The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013352	Clostridium butyricum strain JKY6D1 chromosome 1, complete sequence	3819894	387949	460474	3819894	transposase,tRNA,protease,coat	Bacillus_phage(22.22%)	54	NA	NA
WP_058141691.1|387949_389533_-|transposase	IS1182 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	33.1	9.9e-61
WP_002582780.1|389815_391165_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_003429873.1|391170_391617_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_003429871.1|391835_394253_+	triple tyrosine motif-containing protein	NA	NA	NA	NA	NA
WP_058141692.1|394307_395135_+	lytic transglycosylase domain-containing protein	NA	A0A0H4TGB4	Bacillus_phage	41.1	6.6e-24
WP_024038780.1|395376_396093_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_058141693.1|396686_400040_+	intein-containing ATP-dependent DNA helicase PcrA	NA	A7KV33	Bacillus_phage	26.1	3.4e-87
WP_058141694.1|400215_402207_+	NAD-dependent DNA ligase LigA	NA	A0A0A8J9A9	Ralstonia_phage	33.9	9.5e-85
WP_024038777.1|402211_402484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003410901.1|402794_403085_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_058141695.1|403106_404564_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_002582790.1|404583_406014_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_002582791.1|406068_406371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024038775.1|406574_408062_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_058141696.1|408117_409860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058141697.1|409954_410932_+	AIR synthase	NA	NA	NA	NA	NA
WP_058141698.1|411003_411618_+	XTP/dITP diphosphatase	NA	A0A0P0A2M4	Ugandan_cassava_brown_streak_virus	31.1	4.2e-07
WP_002582796.1|411640_412126_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_002582797.1|414630_415500_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_058371729.1|415696_416584_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_058141699.1|416596_417484_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_058141700.1|417494_419654_+	1,3-beta-galactosyl-N-acetylhexosamine phosphorylase	NA	NA	NA	NA	NA
WP_058141701.1|419912_421259_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_035764899.1|421322_422279_+	ATPase	NA	NA	NA	NA	NA
WP_003429739.1|422313_423453_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_002582805.1|423756_424233_+	PTS N-acetylgalactosamine transporter subunit IIB	NA	NA	NA	NA	NA
WP_002582806.1|424264_425035_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002582807.1|425024_425870_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002582808.1|426005_426752_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058141703.1|426853_428014_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002582810.1|428032_428464_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002582811.1|428509_429364_+	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
WP_002582812.1|431300_433346_+	M13 family metallopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	32.8	1.7e-84
WP_002582338.1|438960_439908_+	polysaccharide deacetylase	NA	NA	NA	NA	NA
WP_002582337.1|440211_440697_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_002582336.1|440701_441535_+	DUF3298 and DUF4163 domain-containing protein	NA	NA	NA	NA	NA
WP_002582335.1|441925_443305_+	TldD/PmbA family protein	NA	NA	NA	NA	NA
WP_043853366.1|443307_444651_+	TldD/PmbA family protein	NA	NA	NA	NA	NA
WP_002582333.1|444740_445532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033127208.1|445654_446614_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_002582331.1|446653_447217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035764760.1|447234_447867_-	RusA family crossover junction endodeoxyribonuclease	NA	NA	NA	NA	NA
WP_002582329.1|448236_449256_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.6	2.5e-65
WP_043853365.1|449264_450269_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_002582327.1|450383_451610_+|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	27.2	2.0e-21
