The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012871	[Enterobacter] lignolyticus strain G5 chromosome, complete genome	4702949	1212040	1277684	4702949	terminase,lysis,tail,integrase,head,plate,protease,tRNA,portal,capsid,holin	Escherichia_phage(21.62%)	84	1236149:1236169	1279102:1279122
WP_044612164.1|1212040_1212664_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_013367273.1|1212634_1213321_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.5e-32
WP_062740523.1|1213317_1215732_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_062740524.1|1216164_1216608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062740525.1|1216885_1217974_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_062740526.1|1218068_1219139_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_062740527.1|1219135_1219645_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_062740528.1|1219820_1220006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062740529.1|1220076_1220286_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_062740530.1|1220437_1221160_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_013367264.1|1221163_1221658_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_062740531.1|1221830_1223216_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	1.5e-44
WP_062740532.1|1223273_1224290_-	Mal regulon transcriptional regulator MalI	NA	NA	NA	NA	NA
WP_062740533.1|1224381_1225881_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_013367260.1|1226114_1226327_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_062740534.1|1226328_1227195_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	38.1	2.9e-30
WP_125451925.1|1227263_1227560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013367258.1|1227556_1228108_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_062742455.1|1228180_1228726_+	type 1 fimbrial protein subunit FimI	NA	NA	NA	NA	NA
WP_062740536.1|1228773_1229466_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_062740537.1|1229465_1232045_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_125451927.1|1232034_1233033_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_062740538.1|1233049_1233568_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_013367252.1|1233612_1234245_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
WP_062740539.1|1235008_1235701_-	hypothetical protein	NA	NA	NA	NA	NA
1236149:1236169	attL	AATCCTATAGGGCGTGCCATT	NA	NA	NA	NA
WP_062740540.1|1236331_1237528_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	53.9	1.5e-122
WP_062740541.1|1237686_1238646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028018417.1|1238781_1238979_+	AlpA family transcriptional regulator	NA	B7SYF9	Stenotrophomonas_phage	46.3	3.9e-07
WP_062740542.1|1239082_1239679_+	hypothetical protein	NA	A0A1X9SFL9	Acinetobacter_phage	53.4	3.3e-17
WP_164504972.1|1239678_1239852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062740543.1|1239957_1240290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062740544.1|1240282_1240639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062740545.1|1240635_1241058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062740546.1|1241059_1241923_-	ORF6N domain-containing protein	NA	F1C5A3	Cronobacter_phage	81.5	2.7e-137
WP_062740547.1|1241935_1242439_-	hypothetical protein	NA	F1C5A2	Cronobacter_phage	60.5	5.4e-53
WP_062740548.1|1242438_1242792_-	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	70.0	1.5e-38
WP_062740549.1|1242898_1243285_-	S24 family peptidase	NA	F1C5A0	Cronobacter_phage	60.8	2.9e-38
WP_062740550.1|1243349_1243655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062740551.1|1243817_1244543_-	helix-turn-helix transcriptional regulator	NA	A0A2D1GM27	Escherichia_phage	54.2	2.8e-66
WP_071886702.1|1244652_1244880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062740552.1|1244928_1245861_+	hypothetical protein	NA	C5IHL2	Burkholderia_virus	36.2	2.2e-36
WP_062740553.1|1245964_1247836_+	AAA family ATPase	NA	Q5G8S8	Enterobacteria_phage	59.7	2.4e-223
WP_062740554.1|1247838_1248699_+	hypothetical protein	NA	A0A1B5FPA6	Escherichia_phage	82.5	2.1e-134
WP_062742457.1|1248776_1249133_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.8	1.7e-56
WP_062740555.1|1249172_1249964_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_062740556.1|1250131_1250395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053883925.1|1251034_1251430_+	hypothetical protein	NA	G8C7V8	Escherichia_phage	75.4	5.0e-46
