The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012987	Klebsiella pneumoniae strain KpN01 chromosome, complete genome	5307114	160644	170058	5307114		Escherichia_phage(87.5%)	9	NA	NA
WP_160333886.1|160644_162279_+	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	55.8	3.1e-182
WP_032431772.1|162333_163599_+	MFS transporter	NA	NA	NA	NA	NA
WP_032431771.1|163629_164718_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	1.2e-209
WP_004183954.1|164804_165065_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_023282555.1|165362_166223_+	class A extended-spectrum beta-lactamase SHV-27	NA	A0A077SL40	Escherichia_phage	99.3	2.9e-155
WP_002210513.1|166243_167005_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|167265_168168_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004224682.1|168179_169445_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.8	7.8e-234
WP_002210516.1|169437_170058_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 2
NZ_CP012987	Klebsiella pneumoniae strain KpN01 chromosome, complete genome	5307114	205278	288983	5307114	integrase,head,terminase,portal,holin,protease,tail,capsid	Klebsiella_phage(42.0%)	93	215299:215314	284942:284957
WP_002903687.1|205278_206091_+|protease	serine protease	protease	NA	NA	NA	NA
WP_029602375.1|206104_206221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002903683.1|206264_206594_-	multidrug efflux SMR transporter subunit KpnF	NA	NA	NA	NA	NA
WP_002903681.1|206580_206943_-	multidrug efflux SMR transporter subunit KpnE	NA	NA	NA	NA	NA
WP_002903679.1|207385_208420_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_004176297.1|208644_210300_+	malonate decarboxylase subunit alpha	NA	NA	NA	NA	NA
WP_032412136.1|210299_211142_+	triphosphoribosyl-dephospho-CoA synthase	NA	NA	NA	NA	NA
WP_004143106.1|211159_211459_+	malonate decarboxylase acyl carrier protein	NA	NA	NA	NA	NA
WP_032412133.1|211451_212285_+	biotin-independent malonate decarboxylase subunit beta	NA	NA	NA	NA	NA
WP_032412130.1|212284_213085_+	biotin-independent malonate decarboxylase subunit gamma	NA	NA	NA	NA	NA
WP_004148291.1|213221_214181_+	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	90.3	2.7e-53
WP_004152239.1|214184_214802_+	malonate decarboxylase holo-ACP synthase	NA	NA	NA	NA	NA
WP_002903633.1|214801_215704_+	malonate decarboxylase subunit epsilon	NA	NA	NA	NA	NA
215299:215314	attL	GCAGCTGGCGCTGCGG	NA	NA	NA	NA
WP_002903632.1|215693_216620_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_048299811.1|217273_218452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015958364.1|218454_218850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190310.1|219010_220666_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_048299432.1|220930_221851_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_004179716.1|222014_222371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040153866.1|222526_224143_+	two-component system sensor histidine kinase DcuS	NA	NA	NA	NA	NA
WP_004176303.1|224139_224859_+	two-component system response regulator DcuR	NA	NA	NA	NA	NA
WP_060579195.1|224839_225790_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_004152245.1|225857_228635_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.1	6.2e-66
WP_002903581.1|229350_230787_+	anion permease	NA	NA	NA	NA	NA
WP_004152246.1|230841_232494_+	class I fumarate hydratase	NA	NA	NA	NA	NA
WP_023316815.1|232657_234274_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_004143067.1|235351_235741_-	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_004151556.1|235733_236498_-	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
WP_040183187.1|236487_237840_-	3-carboxy-cis,cis-muconate cycloisomerase	NA	NA	NA	NA	NA
WP_004179693.1|237849_239052_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_016947027.1|239062_239719_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_002903522.1|239729_240416_-	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
WP_004143057.1|240585_241392_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_009760676.1|241388_241952_-	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_002903460.1|242053_242962_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032431758.1|243128_244439_+	M20 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_060579196.1|244438_245884_+	amidohydrolase	NA	NA	NA	NA	NA
WP_017879817.1|246003_247122_+	transporter	NA	NA	NA	NA	NA
WP_004146386.1|247250_248351_+|integrase	site-specific integrase	integrase	A0A1W6JP34	Morganella_phage	56.8	2.9e-115
WP_075212415.1|249242_249452_-	helix-turn-helix domain-containing protein	NA	A0A286S1P7	Klebsiella_phage	80.9	4.1e-23
WP_077265819.1|249609_253191_-	SGNH/GDSL hydrolase family protein	NA	A0A286S1P0	Klebsiella_phage	67.2	3.6e-34
WP_049109130.1|253266_256344_-	kinase	NA	A0A286S259	Klebsiella_phage	62.1	0.0e+00
WP_049109129.1|256340_256721_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	81.0	1.4e-58
WP_049109128.1|256733_257210_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	65.8	4.8e-51
WP_004884312.1|257196_257670_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.7	1.1e-55
WP_060579197.1|257691_261078_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	56.7	1.5e-303
WP_016530182.1|261137_261371_-	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.9e-08
WP_049109985.1|261444_261750_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	65.7	2.1e-28
WP_021313622.1|261752_262157_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	57.7	8.5e-33
WP_049109987.1|262187_262892_-	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.5	5.5e-80
WP_049109989.1|262948_263296_-	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	59.3	2.6e-30
WP_049109991.1|263292_263742_-	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	84.6	2.7e-64
WP_049109993.1|263738_264077_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	74.1	2.4e-41
WP_049109995.1|264088_264415_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	69.4	1.8e-41
WP_060579198.1|264414_264666_-	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	68.1	1.6e-10
WP_023341472.1|264708_265926_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	88.1	1.3e-196