WP_003412645.1|451745_452063_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002582325.1|452142_452502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043853364.1|452623_453766_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002582323.1|453835_454960_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_035764142.1|455107_456124_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_080630488.1|456095_456872_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003429682.1|457051_458086_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_002582319.1|458245_459367_-	glycosyltransferase family 4 protein	NA	A0A2K9VGK0	Pontimonas_phage	40.3	5.0e-06
WP_002582318.1|459475_460474_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
>prophage 2
NZ_CP013352	Clostridium butyricum strain JKY6D1 chromosome 1, complete sequence	3819894	1214702	1224793	3819894		Prochlorococcus_phage(42.86%)	7	NA	NA
WP_058141824.1|1214702_1218449_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	24.5	1.2e-32
WP_002579500.1|1218705_1219185_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	43.7	1.3e-27
WP_002579501.1|1219184_1219892_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SLB8	Cyanophage	44.8	2.1e-47
WP_002579502.1|1219999_1221412_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.8	1.1e-55
WP_035762527.1|1221503_1222508_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	45.4	1.5e-67
WP_058141825.1|1222495_1223104_+	phosphoribosylglycinamide formyltransferase	NA	R9S626	Prochlorococcus_phage	37.5	3.7e-24
WP_002579505.1|1223284_1224793_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	46.0	1.8e-35
>prophage 3
NZ_CP013352	Clostridium butyricum strain JKY6D1 chromosome 1, complete sequence	3819894	1766372	1834341	3819894	transposase,tRNA,protease	Staphylococcus_prophage(16.67%)	57	NA	NA
WP_002580000.1|1766372_1767578_+|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002580001.1|1767611_1768499_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_002580002.1|1768577_1769123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003411964.1|1769333_1770044_+	membrane protein	NA	NA	NA	NA	NA
WP_058371746.1|1770219_1771803_-|transposase	IS1182 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	33.1	9.9e-61
WP_002580004.1|1772345_1772651_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_003411899.1|1772682_1774779_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_002580006.1|1774845_1775283_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_058141931.1|1775500_1777471_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_002580008.1|1777691_1778549_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_002580009.1|1778918_1780580_+	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_002580010.1|1780945_1781485_+	2'-5' RNA ligase family protein	NA	NA	NA	NA	NA
WP_080646785.1|1781785_1784524_+	calcium-translocating P-type ATPase, PMCA-type	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	32.3	1.8e-102
WP_002580012.1|1784749_1785067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002580013.1|1785164_1785656_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_024040156.1|1785699_1786284_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_002580015.1|1786555_1787935_+	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_002580016.1|1787924_1789373_+	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
WP_058141932.1|1789544_1790261_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_002580018.1|1790429_1791326_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058141933.1|1791415_1792732_+	polynucleotide adenylyltransferase	NA	H7BUW3	unidentified_phage	38.1	4.8e-69
WP_003427727.1|1792887_1793151_+	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_046057737.1|1793311_1795348_+	penicillin-binding transpeptidase domain-containing protein	NA	NA	NA	NA	NA
WP_058141934.1|1795667_1798895_+	sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.2	2.5e-18
