The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012144	Salmonella enterica subsp. enterica serovar Typhimurium strain FORC_020 chromosome, complete genome	4799793	1107441	1201972	4799793	terminase,integrase,tail,head,plate,tRNA,capsid,portal	Salmonella_phage(80.0%)	85	1110734:1110781	1146825:1146872
WP_058144943.1|1107441_1108014_-	flagellar phase variation DNA invertase Hin	NA	A0A0A7NPV4	Enterobacteria_phage	72.6	8.8e-68
WP_058144944.1|1108105_1109626_+	FliC/FljB family flagellin	NA	NA	NA	NA	NA
WP_000388996.1|1109693_1110233_+	phase 1 flagellin gene repressor FljA	NA	NA	NA	NA	NA
1110734:1110781	attL	ATTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_001536726.1|1110898_1111924_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	100.0	9.9e-203
WP_000616878.1|1111927_1112560_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	100.0	1.1e-116
WP_000102102.1|1112679_1112922_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	100.0	1.1e-38
WP_000460858.1|1112954_1113464_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	100.0	1.6e-89
WP_000956168.1|1113471_1113672_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	100.0	3.2e-33
WP_058144945.1|1113635_1113977_+	DUF5347 domain-containing protein	NA	A0A1S6L019	Salmonella_phage	99.1	6.0e-56
WP_058144946.1|1114044_1114278_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	97.4	1.9e-32
WP_000785513.1|1114277_1114505_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	93.3	3.0e-35
WP_000178747.1|1114501_1114798_+	DUF3850 domain-containing protein	NA	C9E2N9	Enterococcus_phage	45.5	1.5e-10
WP_058144947.1|1114794_1115643_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	82.3	6.4e-131
WP_058144948.1|1115639_1116650_+	phosphoadenosine phosphosulfate reductase family protein	NA	B7SYG0	Stenotrophomonas_phage	43.2	5.9e-67
WP_077945812.1|1116646_1119070_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	93.3	0.0e+00
WP_001154444.1|1119225_1119414_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	100.0	2.7e-26
WP_058144949.1|1119425_1119659_+	DinI family protein	NA	E5G6M1	Salmonella_phage	96.1	2.0e-34
WP_058144950.1|1119978_1121871_+	NTPase KAP	NA	NA	NA	NA	NA
WP_000338835.1|1122262_1122808_+	superinfection exclusion B family protein	NA	NA	NA	NA	NA
WP_058144951.1|1122852_1123887_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	89.2	1.7e-173
WP_058144952.1|1123886_1125653_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.8	0.0e+00
WP_058144953.1|1125794_1126628_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	99.3	4.6e-134
WP_023230741.1|1126644_1127709_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	98.0	6.6e-194
WP_058144954.1|1127712_1128363_+	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	99.1	9.2e-114
WP_058144955.1|1128456_1128921_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	98.1	1.9e-84
WP_000868184.1|1128920_1129124_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000171565.1|1129127_1129343_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_001069919.1|1129323_1129833_+	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	98.8	2.2e-94
WP_000731036.1|1129837_1130215_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	100.0	8.1e-62
WP_024133383.1|1130211_1130640_+	hypothetical protein	NA	A0A1S6KZX8	Salmonella_phage	98.6	1.5e-67
WP_001039960.1|1130735_1131167_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	94.4	7.6e-72
WP_058144956.1|1131159_1131609_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.4	2.8e-61
WP_058144957.1|1131620_1133066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058144958.1|1133145_1133724_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	89.6	3.5e-96
WP_058144959.1|1133720_1134080_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	85.7	6.1e-51
WP_058144960.1|1134066_1134975_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	93.0	1.4e-147
WP_058144961.1|1134967_1135573_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	98.5	1.4e-116
WP_058144962.1|1135569_1137144_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	60.7	2.1e-156
WP_077945813.1|1137113_1137731_+|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	94.4	1.8e-106
WP_058144964.1|1137734_1138142_-|tail	tail fiber assembly protein	tail	A0A1B0V844	Salmonella_phage	88.1	1.4e-64
WP_077945814.1|1138148_1139228_-	hypothetical protein	NA	A0A1B0V7G4	Salmonella_phage	91.8	1.2e-182
WP_001165558.1|1139197_1139755_+	serine-type DNA invertase Fin	NA	A0A1S6L009	Salmonella_phage	98.4	5.5e-99
WP_001207652.1|1141038_1141554_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	98.8	7.9e-92
WP_001280962.1|1141608_1141911_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	100.0	2.5e-45
WP_000763316.1|1141925_1142045_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_058144966.1|1142037_1144845_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.3	0.0e+00
WP_000980409.1|1144841_1145327_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	99.2	8.3e-67
WP_023135772.1|1145323_1146424_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	98.6	9.0e-194
WP_000980499.1|1146492_1146711_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	98.6	1.0e-37
WP_072104906.1|1147261_1148425_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
