage tail protein	tail	I6S5Y0	Salmonella_phage	89.6	6.8e-61
WP_001749934.1|2169251_2169500_+	Arc family DNA-binding protein	NA	E7C9U8	Salmonella_phage	84.2	7.3e-27
WP_001749933.1|2169556_2170303_-	hypothetical protein	NA	A0A0P0ZDC0	Stx2-converting_phage	57.1	2.0e-64
WP_058107449.1|2170375_2171242_-	hypothetical protein	NA	B6SD57	Bacteriophage	52.1	1.7e-67
WP_001750314.1|2171501_2171816_+	Arc family DNA-binding protein	NA	H6WRU6	Salmonella_phage	62.4	8.9e-30
WP_023177638.1|2171877_2172363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100148607.1|2172395_2172605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058107447.1|2172680_2174594_-	hypothetical protein	NA	E7C9U6	Salmonella_phage	94.3	1.5e-308
WP_058107469.1|2174593_2175898_-	DNA transfer protein	NA	A0A220NR03	Salmonella_phage	95.2	1.2e-226
WP_023206221.1|2175940_2176630_-	hypothetical protein	NA	B9UDK9	Salmonella_phage	99.6	2.3e-102
WP_023206220.1|2176632_2177088_-	DUF2824 family protein	NA	E7C9U3	Salmonella_phage	99.3	5.2e-87
WP_023206219.1|2177087_2177789_-	hypothetical protein	NA	C6ZR14	Salmonella_phage	94.4	4.7e-71
WP_058107446.1|2177792_2179211_-	hypothetical protein	NA	B9UDK6	Salmonella_phage	96.8	5.3e-271
WP_001629232.1|2179170_2179671_-	DNA stabilization, phage-associated	NA	I1TEJ0	Salmonella_phage	98.8	7.9e-89
WP_058107445.1|2179654_2180215_-	hypothetical protein	NA	I6S1J7	Salmonella_phage	99.5	6.3e-103
WP_001196936.1|2180255_2181548_-|coat	coat protein	coat	A0A075B8L2	Enterobacteria_phage	99.8	2.5e-243
WP_058107444.1|2181547_2182459_-	scaffolding protein	NA	A0A1R3Y5R6	Salmonella_virus	99.7	1.8e-160
WP_058107443.1|2182472_2184650_-|portal	portal protein	portal	I6R968	Salmonella_phage	99.0	0.0e+00
WP_058107442.1|2184649_2186110_-	hypothetical protein	NA	W6MW26	Pseudomonas_phage	76.5	4.3e-220
WP_001629224.1|2186109_2186568_-	hypothetical protein	NA	A0A2P1MXF5	Escherichia_phage	66.2	3.3e-49
WP_024159822.1|2186580_2186985_-	hypothetical protein	NA	C6ZR73	Salmonella_phage	98.5	2.0e-66
WP_001140560.1|2186984_2187374_-	hypothetical protein	NA	C6ZR72	Salmonella_phage	99.2	1.5e-74
WP_000807785.1|2187377_2187620_-	DUF2560 family protein	NA	A0A0M4R322	Salmonella_phage	100.0	7.5e-37
WP_058107441.1|2187946_2188435_-	GIY-YIG nuclease family protein	NA	K7P7S3	Enterobacteria_phage	96.9	3.0e-85
WP_058107468.1|2188637_2189075_-|lysis	lysis protein	lysis	A0A1R3Y6Z8	Salmonella_virus	99.3	4.1e-73
WP_058107467.1|2189163_2189661_-	lysozyme	NA	A0A1R3Y5W5	Salmonella_virus	96.4	1.0e-88
WP_000286100.1|2189638_2189842_-	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_000027539.1|2190334_2190823_-	DUF1133 family protein	NA	I6S672	Salmonella_phage	86.4	8.9e-77
WP_000301743.1|2190819_2190999_-	hypothetical protein	NA	A0A0M4QWY9	Salmonella_phage	96.6	1.0e-22
WP_000149881.1|2190979_2191183_-	protein ninH	NA	A0A1V0E5I5	Salmonella_phage	98.5	6.1e-32
WP_000036320.1|2191179_2191404_-	hypothetical protein	NA	Q76H69	Enterobacteria_phage	100.0	6.3e-38