WP_032442230.1|265935_266784_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	84.6	7.8e-129
WP_049110000.1|266796_268104_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	84.8	1.6e-213
WP_023341469.1|268103_269846_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.2	1.6e-141
WP_004177162.1|269799_270264_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	61.4	3.7e-48
WP_004177164.1|270446_270788_-	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	73.9	3.0e-47
WP_029497198.1|270843_271089_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	64.2	3.6e-18
WP_029497197.1|271413_271686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004177174.1|271818_272103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190672.1|272338_272614_-	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
WP_004190674.1|272610_272955_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
WP_004184488.1|272951_273491_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	100.0	2.3e-102
WP_031280382.1|273487_273787_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	99.0	2.9e-46
WP_071717307.1|274313_274637_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_049109622.1|275083_275866_-	molecular chaperone	NA	F1C595	Cronobacter_phage	78.7	5.5e-113
WP_049109620.1|275862_276339_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	77.8	1.1e-68
WP_049109615.1|276420_276789_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	60.3	3.6e-38
WP_023328640.1|276775_278155_-	AAA family ATPase	NA	Q8W640	Enterobacteria_phage	64.7	8.1e-160
WP_049109614.1|278151_279030_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	63.9	1.9e-85
WP_049109612.1|279041_279872_-	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	66.2	8.5e-80
WP_032430925.1|279868_280057_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_019705432.1|280132_280360_-	helix-turn-helix domain-containing protein	NA	A0A0N7C1T6	Escherichia_phage	60.0	1.5e-15
WP_023328643.1|280484_281192_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	49.8	1.5e-53
WP_019705434.1|281350_281659_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	56.3	3.9e-22
WP_019705435.1|281648_281843_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	50.0	4.5e-08
WP_019705436.1|282013_282238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218017.1|282442_282604_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	96.2	1.5e-20
WP_040186816.1|282596_282851_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	89.3	1.4e-36
WP_004146412.1|282918_283041_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	100.0	1.3e-16
WP_004152156.1|283037_283463_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_009309071.1|283459_283654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023304718.1|283650_284478_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	9.3e-111
WP_021441619.1|284582_285101_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	99.4	1.3e-94
284942:284957	attR	GCAGCTGGCGCTGCGG	NA	NA	NA	NA
WP_049109610.1|285106_285832_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	99.6	7.1e-131
WP_049109607.1|285821_286046_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	90.5	1.8e-29
WP_023313034.1|287144_287405_+	hypothetical protein	NA	A0A1L5C290	Pseudoalteromonas_phage	43.7	1.5e-11
WP_002903398.1|288016_288175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004224598.1|288467_288983_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	53.5	4.6e-23
>prophage 3
NZ_CP012987	Klebsiella pneumoniae strain KpN01 chromosome, complete genome	5307114	600717	645838	5307114	plate,integrase,terminase,head,portal,tail,tRNA,capsid	Enterobacteria_phage(54.55%)	55	605945:605962	642104:642121
WP_004892876.1|600717_601218_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|601334_601781_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_075212342.1|601764_602559_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_020324105.1|602666_603842_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004140471.1|603873_604566_-	CTP synthase	NA	NA	NA	NA	NA
WP_004176547.1|604711_605221_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_014343000.1|605225_605564_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_004176548.1|605553_605793_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
605945:605962	attL	CCCGACGGGGCTTTTTTT	NA	NA	NA	NA
WP_004213128.1|606057_606309_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
WP_060579213.1|606352_607492_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	70.5	3.6e-145
WP_032411327.1|607646_608819_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.7	2.9e-158
WP_004216461.1|608818_609334_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	2.2e-57
WP_004131585.1|609379_609697_+	hypothetical protein	NA	B9A7B2	Serratia_phage	54.8	1.0e-17
WP_032440702.1|609696_609855_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	3.5e-11
WP_060579214.1|609841_612817_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.7	6.3e-218
WP_060579215.1|612832_613270_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	67.4	1.8e-52
WP_071717265.1|613517_615248_+	deoxycytidylate deaminase	NA	NA	NA	NA	NA
WP_060579216.1|615478_616576_-|tail	phage tail protein	tail	G4KKN6	Yersinia_phage	46.7	8.8e-08
WP_032688258.1|616575_616788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060579217.1|616784_619811_-|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	6.4e-24
WP_032457349.1|619800_620724_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	43.6	9.9e-53
WP_032411305.1|620725_621076_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	54.8	2.1e-27
WP_032457348.1|621072_621660_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	61.0	2.2e-61
WP_032457347.1|621656_622292_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	50.5	6.6e-56
WP_023328065.1|622288_622756_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	59.5	5.4e-47
WP_157835119.1|622756_623092_-	peptidase	NA	B6SD31	Bacteriophage	33.3	9.6e-06
WP_023339943.1|623278_623824_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	43.0	6.3e-31