1146825:1146872	attR	ATTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_023238312.1|1150601_1152011_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_058144967.1|1152075_1163550_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_001518569.1|1164169_1164652_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242603.1|1164801_1165278_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_058144968.1|1165267_1165558_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|1165723_1166062_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880958.1|1166210_1167872_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059155.1|1167957_1168836_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|1168959_1169550_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001287923.1|1169584_1170190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127172650.1|1170310_1171597_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|1171616_1172408_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|1172573_1173935_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|1174248_1174497_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|1174515_1175064_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469807.1|1175108_1175876_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065257.1|1175916_1176264_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_001030985.1|1176420_1177641_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_001212380.1|1177633_1178152_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001168062.1|1178591_1179662_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_000225191.1|1179671_1180793_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_058144969.1|1180850_1181759_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000200077.1|1181719_1182880_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010989056.1|1182979_1183027_-	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_000178449.1|1183130_1183469_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197660.1|1183740_1184478_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_058144970.1|1184609_1185590_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000992639.1|1185586_1186318_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235092.1|1186447_1189021_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
WP_000985653.1|1194882_1195338_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.0e-34
WP_000807818.1|1195441_1196743_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.2e-43
WP_001264478.1|1196739_1197063_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949286.1|1197107_1198463_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_052944406.1|1198577_1201238_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000183642.1|1201291_1201972_-|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP012144	Salmonella enterica subsp. enterica serovar Typhimurium strain FORC_020 chromosome, complete genome	4799793	1677589	1686760	4799793	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569168.1|1677589_1678537_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
WP_000824854.1|1678520_1679252_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1679232_1679340_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1679399_1680131_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1680353_1682039_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1682035_1682755_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950416.1|1682801_1683269_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	3.3e-73
WP_001197951.1|1683325_1683856_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1684027_1684486_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195340.1|1684726_1686760_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 3
NZ_CP012144	Salmonella enterica subsp. enterica serovar Typhimurium strain FORC_020 chromosome, complete genome	4799793	1763656	1774163	4799793		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111837.1|1763656_1765060_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981471.1|1765237_1766131_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|1766507_1767593_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023659.1|1767592_1768492_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000857530.1|1768539_1769418_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	5.1e-107
WP_000973714.1|1769418_1769970_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.0e-52
WP_000018224.1|1769975_1770950_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|1770965_1771739_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565902.1|1771743_1772823_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.3e-16
WP_000126351.1|1772849_1774163_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	9.1e-52
>prophage 4
NZ_CP012144	Salmonella enterica subsp. enterica serovar Typhimurium strain FORC_020 chromosome, complete genome	4799793	1865509	1872742	4799793		Morganella_phage(33.33%)	8	NA	NA
WP_000394197.1|1865509_1865929_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457663.1|1865931_1867200_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.9	9.3e-227
WP_000208509.1|1867654_1867867_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1867877_1868066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080668.1|1868323_1869502_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	57.2	6.6e-110
WP_077945821.1|1870151_1870463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000377042.1|1870542_1871238_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_058145040.1|1871311_1872742_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	7.8e-105
>prophage 5
NZ_CP012144	Salmonella enterica subsp. enterica serovar Typhimurium strain FORC_020 chromosome, complete genome	4799793	2596263	2681452	4799793	lysis,terminase,holin,integrase,tail,tRNA,protease,portal	Enterobacteria_phage(30.19%)	106	2616914:2616930	2680971:2680987