WP_001108069.1|2191400_2192012_-	recombination protein NinG	NA	I6R0S7	Salmonella_phage	99.0	6.7e-98
WP_000950959.1|2192004_2192181_-	protein ninF	NA	I6S668	Salmonella_phage	100.0	2.5e-26
WP_001673929.1|2192173_2192515_-	DUF2591 family protein	NA	I6R9D1	Salmonella_phage	100.0	4.6e-64
WP_000113765.1|2192517_2192694_-	NinE family protein	NA	C6ZR57	Salmonella_phage	100.0	4.6e-28
WP_000679702.1|2192660_2192834_-	hypothetical protein	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
WP_000736922.1|2192830_2193268_-	recombination protein NinB	NA	C6ZR55	Salmonella_phage	100.0	7.7e-80
WP_058107440.1|2193492_2193768_-	hypothetical protein	NA	A0A220NQX3	Salmonella_phage	64.8	1.4e-23
WP_058107439.1|2193769_2193985_-	hypothetical protein	NA	A0A0P0ZC82	Stx2-converting_phage	97.2	1.5e-33
WP_053270764.1|2193999_2194182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025711869.1|2194256_2195633_-	AAA family ATPase	NA	A0A192Y673	Salmonella_phage	99.1	2.2e-253
WP_058107438.1|2195629_2196463_-	replication protein	NA	A0A1R3Y5R9	Salmonella_virus	98.9	2.7e-150
WP_001125981.1|2196455_2196602_-	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_001103492.1|2196636_2196918_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_000067726.1|2197028_2197244_-	helix-turn-helix transcriptional regulator	NA	A0A0M4RTV8	Salmonella_phage	100.0	4.1e-34
WP_023135942.1|2197362_2198025_+	LexA family transcriptional regulator	NA	A0A0M4QWY1	Salmonella_phage	100.0	1.7e-126
WP_024140017.1|2198379_2198682_+	hypothetical protein	NA	I6S5Z3	Salmonella_phage	98.0	6.3e-49
WP_058107437.1|2198763_2199258_+	pentapeptide repeat-containing protein	NA	B9UDG8	Salmonella_phage	93.5	3.1e-53
WP_000713611.1|2199291_2199579_+	hypothetical protein	NA	Q76H36	Enterobacteria_phage	98.9	7.8e-49
WP_000972063.1|2199902_2200037_+	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
WP_001243355.1|2200021_2200174_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000031370.1|2200430_2201036_+	ERF family protein	NA	Q9MCQ9	Enterobacteria_phage	100.0	4.1e-108
WP_001659063.1|2201035_2201419_+	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	98.4	2.5e-66
WP_050008835.1|2201441_2201735_+	DUF2856 family protein	NA	K7P7E6	Enterobacteria_phage	99.0	1.9e-50
WP_001214453.1|2201745_2201913_+	DUF2737 family protein	NA	Q716F2	Shigella_phage	100.0	1.7e-24
WP_000109679.1|2201909_2202209_+	hypothetical protein	NA	Q716F3	Shigella_phage	97.0	4.0e-56
WP_058107436.1|2202210_2202894_+	ead/Ea22-like family protein	NA	A0A1B0VCG7	Salmonella_phage	98.7	5.5e-125
WP_058107435.1|2203085_2203367_+	hypothetical protein	NA	A0A0K2FIU9	Enterobacteria_phage	97.8	9.0e-50
WP_016049827.1|2203454_2203805_+	hypothetical protein	NA	I6R980	Salmonella_phage	100.0	3.2e-60
WP_058107434.1|2204034_2205198_+|integrase	site-specific integrase	integrase	A0A0M4R586	Salmonella_phage	98.2	4.1e-221
2205212:2205258	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGACCCACGGCTTAGAAG	NA	NA	NA	NA