WP_058141935.1|1798964_1800335_-	iron hydrogenase	NA	NA	NA	NA	NA
WP_058141936.1|1800661_1801204_+|protease	collagenolytic protease	protease	NA	NA	NA	NA
WP_058141937.1|1801646_1803044_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_058141938.1|1803107_1803710_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002580027.1|1803973_1804471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035761877.1|1804608_1805535_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_002580029.1|1805579_1806500_-	DMT family transporter	NA	NA	NA	NA	NA
WP_058141939.1|1806660_1807272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002580031.1|1807648_1809316_+	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_058141940.1|1809401_1810463_+	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_003411879.1|1810608_1812141_+	cell wall-binding protein	NA	NA	NA	NA	NA
WP_058141644.1|1812165_1813545_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_002579879.1|1813978_1815115_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_024040140.1|1815318_1816368_+	M42 family metallopeptidase	NA	NA	NA	NA	NA
WP_058141941.1|1816410_1817373_+	DUF2232 domain-containing protein	NA	NA	NA	NA	NA
WP_058141942.1|1817464_1818265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058141943.1|1818525_1820634_+	carbohydrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_058141944.1|1820712_1821267_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_058141945.1|1821444_1822401_+	cobalamin biosynthesis protein P47K	NA	NA	NA	NA	NA
WP_002580040.1|1822472_1823096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002580041.1|1823121_1824120_+	permease	NA	NA	NA	NA	NA
WP_002580042.1|1824197_1824935_+	TIGR03943 family protein	NA	NA	NA	NA	NA
WP_002580043.1|1824968_1825532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003427677.1|1825753_1826620_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	44.4	8.7e-51
WP_058141946.1|1827171_1827543_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_058141947.1|1827750_1828206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125390888.1|1828343_1829291_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_058141948.1|1829419_1829902_+	glyoxalase	NA	NA	NA	NA	NA
WP_058141949.1|1829977_1830433_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_058141950.1|1830674_1831598_+	homocysteine S-methyltransferase family protein	NA	NA	NA	NA	NA
WP_045143990.1|1831634_1832249_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_024040124.1|1832336_1832711_+	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
WP_033127508.1|1833102_1834341_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	51.9	3.0e-52
>prophage 4
NZ_CP013352	Clostridium butyricum strain JKY6D1 chromosome 1, complete sequence	3819894	1873220	1881310	3819894		Clostridium_phage(37.5%)	16	NA	NA
WP_058371755.1|1873220_1873727_-	helix-turn-helix transcriptional regulator	NA	Q0SPH9	Clostridium_phage	39.5	6.1e-12
WP_155594175.1|1873955_1874105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058371756.1|1874105_1874405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035764050.1|1874373_1874559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155594176.1|1875285_1875453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035764048.1|1875478_1875718_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A0K2CZ86	Paenibacillus_phage	60.3	9.8e-21
WP_058371757.1|1875943_1876801_+	hypothetical protein	NA	Q0SPI6	Clostridium_phage	40.5	5.8e-47
WP_043852896.1|1876793_1877168_+	VRR-NUC domain-containing protein	NA	A0A2D1GNH3	Pseudomonas_phage	44.3	1.0e-16
WP_035764044.1|1877195_1877354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058371758.1|1877399_1878167_+	ParA family protein	NA	H7BUL8	unidentified_phage	39.1	1.8e-47
WP_058371759.1|1878172_1879165_+	ParB/RepB/Spo0J family partition protein	NA	H7BVD1	unidentified_phage	30.0	1.5e-22
