The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LN831027	Fusobacterium nucleatum subsp. polymorphum strain NCTC10562 chromosome 1	2443126	1260094	1266547	2443126		Synechococcus_phage(33.33%)	7	NA	NA
WP_005896886.1|1260094_1260568_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	46.9	3.8e-24
WP_005896888.1|1260835_1261549_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	43.2	1.9e-43
WP_005896889.1|1261595_1262942_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	32.0	2.5e-52
WP_005896891.1|1262953_1263973_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SQF5	Cyanophage	43.8	6.6e-66
WP_005896893.1|1263960_1264545_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.8	6.5e-26
WP_032842805.1|1264711_1265008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005896898.1|1265032_1266547_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	43.2	8.9e-59
>prophage 2
NZ_LN831027	Fusobacterium nucleatum subsp. polymorphum strain NCTC10562 chromosome 1	2443126	1861378	1925590	2443126	tRNA,capsid,tail,protease,portal,head,plate,integrase,terminase	Clostridium_phage(25.81%)	74	1891059:1891079	1925637:1925657
WP_005898349.1|1861378_1862686_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_005898347.1|1862979_1863483_+	flavodoxin	NA	NA	NA	NA	NA
WP_058229303.1|1863627_1865166_-	AbgT family transporter	NA	NA	NA	NA	NA
WP_005898343.1|1865392_1866001_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_005898340.1|1866014_1866707_-	LrgB family protein	NA	NA	NA	NA	NA
WP_005898339.1|1866706_1867063_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_005898337.1|1867129_1868611_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	43.0	3.7e-94
WP_005898335.1|1868640_1869918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171487425.1|1869934_1870330_-	DUF1934 family protein	NA	NA	NA	NA	NA
WP_005898333.1|1870348_1870816_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005898332.1|1870826_1872776_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	29.6	1.8e-59
WP_005898330.1|1872923_1873469_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_005898328.1|1873540_1874509_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_005898325.1|1874521_1875409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005898323.1|1875424_1876261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032842827.1|1876279_1877116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005898313.1|1877127_1877568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005898311.1|1877587_1878994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005898309.1|1879114_1879654_-	rubrerythrin family protein	NA	NA	NA	NA	NA
WP_005898308.1|1879848_1881324_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_005898307.1|1881451_1882012_-	flavin reductase	NA	NA	NA	NA	NA
WP_005898306.1|1882030_1883785_-	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	39.8	3.4e-110
WP_005898305.1|1883817_1885641_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	37.7	1.7e-101
WP_005898303.1|1885964_1886858_+	adenine-specific DNA-methyltransferase	NA	A0A0P0CJX0	Ostreococcus_lucimarinus_virus	29.0	2.7e-23
WP_005898302.1|1886873_1887962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005898301.1|1888056_1889517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005898300.1|1889552_1890575_-	hypothetical protein	NA	NA	NA	NA	NA
1891059:1891079	attL	TTTCTGCTATTTTTCTGCTAC	NA	NA	NA	NA
WP_005898298.1|1891445_1891958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005898297.1|1892069_1892399_-	hypothetical protein	NA	A0A0E3Y631	Fusobacterium_phage	85.7	1.6e-42
WP_005898296.1|1892413_1892863_-	DUF1353 domain-containing protein	NA	A0A1B2IE16	Erwinia_phage	37.3	2.5e-09
WP_005898293.1|1892849_1893137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005898292.1|1893139_1893688_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0E3Y6A6	Fusobacterium_phage	52.3	2.0e-45
WP_005898290.1|1894001_1894715_-	hypothetical protein	NA	A0A0E3U2P7	Fusobacterium_phage	53.0	7.6e-53
WP_005898288.1|1894726_1895470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005898287.1|1895472_1896129_-	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	38.0	8.1e-25
WP_005898286.1|1896129_1897188_-|plate	baseplate J/gp47 family protein	plate	A0A0A7RUN3	Clostridium_phage	41.4	3.6e-67
WP_005898285.1|1897184_1897637_-	DUF2634 domain-containing protein	NA	NA	NA	NA	NA
WP_005898283.1|1897615_1898140_-	DUF2577 family protein	NA	NA	NA	NA	NA