WP_053883923.1|1251416_1251698_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	72.0	7.7e-33
WP_062740557.1|1251712_1252189_+	glycoside hydrolase family 104 protein	NA	A5VW81	Enterobacteria_phage	88.4	2.1e-75
WP_062740558.1|1252185_1252665_+|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	58.4	2.9e-40
WP_062740559.1|1252665_1252962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062740560.1|1253044_1253332_+	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	62.1	1.3e-30
WP_062740561.1|1253427_1253790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062742458.1|1253868_1254510_+	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	31.1	9.1e-05
WP_062740562.1|1254517_1254871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062740563.1|1255112_1255676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062740564.1|1255617_1257741_+|terminase	terminase	terminase	A0A2K9V3X4	Faecalibacterium_phage	35.2	2.9e-100
WP_062740565.1|1257749_1258010_+|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_062740566.1|1258009_1259647_+|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	34.9	8.6e-92
WP_062740567.1|1259643_1260513_+	S49 family peptidase	NA	K4I1N3	Providencia_phage	39.7	4.6e-52
WP_062740568.1|1260514_1261096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062740569.1|1261095_1261497_+|head	head decoration protein	head	NA	NA	NA	NA
WP_062740570.1|1261602_1262652_+|capsid	major capsid protein	capsid	V5Q8X6	Xylella_phage	30.0	4.0e-42
WP_062740571.1|1262653_1262956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062740572.1|1262960_1263320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062740573.1|1263316_1263862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062740574.1|1263865_1264063_+	DUF2635 domain-containing protein	NA	A0A2P9JZJ7	Alteromonadaceae_phage	54.4	5.4e-09
WP_062740575.1|1264059_1265562_+|tail	phage tail protein	tail	A0A192Y7L1	Salmonella_phage	40.7	2.2e-94
WP_062740576.1|1265565_1265937_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_062740577.1|1265938_1266217_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_062740578.1|1266358_1268164_+	lytic transglycosylase domain-containing protein	NA	I6ZXX9	Escherichia_phage	45.8	2.1e-30
WP_062740579.1|1268211_1268778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062740580.1|1268851_1270252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062740581.1|1270248_1271334_+|tail	phage tail protein	tail	M1PVV2	Vibrio_phage	33.5	8.6e-48
WP_062740582.1|1271330_1271915_+|plate	phage baseplate assembly protein	plate	A0A077KAY0	Edwardsiella_phage	32.9	7.5e-06
WP_062740583.1|1271911_1272349_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	44.7	9.5e-14
WP_062740584.1|1272350_1273493_+|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	29.2	2.4e-24
WP_062740585.1|1273489_1274083_+	YmfQ family protein	NA	NA	NA	NA	NA
WP_062740586.1|1274137_1274875_+	hypothetical protein	NA	K7P7Q7	Enterobacteria_phage	32.2	9.1e-17
WP_062740587.1|1274874_1275462_+|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	53.2	5.2e-07
WP_071886705.1|1275552_1275831_-	DUF3761 domain-containing protein	NA	NA	NA	NA	NA
WP_164504973.1|1276015_1276180_-	hypothetical protein	NA	G9L672	Escherichia_phage	70.4	1.3e-11
WP_062740588.1|1276182_1277229_-	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	81.3	9.8e-174
WP_062740589.1|1277222_1277684_-	hypothetical protein	NA	G9L674	Escherichia_phage	85.0	1.1e-65
1279102:1279122	attR	AATCCTATAGGGCGTGCCATT	NA	NA	NA	NA
>prophage 2
NZ_CP012871	[Enterobacter] lignolyticus strain G5 chromosome, complete genome	4702949	2538676	2547487	4702949	tRNA	Tupanvirus(33.33%)	10	NA	NA
WP_062741302.1|2538676_2539228_-	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	33.7	3.3e-19
WP_062741303.1|2539257_2540238_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_006820203.1|2540340_2540640_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_013366086.1|2540644_2543032_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	26.0	3.6e-06
WP_013366085.1|2543047_2544031_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	3.8e-34
WP_001386830.1|2544145_2544190_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_013366084.1|2544311_2544668_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|2544717_2544915_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_013366083.1|2545012_2545555_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.1	3.7e-15