WP_058371760.1|1879214_1879631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043666071.1|1879646_1879922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058371761.1|1879905_1880529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035764036.1|1880521_1880950_+	single-stranded DNA-binding protein	NA	A1EAD1	Streptococcus_phage	51.9	3.7e-26
WP_035764034.1|1880965_1881310_+	hypothetical protein	NA	Q0SPI5	Clostridium_phage	52.6	1.2e-22
>prophage 5
NZ_CP013352	Clostridium butyricum strain JKY6D1 chromosome 1, complete sequence	3819894	1884366	1901000	3819894	head,terminase,capsid,tail,protease,portal	Bacillus_virus(28.57%)	21	NA	NA
WP_035764109.1|1884366_1884861_+	hypothetical protein	NA	I2E8Y5	Clostridium_phage	39.9	9.1e-29
WP_035764028.1|1885015_1885318_+	HNH endonuclease	NA	A0A2I7SC48	Paenibacillus_phage	62.4	4.4e-26
WP_043666037.1|1885403_1885787_+|terminase	terminase	terminase	Q0H265	Geobacillus_phage	45.3	1.2e-15
WP_058371944.1|1885776_1887543_+|terminase	terminase large subunit	terminase	A0A0S2SXJ7	Bacillus_phage	75.7	2.3e-268
WP_035764025.1|1887600_1888806_+|portal	phage portal protein	portal	A6XMJ5	Bacillus_virus	66.8	4.0e-155
WP_058371767.1|1888798_1889377_+|head,protease	HK97 family phage prohead protease	head,protease	Q0H262	Geobacillus_phage	72.5	2.5e-70
WP_058371768.1|1889366_1890779_+|capsid	phage major capsid protein	capsid	A6XMJ6	Bacillus_virus	59.5	1.2e-118
WP_035764019.1|1890792_1891077_+	hypothetical protein	NA	A6XMJ7	Bacillus_virus	41.6	3.6e-06
WP_035764017.1|1891089_1891374_+	hypothetical protein	NA	Q0H259	Geobacillus_phage	71.0	4.6e-33
WP_058371769.1|1891373_1891694_+	hypothetical protein	NA	A6XMK0	Bacillus_virus	46.2	1.4e-19
WP_035764014.1|1891686_1892043_+	hypothetical protein	NA	A0A290FZT5	Caldibacillus_phage	50.0	2.9e-21
WP_058371770.1|1892039_1892369_+	hypothetical protein	NA	A6XMK2	Bacillus_virus	59.6	3.0e-28
WP_058371771.1|1892370_1892940_+|tail	phage tail protein	tail	A0A0U4JWV5	Exiguobacterium_phage	61.8	8.8e-60
WP_043666011.1|1892951_1893293_+	hypothetical protein	NA	A0A290GJX3	Caldibacillus_phage	63.7	3.1e-36
WP_153741809.1|1893322_1893496_+	hypothetical protein	NA	Q0H231	Geobacillus_phage	54.0	2.6e-07
WP_058371772.1|1893515_1896422_+	hypothetical protein	NA	A6XMK6	Bacillus_virus	48.7	4.7e-133
WP_058371773.1|1896421_1897126_+|tail	phage tail protein	tail	A0A1L2BYA2	Clostridium_phage	51.9	7.8e-66
WP_058371774.1|1897125_1898814_+	hypothetical protein	NA	A0A1L2BYA1	Clostridium_phage	56.1	1.1e-158
WP_058371775.1|1898829_1899675_+	hypothetical protein	NA	A0A1L2BYA7	Clostridium_phage	74.5	1.0e-51
WP_058371776.1|1899703_1900216_+	hypothetical protein	NA	A0A0U4IVC6	Arthrobacter_phage	51.9	3.1e-16
WP_058371777.1|1900229_1901000_+	hypothetical protein	NA	A0A0Y0AE86	Bacillus_phage	33.7	4.4e-06
>prophage 6
NZ_CP013352	Clostridium butyricum strain JKY6D1 chromosome 1, complete sequence	3819894	2277129	2282549	3819894	integrase	Clostridium_phage(28.57%)	8	2276479:2276493	2284920:2284934
2276479:2276493	attL	ATTTATATTTTCATT	NA	NA	NA	NA
WP_058371829.1|2277129_2277846_-	hypothetical protein	NA	S5MP04	Brevibacillus_phage	41.4	1.2e-24
WP_033128325.1|2277877_2278117_-	AbrB family transcriptional regulator	NA	A0A2I7SC16	Paenibacillus_phage	44.6	2.4e-11
WP_058371946.1|2278171_2278819_-	AAA family ATPase	NA	Q0H276	Geobacillus_phage	41.2	1.8e-32
WP_058371830.1|2278847_2279918_-	DnaD domain protein	NA	V5UQV4	Oenococcus_phage	41.6	3.1e-21
WP_002580423.1|2280162_2280465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033128322.1|2280551_2280782_-	DUF739 family protein	NA	A0A0A7RTP5	Clostridium_phage	56.8	5.0e-14
WP_058371831.1|2280935_2281418_+	helix-turn-helix transcriptional regulator	NA	A0A0A7RTR3	Clostridium_phage	55.5	1.9e-23
WP_058229741.1|2281445_2282549_+|integrase	site-specific integrase	integrase	A0A0U3U8Y8	Bacillus_phage	27.2	8.9e-16
2284920:2284934	attR	ATTTATATTTTCATT	NA	NA	NA	NA
>prophage 7
NZ_CP013352	Clostridium butyricum strain JKY6D1 chromosome 1, complete sequence	3819894	2814982	2867828	3819894	transposase,terminase,integrase,capsid,holin,portal	Clostridium_phage(68.97%)	53	2818176:2818191	2869862:2869877