WP_004213110.1|623820_624105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004131559.1|624095_624296_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
WP_004213109.1|624295_624811_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	49.4	4.1e-40
WP_032457346.1|624923_625781_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	58.1	1.1e-69
WP_023328071.1|625830_626865_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	3.6e-96
WP_004213106.1|626874_627714_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	66.3	5.6e-95
WP_060579218.1|627870_629598_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	67.9	2.6e-232
WP_017898633.1|629591_630653_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.7	1.2e-142
WP_127717256.1|631187_631937_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_060579220.1|632223_633273_-	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_060579221.1|633345_634044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060579222.1|634578_637206_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	50.7	1.7e-190
WP_060579223.1|637223_638180_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	52.9	6.6e-84
WP_048978239.1|638412_638979_-	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	32.6	3.6e-13
WP_032457341.1|638975_639200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004131520.1|639268_639541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032457340.1|639556_639934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004131515.1|639949_640168_-	hypothetical protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	4.7e-06
WP_017898643.1|640188_640467_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	87.6	2.0e-41
WP_048024533.1|640588_640888_+	helix-turn-helix transcriptional regulator	NA	Q1JS83	Enterobacteria_phage	85.9	3.0e-43
WP_017898644.1|641003_641987_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	79.8	8.4e-151
WP_004176549.1|642252_643266_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
642104:642121	attR	CCCGACGGGGCTTTTTTT	NA	NA	NA	NA
WP_004150782.1|643323_643425_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004213093.1|643424_643499_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|643616_643742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140489.1|643801_644065_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_049006378.1|644195_644834_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004148038.1|644923_645838_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
>prophage 4
NZ_CP012987	Klebsiella pneumoniae strain KpN01 chromosome, complete genome	5307114	668247	714055	5307114	plate,integrase,head,terminase,portal,tail,tRNA,capsid	Salmonella_phage(16.67%)	56	701336:701349	710774:710787
WP_032437619.1|668247_668619_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	51.9	8.3e-27
WP_040174799.1|669474_669897_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
WP_073553305.1|669974_670184_-	Hin recombinase	NA	A0A286S1P7	Klebsiella_phage	77.9	4.5e-22
WP_077259490.1|670341_673947_-	SGNH/GDSL hydrolase family protein	NA	A0A286S1P0	Klebsiella_phage	51.6	3.9e-20
WP_049006245.1|674033_674996_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	32.7	1.6e-08
WP_071717287.1|675013_675898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047719060.1|675929_676607_-	YmfQ family protein	NA	NA	NA	NA	NA
WP_049006248.1|676603_677752_-|plate	baseplate J/gp47 family protein	plate	R9TN81	Rhizobium_phage	27.8	5.8e-18
WP_077259491.1|678183_678732_-|plate	phage baseplate assembly protein	plate	A0A077KAY0	Edwardsiella_phage	33.3	5.4e-06
WP_049006252.1|678767_679847_-|tail	tail protein	tail	Q8HAC0	Salmonella_phage	30.5	3.1e-37
WP_049006254.1|679843_681244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049006255.1|681289_683164_-	hypothetical protein	NA	T1SBJ1	Salmonella_phage	45.0	6.5e-19
WP_049006256.1|683305_683584_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_048294781.1|683585_683954_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_049006257.1|683957_685469_-|tail	tail protein	tail	B5TK67	Pseudomonas_phage	44.2	1.5e-106
WP_032735091.1|685465_685651_-	DUF2635 domain-containing protein	NA	A0A2P9JZJ7	Alteromonadaceae_phage	46.8	2.8e-07
WP_049006258.1|685654_686200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071717286.1|686196_686556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049006261.1|686561_686960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049006262.1|686931_687981_-|capsid	major capsid protein	capsid	V5Q8X6	Xylella_phage	29.1	3.5e-38
WP_049006264.1|688079_688484_-|head	head decoration protein	head	A0A0C5AN05	Bacteriophage	37.6	2.4e-11
WP_049006266.1|688483_689065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049006268.1|689066_689933_-	S49 family peptidase	NA	A0A248XD65	Klebsiella_phage	46.8	2.0e-47
WP_049006270.1|689929_691567_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	36.2	4.0e-89
WP_032735077.1|691566_691830_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_053090091.1|691838_693962_-|terminase	terminase	terminase	A0A2K9V3X4	Faecalibacterium_phage	35.6	4.2e-99
WP_048294759.1|693903_694488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049006301.1|694732_695371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_130939985.1|695653_696019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032735066.1|696008_696242_+	DUF4199 domain-containing protein	NA	NA	NA	NA	NA
WP_049006276.1|696561_696951_-	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	44.4	2.5e-21
WP_048294746.1|696947_697472_-	lysozyme	NA	Q71TF3	Escherichia_phage	54.2	1.3e-49
WP_049006278.1|697455_697776_-	hypothetical protein	NA	O64361	Escherichia_phage	50.0	5.3e-22
WP_049006280.1|698507_699086_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.2	1.3e-50
WP_071717285.1|699099_700080_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	66.9	7.1e-134
WP_000779146.1|700092_700470_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	2.3e-48
WP_049006283.1|700479_701289_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.3	3.5e-110