WP_023893413.1|2596263_2596782_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_000272239.1|2596778_2596886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000460698.1|2597091_2597538_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_000579793.1|2597517_2598312_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000205343.1|2598412_2599597_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_001222527.1|2599715_2600063_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_000487126.1|2600048_2600360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058111824.1|2600428_2600680_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001589065.1|2600875_2600974_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_000512149.1|2601112_2601361_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_001532438.1|2601674_2602316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000513733.1|2602545_2602728_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_001248993.1|2602730_2603093_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000457190.1|2603265_2603904_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_000617990.1|2604099_2604645_-	chorismate mutase	NA	NA	NA	NA	NA
WP_000208086.1|2604973_2605222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058145123.1|2605476_2606325_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001562706.1|2606393_2606987_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_058145124.1|2607131_2607920_-	cryptic aminoglycoside nucleotidyltransferase ANT(3'')/ANT(9)	NA	NA	NA	NA	NA
WP_162008455.1|2608028_2608676_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001183699.1|2608872_2609199_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_001618317.1|2609392_2610526_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_058145125.1|2610607_2611198_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_000950207.1|2611191_2611989_-	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	2.8e-11
WP_045900070.1|2611982_2612795_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001726984.1|2612784_2613759_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_021294179.1|2613758_2615393_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000182479.1|2616074_2616389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058145126.1|2616537_2617068_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	70.2	2.4e-35
2616914:2616930	attL	CAGATAGCGCCCTAAAA	NA	NA	NA	NA
WP_000761745.1|2617149_2618193_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_001618322.1|2618531_2618999_-	Hsp20 family protein	NA	NA	NA	NA	NA
WP_000927827.1|2619151_2619424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000758947.1|2619623_2619749_-	lipoprotein	NA	NA	NA	NA	NA
WP_000977722.1|2620126_2620471_+	c-type lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000789471.1|2621692_2622250_-	virulence membrane protein PagC	NA	Q9LA63	Enterobacterial_phage	33.0	1.0e-15
WP_012664625.1|2623058_2623322_+	virulence protein PagD	NA	NA	NA	NA	NA
WP_001537306.1|2623453_2623666_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_001520581.1|2624082_2624604_+	ricin-type beta-trefoil lectin domain protein	NA	NA	NA	NA	NA
WP_000497451.1|2624794_2625034_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_058145127.1|2625523_2626312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058145128.1|2627301_2628426_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_012218897.1|2628873_2629086_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	2.5e-20
WP_000334550.1|2629339_2630011_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.3	1.8e-80
WP_045717999.1|2630003_2631272_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	96.9	1.3e-241
WP_045718000.1|2631274_2631694_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	59.1	2.5e-35
WP_071886398.1|2631865_2632027_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	93.9	3.4e-09
WP_031609383.1|2632206_2632407_+	phage virulence factor PagK family protein	NA	NA	NA	NA	NA
WP_058145129.1|2632503_2633088_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	85.3	1.3e-87
WP_058145130.1|2633087_2635526_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	62.0	8.6e-88
WP_000178826.1|2635579_2635822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077905120.1|2635860_2636736_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	79.7	1.5e-50
WP_045716920.1|2639282_2639987_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
WP_000606351.1|2639884_2640622_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001152415.1|2640631_2641327_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000877926.1|2641416_2641950_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|2642066_2642564_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000978295.1|2642663_2642996_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	2.6e-35
WP_077945841.1|2642992_2645980_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	60.3	6.7e-252
WP_071886390.1|2646059_2646389_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	3.8e-23
WP_045716924.1|2646385_2646784_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.5	1.5e-29
WP_045716925.1|2646829_2647579_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000196703.1|2647590_2647992_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	2.0e-42
WP_045716927.1|2647988_2648555_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	95.7	2.1e-13
WP_000774239.1|2648535_2648835_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_023209454.1|2648827_2649151_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_077910846.1|2649241_2651323_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	6.3e-265
WP_057516619.1|2651246_2652794_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.3	3.7e-177
WP_000196190.1|2652790_2652997_-	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_058145132.1|2652993_2655102_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	70.5	4.7e-292
WP_045717924.1|2655091_2655583_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	58.4	2.2e-43