WP_005898282.1|1898132_1899113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005898281.1|1899122_1899668_-	hypothetical protein	NA	A0A2H4J2N2	uncultured_Caudovirales_phage	32.1	1.7e-07
WP_005898280.1|1899682_1902034_-	hypothetical protein	NA	A0A0E3Y5G6	Fusobacterium_phage	34.7	9.3e-31
WP_005898279.1|1902107_1902353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005898277.1|1902572_1902962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005898276.1|1902975_1903407_-|tail	phage tail tube protein	tail	A0A1V0DZX1	Clostridioides_phage	39.6	3.4e-24
WP_005898275.1|1903419_1904484_-|terminase	terminase	terminase	A0A0A8WJL8	Clostridium_phage	34.3	1.1e-50
WP_005898273.1|1904497_1904938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005898272.1|1904937_1905357_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_005898271.1|1905361_1905697_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_005898270.1|1905689_1905983_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0A7S0C9	Clostridium_phage	41.1	1.9e-10
WP_005898269.1|1905994_1907101_-|capsid	phage major capsid protein	capsid	Q2I8F7	Bacillus_phage	34.0	1.9e-42
WP_005898268.1|1907105_1907816_-|protease	Clp protease ClpP	protease	J9QE31	Clostridium_phage	37.1	3.4e-37
WP_167337487.1|1907808_1908963_-|portal	phage portal protein	portal	A6M949	Geobacillus_virus	46.6	1.1e-93
WP_005898266.1|1909019_1910744_-|terminase	terminase large subunit	terminase	A0A0A7RVS5	Clostridium_phage	49.7	2.1e-157
WP_005898265.1|1910744_1911230_-|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_005898264.1|1911367_1911778_-	hypothetical protein	NA	Q0SPJ9	Clostridium_phage	35.6	5.2e-14
WP_032842736.1|1912032_1912467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005898257.1|1912574_1912766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005898255.1|1912789_1912972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005898253.1|1912972_1913410_-	DUF3310 domain-containing protein	NA	Q7Y4J5	Streptococcus_phage	51.5	4.1e-09
WP_005898251.1|1913974_1915894_-	ATP-binding protein	NA	A0A2H4J1M0	uncultured_Caudovirales_phage	27.6	1.4e-48
WP_005898248.1|1915924_1917688_-	hypothetical protein	NA	A0A2H4J041	uncultured_Caudovirales_phage	36.2	1.3e-85
WP_005898245.1|1917765_1918182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005898243.1|1918366_1919023_-	ATP-binding protein	NA	A0A0A1ENB5	Lactobacillus_phage	38.8	5.2e-40
WP_005898241.1|1919060_1919723_-	hypothetical protein	NA	A0A0A7RW33	Clostridium_phage	55.9	3.3e-34
WP_005898239.1|1919770_1920703_-	YqaJ viral recombinase family protein	NA	NA	NA	NA	NA
WP_005898237.1|1920695_1921901_-	DEAD/DEAH box helicase	NA	A0A2H4J064	uncultured_Caudovirales_phage	26.9	2.4e-30
WP_005898235.1|1921897_1922221_-	VRR-NUC domain-containing protein	NA	A0A2H4J095	uncultured_Caudovirales_phage	46.3	3.6e-10
WP_005898234.1|1922264_1922447_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005898230.1|1922439_1922775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143827553.1|1922767_1922887_-	phage antirepressor KilAC domain-containing protein	NA	A0A1Q1PVU2	Staphylococcus_phage	62.9	2.6e-06
WP_048481037.1|1922876_1923293_-	hypothetical protein	NA	A0A0C5AN66	Paenibacillus_phage	45.6	2.5e-19
WP_005898228.1|1923309_1923516_-	DUF739 family protein	NA	NA	NA	NA	NA
WP_005898222.1|1923945_1924494_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005898220.1|1924477_1925590_+|integrase	site-specific integrase	integrase	A0A172LN96	Lactococcus_phage	28.8	5.8e-23
1925637:1925657	attR	TTTCTGCTATTTTTCTGCTAC	NA	NA	NA	NA
>prophage 3
NZ_LN831027	Fusobacterium nucleatum subsp. polymorphum strain NCTC10562 chromosome 1	2443126	2279138	2288163	2443126		Staphylococcus_phage(33.33%)	7	NA	NA
WP_080542795.1|2279138_2279585_-	hypothetical protein	NA	A0A0H3UZK2	Geobacillus_virus	54.4	1.7e-34
WP_080542796.1|2279629_2280022_-	hypothetical protein	NA	Q331U5	Clostridium_botulinum_C_phage	40.2	8.3e-17
WP_005894649.1|2281122_2283660_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	34.3	9.5e-13
WP_005894652.1|2283671_2284226_-	cupin domain-containing protein	NA	A0A1W6JPB6	Staphylococcus_phage	40.3	6.0e-05
WP_005894654.1|2284245_2285442_-	competence/damage-inducible protein A	NA	B5TK85	Pseudomonas_phage	40.0	6.7e-17
WP_005894657.1|2285452_2285968_-	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
WP_032842642.1|2285967_2288163_-	DUF3656 domain-containing protein	NA	Q6DW11	Phage_TP	27.7	1.2e-24