WP_049006285.1|701285_702254_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	66.4	5.5e-86
701336:701349	attL	AGCTGGCTCGCGAA	NA	NA	NA	NA
WP_004184738.1|702243_702423_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	75.0	1.6e-15
WP_004213338.1|702660_703122_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
WP_001191665.1|703156_703399_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	80.3	1.3e-25
WP_000690183.1|703496_704192_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	71.3	2.7e-87
WP_049006289.1|704724_705642_+	recombination-associated protein RdgC	NA	A0A1W6JP69	Morganella_phage	36.9	5.2e-46
WP_040186300.1|705729_706029_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	47.8	1.0e-14
WP_049006292.1|706028_706814_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.5	1.5e-62
WP_025714330.1|706941_707250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114138601.1|707262_707679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023283338.1|707678_707891_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	43.9	2.4e-10
WP_040176408.1|707887_708283_+	hypothetical protein	NA	A0A077K9V6	Edwardsiella_phage	33.8	1.0e-06
WP_040176407.1|708275_708494_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	53.4	3.5e-09
WP_000089156.1|708794_709031_+	excisionase	NA	NA	NA	NA	NA
WP_000741346.1|709020_710163_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	82.2	9.1e-173
WP_004150800.1|710275_711526_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
710774:710787	attR	TTCGCGAGCCAGCT	NA	NA	NA	NA
WP_004150801.1|711766_712417_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004150802.1|712433_712892_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150803.1|712948_714055_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP012987	Klebsiella pneumoniae strain KpN01 chromosome, complete genome	5307114	954483	963946	5307114	protease,tRNA	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_016532437.1|954483_956205_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_004141853.1|956231_956951_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|957304_957523_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|957642_959922_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|959952_960270_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|960595_960817_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|960893_962834_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_004191152.1|962830_963946_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 6
NZ_CP012987	Klebsiella pneumoniae strain KpN01 chromosome, complete genome	5307114	3228750	3261179	5307114	integrase,head,terminase,portal,protease,tail,tRNA,capsid	uncultured_Caudovirales_phage(78.57%)	31	3246356:3246373	3261793:3261810
WP_004150007.1|3228750_3229698_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_004174081.1|3229712_3230222_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	1.5e-18
WP_002919139.1|3230350_3231475_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|3231446_3231920_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|3231945_3232488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|3232492_3233065_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|3233068_3233887_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|3233883_3234141_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_023279307.1|3234116_3234671_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|3240464_3240686_-	membrane protein	NA	NA	NA	NA	NA
WP_004144975.1|3240979_3244090_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|3244102_3245242_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004900945.1|3245620_3246274_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
3246356:3246373	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004149996.1|3246543_3247764_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	63.0	3.5e-154
WP_019077825.1|3247763_3248414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019077824.1|3248994_3249279_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_019077822.1|3250338_3250542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032660562.1|3250684_3250873_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_060579284.1|3250865_3251060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060579285.1|3251056_3251269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060579286.1|3251258_3253922_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	54.6	5.6e-274
WP_060579287.1|3254276_3254579_+	hypothetical protein	NA	A0A2H4JB54	uncultured_Caudovirales_phage	86.3	2.0e-42
WP_060579288.1|3254811_3255978_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	99.2	2.2e-214
WP_060579289.1|3256029_3256590_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	97.8	3.8e-100
WP_060579290.1|3256591_3257833_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	3.6e-231
WP_004150961.1|3257829_3258165_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|3258161_3258461_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_001547823.1|3258460_3258904_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	92.5	3.3e-78
WP_001547822.1|3258896_3259049_+	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	84.0	1.3e-15
WP_019077808.1|3259177_3259534_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	94.1	3.3e-57
WP_019077807.1|3259517_3261179_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	97.1	0.0e+00
3261793:3261810	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 7
NZ_CP012987	Klebsiella pneumoniae strain KpN01 chromosome, complete genome	5307114	3431528	3475908	5307114	plate,integrase,head,terminase,lysis,portal,holin,tail,tRNA,capsid	Erwinia_phage(24.39%)	52	3422998:3423012	3462602:3462616
3422998:3423012	attL	GCGATGCCGATGCCT	NA	NA	NA	NA
WP_060579293.1|3431528_3434771_-	transporter substrate-binding domain-containing protein	NA	A0A1V0SGX0	Hokovirus	33.3	7.3e-34
WP_004174237.1|3434775_3435390_-	acid-sensing system DNA-binding response regulator EvgA	NA	NA	NA	NA	NA
WP_004900718.1|3435691_3436057_+	hdeB family protein	NA	NA	NA	NA	NA