WP_139815256.1|2655800_2656274_-|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	81.9	2.1e-59
WP_058145134.1|2656294_2656783_-	lysozyme	NA	M9P0E5	Enterobacteria_phage	68.8	2.1e-57
WP_001526513.1|2656760_2657063_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_022742726.1|2657254_2657800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023139352.1|2657790_2657997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001534381.1|2658165_2658354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077945842.1|2658595_2659243_-	ORF6N domain-containing protein	NA	A0A0P0ZGP9	Escherichia_phage	69.9	2.1e-41
WP_058145135.1|2659631_2660186_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	65.3	4.4e-64
WP_000861020.1|2660182_2660464_-	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	79.1	1.7e-35
WP_021000145.1|2660460_2660655_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	61.5	6.1e-13
WP_045717916.1|2660651_2661251_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	83.4	1.9e-97
WP_079902958.1|2661314_2661563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001237395.1|2662250_2664230_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
WP_058145136.1|2664626_2665757_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_058145137.1|2666043_2666439_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	38.8	7.5e-18
WP_157872077.1|2666451_2666994_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	74.8	7.1e-67
WP_001604746.1|2666905_2667913_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	67.3	4.0e-124
WP_058145138.1|2667959_2668454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001033909.1|2668440_2668695_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	59.4	1.2e-16
WP_001224470.1|2668791_2669217_+	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	56.3	9.3e-14
WP_021000137.1|2669526_2669682_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	8.0e-08
WP_137975606.1|2669983_2670181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000613374.1|2670617_2670902_+	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	53.2	1.7e-08
WP_058145139.1|2670976_2671312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045718429.1|2671452_2673870_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	H6WRX1	Salmonella_phage	54.1	1.7e-181
WP_001126032.1|2673862_2674693_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.0e-104
WP_001033921.1|2674728_2675049_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	60.2	3.6e-34
WP_023239956.1|2675041_2675374_+	hypothetical protein	NA	S4TNP2	Salmonella_phage	63.6	4.9e-10
WP_023239955.1|2675370_2675874_+	hypothetical protein	NA	A0A075B8H2	Enterobacteria_phage	91.0	6.6e-35
WP_000089141.1|2675923_2676160_+	excisionase	NA	NA	NA	NA	NA
WP_023239954.1|2676149_2677292_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21929	Phage_21	80.0	2.4e-173
WP_000444509.1|2677405_2678656_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	6.7e-20
WP_001249412.1|2678827_2679493_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_001748347.1|2679489_2679819_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_000476069.1|2679830_2680292_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000004541.1|2680345_2681452_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
2680971:2680987	attR	TTTTAGGGCGCTATCTG	NA	NA	NA	NA
>prophage 6
NZ_CP012144	Salmonella enterica subsp. enterica serovar Typhimurium strain FORC_020 chromosome, complete genome	4799793	2826435	2911141	4799793	holin,terminase,transposase,tail,head,tRNA,capsid,protease,portal	Salmonella_phage(38.89%)	95	NA	NA
WP_000938189.1|2826435_2827116_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	66.4	1.3e-73
WP_058145152.1|2827738_2828386_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.6e-44
WP_058145153.1|2828472_2828802_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2828798_2829080_-	acylphosphatase	NA	NA	NA	NA	NA
WP_058145154.1|2829128_2829908_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000859414.1|2829933_2830482_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|2830696_2831908_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2831965_2832283_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001537782.1|2832327_2832741_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2832914_2833577_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2833671_2834130_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420515.1|2834165_2836220_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
WP_001261222.1|2836343_2836790_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950881.1|2836808_2838962_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2838948_2839554_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2839770_2840280_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001670727.1|2840636_2841689_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2841760_2842213_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156454.1|2842398_2844159_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2844227_2844746_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2844845_2845013_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2845268_2845832_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2845828_2847469_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2847473_2848727_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053051.1|2848741_2850649_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	5.4e-53
WP_058145155.1|2850661_2852770_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_058145156.1|2852868_2853978_+	YcbX family protein	NA	NA	NA	NA	NA