WP_013366082.1|2545558_2547487_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.8	3.3e-127
>prophage 3
NZ_CP012871	[Enterobacter] lignolyticus strain G5 chromosome, complete genome	4702949	2943135	2951180	4702949		Bodo_saltans_virus(16.67%)	7	NA	NA
WP_013365671.1|2943135_2943735_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	30.6	9.7e-17
WP_013365670.1|2943870_2944875_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.9	3.7e-29
WP_013365669.1|2944922_2946089_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	55.0	5.7e-114
WP_013365668.1|2946318_2947725_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	27.8	1.8e-37
WP_164504986.1|2948191_2948947_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_125451996.1|2948943_2950080_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	29.4	3.5e-23
WP_013365665.1|2950076_2951180_-	acyltransferase	NA	Q716G0	Shigella_phage	28.1	4.9e-14
>prophage 4
NZ_CP012871	[Enterobacter] lignolyticus strain G5 chromosome, complete genome	4702949	2959479	2967762	4702949		Enterobacteria_phage(42.86%)	8	NA	NA
WP_062741490.1|2959479_2960712_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	6.6e-12
WP_062741491.1|2960701_2961478_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_013365656.1|2961487_2962042_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	53.6	1.9e-51
WP_062741492.1|2962048_2962930_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.8	1.6e-39
WP_013365654.1|2962929_2963811_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	68.1	3.1e-112
WP_071886775.1|2963824_2964913_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.6	6.1e-102
WP_044611922.1|2965306_2966209_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	40.0	4.4e-45
WP_062741494.1|2966355_2967762_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.3	2.1e-17
>prophage 5
NZ_CP012871	[Enterobacter] lignolyticus strain G5 chromosome, complete genome	4702949	3456514	3519924	4702949	tRNA,plate,tail	Escherichia_phage(22.86%)	66	NA	NA
WP_044611907.1|3456514_3457045_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_062741710.1|3457064_3457727_-	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_062741711.1|3457973_3458822_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013365200.1|3458878_3459139_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	50.0	2.5e-17
WP_013365199.1|3459135_3459516_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_062741712.1|3459515_3460247_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_062741713.1|3460258_3460987_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_013365196.1|3460997_3461903_-	GTPase Era	NA	NA	NA	NA	NA
WP_013365195.1|3461899_3462580_-	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	32.6	1.8e-19
WP_062741714.1|3462803_3463778_-	signal peptidase I	NA	NA	NA	NA	NA
WP_013365193.1|3463794_3465594_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.9	6.5e-24
WP_013365192.1|3465779_3466259_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_013365191.1|3466255_3467209_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_013365190.1|3467208_3467859_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_006176728.1|3467890_3468466_-	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	28.1	8.2e-05
WP_044612074.1|3468888_3470508_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_013365188.1|3470492_3471230_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_013365187.1|3471361_3472696_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	29.3	9.6e-41
WP_062741715.1|3472722_3473607_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013365184.1|3474407_3474791_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	69.9	1.8e-32
WP_062742505.1|3475109_3475799_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.2e-55
WP_013365182.1|3475831_3476890_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_013365181.1|3477094_3477523_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	39.3	7.9e-13
WP_044611905.1|3477592_3478291_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_062741716.1|3478326_3480975_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_013365178.1|3481100_3482456_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_062741717.1|3482500_3482821_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_062742506.1|3482824_3484123_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.7	9.1e-44