WP_004889691.1|3436125_3436398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032454123.1|3437064_3438102_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	64.7	2.7e-123
WP_032454122.1|3438108_3438693_-	phage repressor protein CI	NA	F1BUS8	Erwinia_phage	38.7	1.0e-31
WP_004195891.1|3438812_3439034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032454121.1|3439064_3439574_+	phage regulatory CII family protein	NA	Q6K1F8	Salmonella_virus	93.5	4.6e-84
WP_032454120.1|3439581_3439782_+	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	93.9	1.1e-30
WP_032454119.1|3439745_3440084_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	92.0	8.0e-53
WP_060579294.1|3440152_3440380_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	73.3	3.0e-19
WP_042943327.1|3440379_3440601_+	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	87.7	4.0e-29
WP_047718529.1|3440601_3440883_+	DUF5405 family protein	NA	A0A218M4I8	Erwinia_phage	91.4	3.7e-43
WP_162779380.1|3441031_3443104_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	89.9	0.0e+00
WP_060579296.1|3443218_3443659_+	DinI family protein	NA	A0A218M4I0	Erwinia_phage	81.8	5.4e-57
WP_060579297.1|3443791_3444526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060579298.1|3445012_3446056_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	82.1	1.5e-166
WP_015959022.1|3446055_3447825_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	87.9	2.8e-306
WP_060579299.1|3447990_3448845_+|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	75.4	2.4e-117
WP_032440340.1|3448918_3449977_+|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.5	3.5e-163
WP_162779381.1|3450004_3450724_+|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	79.2	1.8e-94
WP_025710538.1|3450820_3451327_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	84.3	5.4e-61
WP_060579301.1|3451326_3451530_+|tail	phage tail protein	tail	S4TTA0	Salmonella_phage	77.6	1.0e-23
WP_019725381.1|3451534_3451825_+|holin	holin	holin	A0A0M5M1H1	Salmonella_phage	79.6	5.0e-35
WP_060579302.1|3451811_3452309_+	glycoside hydrolase family 104 protein	NA	O80309	Escherichia_phage	84.2	3.0e-80
WP_060579303.1|3452305_3452737_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	64.7	2.0e-40
WP_060579304.1|3452711_3452870_+	hypothetical protein	NA	A0A218M4L1	Erwinia_phage	72.0	8.4e-13
WP_060579305.1|3452832_3453300_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	76.1	9.7e-65
WP_060579306.1|3453292_3453742_+	phage virion morphogenesis protein	NA	A0A0M3UL83	Salmonella_phage	61.9	4.4e-46
WP_023317710.1|3453761_3454307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060579307.1|3454316_3455675_+	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_060579308.1|3455784_3456426_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	77.0	2.9e-91
WP_060579309.1|3456422_3456770_+|plate	baseplate assembly protein	plate	Q7Y4D7	Escherichia_virus	77.4	4.9e-45
WP_060579310.1|3456774_3457683_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	71.5	9.9e-114
WP_162779382.1|3457690_3458278_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	56.2	1.2e-51
WP_141769590.1|3458171_3460511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060579313.1|3460510_3461293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060579314.1|3461314_3462388_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	41.9	8.0e-30
WP_060579315.1|3462498_3463680_+|tail	phage tail sheath protein	tail	Q7Y4D1	Escherichia_virus	86.1	5.1e-195
3462602:3462616	attR	GCGATGCCGATGCCT	NA	NA	NA	NA
WP_014343412.1|3463693_3464209_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.6	3.2e-69
WP_060579316.1|3464268_3464544_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	76.1	5.4e-31
WP_014343413.1|3464576_3464696_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	92.3	2.0e-14
WP_060579317.1|3464688_3467127_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	72.0	4.5e-294
WP_032454094.1|3467143_3467623_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	77.1	4.5e-65
WP_060579318.1|3467622_3468783_+	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	80.5	3.7e-174
WP_071717250.1|3468831_3469239_-	hypothetical protein	NA	S4TTB4	Salmonella_phage	43.6	1.3e-25
WP_032454093.1|3469331_3469550_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	84.7	1.0e-32
WP_002917636.1|3469918_3470425_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_004174339.1|3470524_3472366_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_004149864.1|3472584_3474330_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.7	1.6e-75
WP_001144069.1|3474441_3474657_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_004900709.1|3474894_3475908_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	1.4e-108
>prophage 8
NZ_CP012987	Klebsiella pneumoniae strain KpN01 chromosome, complete genome	5307114	4204685	4256230	5307114	head,terminase,integrase,holin	Cronobacter_phage(25.0%)	72	4240673:4240688	4260865:4260880
WP_023280390.1|4204685_4205144_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	33.9	1.9e-12
WP_004149227.1|4205276_4206185_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	24.2	4.6e-10
WP_049006705.1|4206194_4207076_-	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.5e-05
WP_002913367.1|4207443_4207926_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_023301637.1|4208262_4208463_-	transcriptional regulator	NA	K7P7V0	Enterobacteria_phage	86.4	3.7e-29
WP_060579327.1|4208459_4208693_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	48.1	2.7e-07
WP_060579328.1|4208694_4208913_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	2.4e-10
WP_060579329.1|4208909_4209959_-	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	68.3	5.1e-146
WP_060579330.1|4209955_4210612_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	88.0	9.3e-114
WP_004151308.1|4210608_4210767_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
WP_032434117.1|4210763_4211444_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	92.9	3.9e-123
WP_060579331.1|4211440_4212286_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.5e-68
WP_016529276.1|4212301_4212586_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	8.6e-40