WP_001220671.1|2853974_2854517_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2854682_2855693_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_058145157.1|2855900_2858513_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
WP_024143826.1|2859017_2859443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000343758.1|2859439_2860660_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_000161705.1|2861309_2862032_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_000143158.1|2862227_2862809_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	87.4	1.8e-92
WP_031618324.1|2862798_2863119_-	hypothetical protein	NA	A0A0M4QWS3	Salmonella_phage	79.2	4.9e-44
WP_023251962.1|2863619_2866058_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	63.2	9.2e-90
WP_000178826.1|2866111_2866354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023223575.1|2866392_2869755_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	80.3	0.0e+00
WP_023228907.1|2869816_2870464_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	78.6	5.4e-90
WP_000662740.1|2870361_2871099_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	84.6	1.2e-128
WP_001152689.1|2871105_2871804_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|2871813_2872143_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_052942650.1|2872145_2875187_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	65.2	1.0e-295
WP_010989052.1|2875158_2875497_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|2875493_2875889_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971954.1|2875939_2876686_-	Ig-like domain-containing protein	NA	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000033885.1|2876693_2877095_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_001534814.1|2877138_2877717_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.7	1.7e-82
WP_023251960.1|2877703_2878081_-|capsid	phage capsid protein	capsid	A0A0K2FJB7	Enterobacteria_phage	55.6	2.0e-28
WP_023251959.1|2878091_2878451_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522566.1|2878508_2879537_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000011260.1|2879591_2879939_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_023251958.1|2879951_2881448_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.9	1.9e-98
WP_000831821.1|2881437_2883018_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_000201415.1|2883014_2883218_-	gpW family protein	NA	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_058145158.1|2883201_2885133_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	5.7e-260
WP_001102153.1|2885104_2885650_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_023223569.1|2885694_2885886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023136440.1|2885908_2886412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000636436.1|2886514_2887057_-	DUF2514 family protein	NA	NA	NA	NA	NA
WP_058145159.1|2887053_2887668_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	92.6	1.6e-107
WP_162264800.1|2887670_2888012_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	80.4	9.6e-46
WP_000993186.1|2888212_2888902_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	50.2	5.3e-59
WP_000801757.1|2888898_2889039_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096542.1|2889035_2889647_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	98.0	2.7e-91
WP_000929790.1|2889855_2890458_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_031607489.1|2890492_2890741_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	98.8	1.0e-41
WP_058145160.1|2890857_2891091_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	1.2e-36
WP_023257588.1|2891338_2891665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071825187.1|2891758_2891827_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_023257587.1|2891810_2893025_-	hypothetical protein	NA	J9Q803	Salmonella_phage	53.3	3.0e-118
WP_000974174.1|2893335_2893581_-	hypothetical protein	NA	Q5G8U9	Enterobacteria_phage	88.9	3.0e-33
WP_000065089.1|2893580_2893901_-	hypothetical protein	NA	H6WRY0	Salmonella_phage	65.5	6.7e-25
WP_023257586.1|2893897_2894245_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	99.1	2.2e-58
WP_000800012.1|2894255_2895005_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
WP_000062941.1|2895007_2895991_-	replication protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_015702794.1|2896075_2896450_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	3.3e-63
WP_000145711.1|2896415_2896643_-	helix-turn-helix domain-containing protein	NA	K7PKS2	Enterobacteria_phage	95.9	1.5e-34
WP_000169862.1|2896656_2897124_+	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	83.9	3.9e-66
WP_000439052.1|2897274_2898024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000210935.1|2898020_2898848_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_000438989.1|2898883_2899090_-	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	69.1	9.6e-17
WP_058145161.1|2899381_2899606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000186242.1|2899598_2899799_+	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
WP_000995352.1|2899889_2900186_+	host-nuclease inhibitor protein Gam	NA	A0A0M5M5Z9	Salmonella_phage	100.0	1.1e-48
WP_001652508.1|2900191_2900977_+	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	98.9	8.2e-149
WP_000187055.1|2900973_2901654_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	97.8	1.9e-130
WP_039501142.1|2901650_2902520_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4R347	Salmonella_phage	94.8	1.3e-158
WP_001754984.1|2902525_2902765_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	96.2	9.7e-37
WP_000065276.1|2902805_2903054_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262307.1|2903098_2904391_+	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	100.0	3.4e-253