WP_062741718.1|3489988_3492562_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	2.2e-126
WP_062741719.1|3492690_3493422_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_013365173.1|3493418_3494399_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_062741720.1|3494529_3495267_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_013365171.1|3495545_3495878_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_121497579.1|3495983_3496031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062741721.1|3496130_3497291_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_013365169.1|3497392_3498514_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_062741722.1|3498524_3499595_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	52.4	5.6e-92
WP_013365167.1|3499941_3500535_+	YfiR family protein	NA	NA	NA	NA	NA
WP_013365166.1|3500527_3501748_+	diguanylate cyclase DgcN	NA	A0A127AWB9	Bacillus_phage	31.7	4.4e-08
WP_013365165.1|3501765_3502248_+	OmpA family protein	NA	NA	NA	NA	NA
WP_062741723.1|3502255_3503620_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_062741724.1|3503673_3504084_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_062741725.1|3504214_3505066_-	phage repressor protein CI	NA	A0A0M4RE65	Salmonella_phage	59.9	1.4e-90
WP_062741726.1|3505337_3505673_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	62.5	4.3e-30
WP_013365160.1|3505739_3505955_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_071886737.1|3505954_3506179_+	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	63.4	8.6e-19
WP_062741727.1|3506175_3508149_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	62.8	8.7e-240
WP_013365157.1|3508252_3508435_+	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	78.3	2.8e-20
WP_062742507.1|3508591_3508795_+|tail	phage tail protein	tail	S4TTA0	Salmonella_phage	70.1	2.4e-20
WP_013365155.1|3508785_3508992_+	primosomal protein	NA	A0A218M4L5	Erwinia_phage	77.6	1.0e-18
WP_062741728.1|3508988_3509495_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	69.0	4.0e-64
WP_062741729.1|3509494_3509920_+	hypothetical protein	NA	O80310	Escherichia_phage	48.9	3.8e-23
WP_062741730.1|3510015_3510483_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	58.1	1.8e-42
WP_062741731.1|3510569_3511205_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	71.1	5.7e-84
WP_013365149.1|3511201_3511549_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	74.6	7.0e-44
WP_062741732.1|3511552_3512461_+|plate	baseplate assembly protein	plate	Q858V6	Yersinia_virus	80.5	5.8e-130
WP_062741733.1|3512453_3512993_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	77.1	5.4e-83
WP_062741734.1|3512995_3514078_+	hypothetical protein	NA	A0A0M3ULH6	Salmonella_phage	31.1	4.9e-59
WP_013365141.1|3514261_3515452_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	86.1	4.5e-199
WP_013365140.1|3515464_3515983_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	89.0	4.5e-87
WP_062741735.1|3516038_3516320_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	82.6	1.2e-30
WP_013365138.1|3516352_3516472_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	84.6	4.8e-13
WP_062741736.1|3516464_3518099_+	hypothetical protein	NA	Q858U7	Yersinia_virus	25.5	6.5e-47
WP_062741737.1|3518117_3518585_+|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	60.7	3.7e-48
WP_062741738.1|3518584_3519661_+	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	51.0	2.5e-100
WP_071886776.1|3519735_3519924_+	late control protein B	NA	Q37973	Salmonella_virus	78.8	1.9e-19
>prophage 6
NZ_CP012871	[Enterobacter] lignolyticus strain G5 chromosome, complete genome	4702949	3730543	3739705	4702949	tRNA,integrase	uncultured_phage(16.67%)	7	3724475:3724489	3741462:3741476
3724475:3724489	attL	CCTGCTGGCGGAACA	NA	NA	NA	NA
WP_062741877.1|3730543_3732496_-|integrase	site-specific integrase	integrase	A0A059XK29	uncultured_phage	22.2	2.1e-07
WP_044612062.1|3732739_3733453_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV79	Clostridium_phage	34.2	2.5e-11
WP_013364889.1|3733614_3735135_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_013364888.1|3735144_3736243_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	40.7	1.4e-05
WP_062741879.1|3736333_3738067_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	8.3e-61
WP_013364886.1|3738072_3738786_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_062741881.1|3738808_3739705_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.9	3.0e-30
3741462:3741476	attR	TGTTCCGCCAGCAGG	NA	NA	NA	NA