WP_004151303.1|4212674_4212869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074183191.1|4212861_4212987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060579332.1|4213305_4213938_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	43.0	6.0e-33
WP_023284762.1|4214037_4214253_+	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	60.9	4.2e-15
WP_004141720.1|4214302_4214623_+	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	68.9	3.8e-36
WP_004151298.1|4214709_4214856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162779384.1|4214896_4215748_+	DNA replication protein	NA	F1C5C3	Cronobacter_phage	56.0	2.0e-84
WP_162779383.1|4215752_4217168_+	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	67.7	3.7e-184
WP_004218528.1|4217167_4217470_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_101977350.1|4217466_4217901_+	hypothetical protein	NA	A0A193GYX5	Enterobacter_phage	74.4	3.0e-12
WP_040181701.1|4217897_4218158_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	75.6	1.6e-29
WP_060579334.1|4218264_4218744_+	ead/Ea22-like family protein	NA	K7P6V8	Enterobacteria_phage	41.0	8.6e-08
WP_060579335.1|4218743_4218956_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_060579336.1|4218952_4219585_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	32.5	5.3e-05
WP_139618712.1|4219963_4220317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060579338.1|4220671_4221127_+	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	1.0e-55
WP_071717292.1|4221126_4221297_+	hypothetical protein	NA	G8C7V4	Escherichia_phage	72.7	1.7e-14
WP_060579339.1|4221289_4221925_+	NinG family protein	NA	M9NYX8	Enterobacteria_phage	76.1	1.9e-79
WP_060579340.1|4221921_4222062_+	YlcG family protein	NA	NA	NA	NA	NA
WP_004884209.1|4222058_4222559_+	phage antitermination Q family protein	NA	G8C7V7	Escherichia_phage	91.5	3.3e-87
WP_060579341.1|4223166_4223505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019704119.1|4224636_4224861_+|holin	holin	holin	M9NZI9	Enterobacteria_phage	91.9	4.0e-32
WP_019704120.1|4224838_4225333_+	lysozyme	NA	M9P0E5	Enterobacteria_phage	95.1	1.7e-88
WP_060579342.1|4225329_4225680_+	hypothetical protein	NA	H2EQH5	Salmonella_phage	39.8	7.1e-12
WP_060579343.1|4225834_4226107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032443192.1|4226262_4226499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060595339.1|4226546_4226756_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_060579344.1|4226783_4227299_+|terminase	terminase small subunit	terminase	I6PDJ6	Cronobacter_phage	76.4	3.9e-67
WP_060579345.1|4227298_4228771_+	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	82.3	2.2e-248
WP_060579346.1|4228783_4230253_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	56.6	2.4e-149
WP_060579347.1|4230179_4231184_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	70.7	1.6e-117
WP_004151273.1|4231225_4231702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060579348.1|4231774_4233160_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	60.0	3.0e-154
WP_004151271.1|4233163_4233592_+	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	1.6e-42
WP_004151270.1|4233603_4234698_+	hypothetical protein	NA	F1C5E1	Cronobacter_phage	62.8	1.7e-123
WP_060579349.1|4234708_4234948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060579350.1|4234950_4235331_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	54.5	1.6e-28
WP_049110627.1|4235330_4235504_+	hypothetical protein	NA	I6R0P9	Salmonella_phage	52.6	9.2e-13
WP_040246669.1|4235503_4235866_+	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	49.2	1.3e-19
WP_060579351.1|4235868_4236237_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	82.8	3.8e-48
WP_060579352.1|4236233_4236617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063343980.1|4236675_4237440_+	immunoglobulin domain-containing protein	NA	G0ZNE6	Cronobacter_phage	43.8	5.5e-41
WP_060579353.1|4237507_4238203_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	53.7	1.8e-62
WP_004223321.1|4238397_4238760_-	Arc family DNA-binding protein	NA	H6WRU6	Salmonella_phage	65.6	3.3e-12
WP_004223324.1|4238872_4239046_+	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	85.7	5.1e-19
WP_060579354.1|4239035_4239737_+	hypothetical protein	NA	H6WRU8	Salmonella_phage	40.6	1.4e-38
WP_060579355.1|4239802_4240588_+	Bro-N domain-containing protein	NA	A0A2L1IV39	Escherichia_phage	59.7	7.1e-84
4240673:4240688	attL	GGTGAAAAAATGAATA	NA	NA	NA	NA
WP_060579356.1|4240681_4240894_+	hypothetical protein	NA	H6WRV2	Salmonella_phage	62.1	8.1e-11
WP_032439739.1|4240968_4241583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060579357.1|4241642_4244921_+	tape measure protein	NA	R9TMK1	Aeromonas_phage	50.4	1.0e-192
WP_048987939.1|4244943_4245567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060579358.1|4245629_4246106_+	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	47.7	1.5e-36
WP_048287261.1|4246105_4246576_+	hypothetical protein	NA	F1C5F1	Cronobacter_phage	37.7	3.4e-25
WP_016531193.1|4246572_4246968_+	hypothetical protein	NA	F1C5F2	Cronobacter_phage	52.8	2.3e-35
WP_060579360.1|4246954_4249426_+	hypothetical protein	NA	F1C5A7	Cronobacter_phage	45.2	2.2e-203
WP_114141038.1|4249511_4253087_+	SGNH/GDSL hydrolase family protein	NA	A0A286S1P0	Klebsiella_phage	56.0	8.1e-18
WP_060579361.1|4253322_4253640_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	53.5	3.7e-23
WP_047693700.1|4253814_4254975_-|integrase	tyrosine-type recombinase/integrase	integrase	Q716F9	Shigella_phage	85.3	8.0e-193
WP_004149224.1|4255300_4256230_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	81.4	6.7e-134
4260865:4260880	attR	GGTGAAAAAATGAATA	NA	NA	NA	NA
>prophage 9
NZ_CP012987	Klebsiella pneumoniae strain KpN01 chromosome, complete genome	5307114	4478195	4485100	5307114	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004180551.1|4478195_4479059_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004180550.1|4479069_4479843_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_004151134.1|4480083_4480980_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|4481222_4482584_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|4482902_4483625_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004149058.1|4483621_4485100_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 1