WP_021294195.1|2904585_2905788_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_058145162.1|2907547_2908762_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000762343.1|2909078_2909540_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117871.1|2909740_2911141_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	34.9	1.7e-80
>prophage 7
NZ_CP012144	Salmonella enterica subsp. enterica serovar Typhimurium strain FORC_020 chromosome, complete genome	4799793	4354895	4399669	4799793	tail,tRNA,plate,holin	Burkholderia_phage(36.36%)	47	NA	NA
WP_001182234.1|4354895_4355894_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039335.1|4355981_4357292_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416271.1|4357538_4358054_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4358152_4358362_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4358383_4358497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128102.1|4358493_4359819_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4359997_4360606_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002900.1|4360714_4361083_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4361253_4363674_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4363772_4364645_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019230.1|4364658_4365156_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782497.1|4365336_4366254_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973678.1|4366417_4367776_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4367864_4368974_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|4369335_4370526_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382570.1|4370657_4372202_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252081.1|4372216_4373107_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|4373272_4373683_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750800.1|4373825_4375922_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_058145349.1|4375921_4376659_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_125469230.1|4376655_4377324_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4377357_4377600_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790025.1|4378043_4379693_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136390.1|4380037_4381387_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4381517_4381865_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226439.1|4382441_4382729_+|holin	putative holin	holin	Q6QIC8	Burkholderia_phage	48.1	3.0e-16
WP_001203711.1|4382731_4383337_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.4	9.3e-60
WP_000777266.1|4383349_4383664_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449399.1|4383823_4384279_+	Gp37 family protein	NA	NA	NA	NA	NA
WP_000875314.1|4384275_4384473_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729853.1|4384462_4385890_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.4e-194
WP_000907494.1|4385889_4386414_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003641.1|4386465_4386783_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4386742_4386871_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262492.1|4386967_4389319_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.3	3.4e-65
WP_000271425.1|4389318_4390272_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|4390271_4390481_+|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818149.1|4390468_4391512_+	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.9	5.0e-77
WP_000679388.1|4391521_4392244_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000593183.1|4392570_4392933_+	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	1.2e-43
WP_000703634.1|4392929_4393859_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	6.7e-150
WP_000632054.1|4393858_4395406_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	1.1e-48
WP_001093501.1|4395569_4395929_+	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951736.1|4395919_4397035_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_001749149.1|4397027_4397660_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	55.6	1.9e-23
WP_000368203.1|4397662_4399144_+|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	51.7	1.3e-51
WP_001177097.1|4399153_4399669_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	41.2	3.4e-34
>prophage 8
NZ_CP012144	Salmonella enterica subsp. enterica serovar Typhimurium strain FORC_020 chromosome, complete genome	4799793	4518209	4585218	4799793	lysis,holin,terminase,integrase,tail,head,plate,capsid,protease,portal	Escherichia_phage(42.55%)	78	4548074:4548120	4580593:4580639
WP_000208240.1|4518209_4518740_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293360.1|4518749_4520081_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	2.4e-44
WP_000139639.1|4520147_4521077_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872918.1|4521169_4521655_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000051370.1|4521876_4522116_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084285.1|4522514_4523360_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
WP_000136809.1|4523380_4524889_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250624.1|4525000_4526011_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796303.1|4526107_4526854_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000155237.1|4526960_4527389_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_058145363.1|4527489_4528086_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216335.1|4528198_4528966_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001088050.1|4529057_4529822_-	epimerase	NA	NA	NA	NA	NA