NZ_CP012989	Klebsiella pneumoniae strain KpN01 plasmid pKpN01-SIL, complete sequence	134064	724	57690	134064	protease,transposase	uncultured_Caudovirales_phage(30.77%)	46	NA	NA
WP_077251107.1|724_2071_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004187044.1|2281_2764_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003026799.1|2751_3018_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_060579418.1|3168_3873_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	6.9e-139
WP_004187040.1|4031_6617_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.2	3.5e-23
WP_032238678.1|6585_6831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152113.1|8245_9208_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_004187033.1|9194_9944_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_004152116.1|10378_13174_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152117.1|13279_13849_-	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_013307885.1|13883_14165_-	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	6.8e-05
WP_004118208.1|14408_14672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187027.1|14686_14950_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_004187025.1|15912_16161_+	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_004187019.1|16150_16435_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	55.9	6.4e-19
WP_004187017.1|16450_17806_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004187015.1|17848_18349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187010.1|20751_21216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187005.1|22674_24420_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_004181711.1|24419_26003_-	5-oxoprolinase/urea amidolyase family protein	NA	NA	NA	NA	NA
WP_004187003.1|26015_26822_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_004181708.1|26818_27592_-	LamB/YcsF family protein	NA	NA	NA	NA	NA
WP_004181707.1|27600_28845_-	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_004181705.1|29184_29835_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100206809.1|30614_32069_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_004186999.1|32109_32946_-	DUF1989 domain-containing protein	NA	NA	NA	NA	NA
WP_004186998.1|32945_33668_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004186997.1|33677_35186_-	amino acid ABC transporter permease/ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.2	7.6e-34
WP_004186996.1|35210_36026_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_096810283.1|37363_38530_+|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	95.8	1.1e-178
WP_000427619.1|40165_41170_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_032742905.1|41248_44233_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	54.1	9.9e-304
WP_008502231.1|44392_44977_+	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	36.1	2.6e-22
WP_000108589.1|45161_45719_+	OsmC family protein	NA	NA	NA	NA	NA
WP_023304048.1|45860_46442_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000888080.1|46446_46785_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_031591986.1|46814_47144_-	thioredoxin family protein	NA	V9SJ74	Achromobacter_phage	33.7	4.3e-11
WP_060579419.1|47356_48463_+	alkene reductase	NA	NA	NA	NA	NA
WP_031591983.1|48528_49230_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_004729618.1|49295_50069_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_031591991.1|51780_52206_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	6.1e-50
WP_031591992.1|52218_53508_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	3.5e-173
WP_031591994.1|53554_55306_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_031591995.1|55322_55685_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_031591996.1|55732_56086_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	49.1	6.9e-23
WP_000427619.1|56685_57690_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP012988	Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence	190072	0	10705	190072		Escherichia_phage(37.5%)	11	NA	NA
WP_060579413.1|0_756_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	95.2	2.9e-135
WP_000368714.1|1521_2727_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_060579414.1|2726_3701_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	53.5	1.4e-86
WP_060579415.1|3782_5054_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	6.4e-151
WP_048993623.1|5053_5485_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_162779385.1|5892_7380_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.1	1.9e-29
WP_004152353.1|7628_8600_+	mediator of plasmid stability	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_032330269.1|8602_9274_+	Mediator of plasmid stability	NA	NA	NA	NA	NA
WP_001568040.1|9336_9567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343518.1|9685_9802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152355.1|10003_10705_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
>prophage 2
NZ_CP012988	Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence	190072	71975	156818	190072	integrase,protease,transposase	Escherichia_phage(27.59%)	73	71911:71970	119679:120500
71911:71970	attL	TCGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGC	NA	NA	NA	NA
WP_001067855.1|71975_72680_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000046891.1|73805_74141_-	thermonuclease family protein	NA	G8DH70	Emiliania_huxleyi_virus	35.7	2.8e-05
WP_001515734.1|74383_74947_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001348195.1|75011_75386_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001097412.1|75409_75973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|77374_78079_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032140899.1|79700_79943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000164043.1|79974_80625_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804064.1|80730_81930_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000058717.1|81961_82846_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001351729.1|82983_83376_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000509966.1|84152_84758_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_023307208.1|84852_87750_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	5.5e-182