WP_001738619.1|4529831_4530122_-	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_000774146.1|4530204_4531080_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000090737.1|4531108_4532131_-	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000981826.1|4532159_4533161_-	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000911133.1|4533157_4534201_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001167255.1|4534194_4535730_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	29.5	8.3e-20
WP_023197763.1|4535985_4536945_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_000113085.1|4537031_4538624_+	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_001173083.1|4538637_4538988_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000060999.1|4539224_4539395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001535809.1|4539492_4540215_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000557881.1|4540277_4541318_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_058145364.1|4541327_4542287_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000777314.1|4542297_4543632_-	MFS transporter	NA	NA	NA	NA	NA
WP_000750762.1|4543896_4544652_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_000758711.1|4544752_4545742_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000591793.1|4545945_4546908_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001077320.1|4547092_4547995_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4548074:4548120	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_000468308.1|4548231_4548450_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001749286.1|4548531_4549695_-	phage late control D family protein	NA	A0A0F7LDZ2	Escherichia_phage	99.0	9.1e-205
WP_000978897.1|4549694_4550174_-|tail	phage tail protein	tail	O64315	Escherichia_phage	100.0	5.1e-85
WP_001749285.1|4550188_4552636_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	99.4	0.0e+00
WP_000785970.1|4552628_4552748_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|4552780_4553056_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|4553111_4553630_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286716.1|4553642_4554833_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
WP_001749283.1|4554892_4555486_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.5	6.1e-104
WP_049813387.1|4555513_4556797_+	hypothetical protein	NA	A0A1B0VFW4	Salmonella_phage	99.5	3.9e-241
WP_006678265.1|4556766_4557384_+|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	100.0	5.7e-113
WP_001747940.1|4557387_4557795_-|tail	tail assembly chaperone	tail	A0A1B0V844	Salmonella_phage	100.0	4.9e-73
WP_001285340.1|4559600_4560212_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	100.0	1.7e-117
WP_001121473.1|4560204_4561113_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.7	2.6e-162
WP_000127163.1|4561117_4561465_-	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001093697.1|4561461_4562097_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	1.6e-110
WP_001001786.1|4562163_4562616_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	100.0	8.2e-77
WP_001749231.1|4562608_4563076_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	98.1	3.3e-81
WP_001697717.1|4563183_4563609_-|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	95.0	5.2e-65
WP_001749230.1|4563596_4564022_-	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	91.5	6.8e-57
WP_001144101.1|4564036_4564534_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|4564533_4564815_-|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846409.1|4564818_4565022_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000988638.1|4565021_4565531_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	99.4	2.5e-90
WP_000203444.1|4565630_4566374_-|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	98.8	6.0e-125
WP_001248595.1|4566377_4567451_-|capsid	phage major capsid protein, P2 family	capsid	Q94MC7	Enterobacteria_phage	99.2	5.7e-201
WP_001074420.1|4567509_4568364_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MF5	Enterobacteria_phage	99.6	2.2e-139
WP_000156861.1|4568537_4570310_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_000038188.1|4570309_4571344_+|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.4	4.2e-201
WP_000351260.1|4571717_4572860_+	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	42.9	1.6e-73
WP_058145365.1|4572861_4573542_+	hypothetical protein	NA	A0A0R6PER3	Moraxella_phage	31.7	9.9e-18
WP_001697730.1|4573571_4574594_-	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	59.0	5.5e-113
WP_001749228.1|4574680_4576978_-	replication endonuclease	NA	Q858T4	Yersinia_virus	97.5	0.0e+00
WP_000027664.1|4576967_4577243_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113264.1|4577239_4577464_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_001277898.1|4577466_4577766_-	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_000557703.1|4577765_4577990_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217670.1|4578053_4578554_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001308179.1|4578723_4578996_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000777029.1|4579132_4579426_+	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_000985246.1|4579495_4580476_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_001233463.1|4580661_4581162_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4580593:4580639	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001033731.1|4581312_4582011_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580402.1|4582007_4583381_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
WP_000133443.1|4583431_4583827_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_000559229.1|4583838_4584528_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000122632.1|4584597_4585218_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