WP_014386481.1|90157_90802_+	quinolone resistance pentapeptide repeat protein QnrB1	NA	NA	NA	NA	NA
WP_001067855.1|91674_92379_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000845048.1|92924_93938_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_004201280.1|94093_94567_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001144737.1|94787_95054_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_001389365.1|95196_95961_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_004098817.1|96221_97436_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001288432.1|97469_98903_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_001067855.1|99221_99926_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001393253.1|102804_103137_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_000239590.1|103183_104059_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_000608644.1|104314_105577_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_001235713.1|106140_106698_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|106880_107741_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001120891.1|107950_108490_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000480968.1|108461_109298_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|109297_110101_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043260.1|110161_110977_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000954592.1|111306_111483_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_000427619.1|111664_112669_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|114267_114972_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001445937.1|115352_116309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011977825.1|116335_116497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000176305.1|116493_117105_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001568067.1|117158_117440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011977766.1|117612_117948_+	C2H2-type zinc finger protein	NA	NA	NA	NA	NA
WP_001067855.1|118968_119673_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001695382.1|119785_120127_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	50.0	3.4e-19
WP_015065500.1|120173_120824_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.6	1.8e-77
119679:120500	attR	GCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCGATCTGGCGACTGGATCGTCTGAGCCGTTCCCTGAAAGACTTGATTGAAATGGTTAAACATCTGGAGTCGAAAGGTATCGGTTTAAAAAGCCTTCAGGAATCCATCGACACAACCTCCAGTTCCGGAATGCTGATATTTCATCTTTTTGGGGCACTGGCAGAATTTGAACGCAACCTGACAAGAGAGAGAACTCAGGCCGGGCTTCAGGCAGCACGAGCCAGAGGACGTAAGGGCGGCAGGCCGAAAACACTGAGTAAGGATAAACAGGCCCTTGCTGTTCAACTCTATAACGAGAAAAAACATACAGTTGCGCAGATTTGTGTGTTGATGGGGATATCGAGGCCAACGCTGTACAAATACATAGAGTCAGCCAGGTTGTTCAAGAAATGAACTTAGCGTACGTTTTCGTACGGTTGGGCTTCAAACCCCTCAGTCAATGACGCGGGAAGAGTATCTTTCTCTCTTCGCCAATGAAGCCGATCGAAATATTGCCTACGACCCGGAACCCATCGGTCGCTATAACGTCGCCCCGGGTACCAGGGTGTTACTTCTGAGCGAACGCGACGAACAGCTGCAGCTCGATCCGGTTCACTGGGGTTACGCACCAGGGTGGTGGGATAAACCGCCATTGATTAATGCCCGGGTTGAGACCGCAGCCAGCAGCAGGATGTTTAAACCTCTTTGGCAGCACGGTCGGGCGATCTGCTTTGCTGATGGCTGGTTTGAATGGAAGCGTGAAGGAGACAAGAAGCAGCCCTATTTC	NA	NA	NA	NA
WP_019725651.1|121120_122116_+	hypothetical protein	NA	A0A2H4UVR4	Bodo_saltans_virus	34.9	2.1e-32
WP_019725650.1|122188_122512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032720638.1|124671_124995_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_032720637.1|125043_125346_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_153591440.1|125388_125556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032720701.1|125743_125923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032720636.1|125946_126330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032720635.1|126434_127007_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_032720700.1|127008_127797_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_050548604.1|127832_128753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044266755.1|129055_129550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044266753.1|129580_130153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060579400.1|130149_130398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058650054.1|130963_131308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016338367.1|131415_132051_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_016338368.1|132050_134159_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	27.3	2.4e-38
WP_016338369.1|134148_135426_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_048983057.1|137002_137419_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016338373.1|137415_137646_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001407551.1|138290_139307_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_032249507.1|139316_139985_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_077265821.1|140182_141151_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.9	7.7e-173
WP_001542733.1|141480_141777_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_032677266.1|142356_145890_-	DEAD/DEAH box helicase	NA	A0A076FHE1	Aureococcus_anophage	26.1	2.7e-18
WP_000248889.1|145873_146653_-	DUF1837 domain-containing protein	NA	NA	NA	NA	NA
WP_000770925.1|147308_148145_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_060579401.1|148141_149791_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_023300121.1|149968_153091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004016055.1|153191_154625_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_000619352.1|154645_155449_-	TIGR02391 family protein	NA	A0A1S5SBU1	Streptococcus_phage	36.0	2.6e-33
WP_085929673.1|155649_156818_-|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.1	1.9e-178