WP_002581975.1|2814982_2816566_-|transposase	IS1182-like element ISClbu1 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	33.1	9.9e-61
WP_002581048.1|2816670_2817315_-	fructose-6-phosphate aldolase	NA	A0A0E3HNZ3	Synechococcus_phage	47.7	3.0e-48
WP_002581049.1|2817380_2818088_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
2818176:2818191	attL	AATCTTATTTTTGCTT	NA	NA	NA	NA
WP_002581050.1|2818189_2819113_-	transketolase family protein	NA	NA	NA	NA	NA
WP_003424913.1|2819132_2819948_-	transketolase	NA	G9E5U1	Micromonas_pusilla_virus	34.5	2.2e-16
WP_035779099.1|2819987_2821178_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_058146450.1|2821374_2822577_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_002581053.1|2822697_2823099_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_058146452.1|2823160_2824363_-	Na+ dependent nucleoside transporter domain-containing protein	NA	NA	NA	NA	NA
WP_003424907.1|2824563_2825349_-	uridine phosphorylase	NA	NA	NA	NA	NA
WP_002581056.1|2825676_2825928_-	hypothetical protein	NA	A0A0A7RW97	Clostridium_phage	54.4	1.4e-17
WP_002581057.1|2826103_2826739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058146880.1|2826913_2827594_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003424904.1|2827595_2828243_-	fructose-6-phosphate aldolase	NA	E3SNX1	Prochlorococcus_phage	47.7	1.1e-47
WP_043662954.1|2828290_2829217_-	transketolase family protein	NA	NA	NA	NA	NA
WP_058146454.1|2829236_2830052_-	transketolase	NA	G9E5U1	Micromonas_pusilla_virus	37.0	1.5e-15
WP_002581062.1|2830112_2830976_-	L-ribulose-5-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_002581063.1|2831058_2831748_-	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_058146456.1|2831864_2832893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002581065.1|2832926_2833220_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002581066.1|2833245_2834703_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_002581067.1|2834731_2835190_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_027636241.1|2835319_2836384_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_002581069.1|2836769_2837549_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_058146663.1|2837744_2839328_-|transposase	IS1182 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	33.1	1.7e-60
WP_043853196.1|2839450_2840764_-	sodium-dependent transporter	NA	NA	NA	NA	NA
WP_002581071.1|2841158_2841482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002581072.1|2841644_2842424_-	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_058371851.1|2843060_2843696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058371852.1|2843793_2844465_-	hypothetical protein	NA	M9Q2L2	Clostridium_phage	36.1	1.3e-14
WP_155594183.1|2844604_2844814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058371854.1|2844857_2845682_-	hypothetical protein	NA	Q0SPG7	Clostridium_phage	42.6	2.3e-32
WP_058371855.1|2845683_2846124_-|holin	phage holin family protein	holin	J9QD30	Clostridium_phage	56.3	6.4e-34
WP_058371856.1|2846184_2851542_-	hypothetical protein	NA	D7RWK2	Brochothrix_phage	26.8	1.3e-27
WP_058371857.1|2851565_2851952_-	hypothetical protein	NA	Q0SPL5	Clostridium_phage	41.4	2.4e-21
WP_058371858.1|2852001_2852259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052501809.1|2852274_2852625_-	hypothetical protein	NA	A0A1S5SF11	Streptococcus_phage	53.0	1.3e-29
WP_058371859.1|2852636_2856305_-	hypothetical protein	NA	M9Q251	Clostridium_phage	56.2	1.5e-14
WP_052501810.1|2856346_2856667_-	hypothetical protein	NA	M9Q2I4	Clostridium_phage	69.9	1.6e-34
WP_058371860.1|2856677_2857013_-	hypothetical protein	NA	M9Q2L0	Clostridium_phage	39.6	8.4e-10
WP_058371861.1|2857028_2857487_-	hypothetical protein	NA	M9Q1I1	Clostridium_phage	70.3	4.4e-54
WP_043853209.1|2857495_2857885_-	hypothetical protein	NA	M9Q2F6	Clostridium_phage	65.9	3.3e-42
WP_058371862.1|2857884_2858259_-	hypothetical protein	NA	M9Q249	Clostridium_phage	63.7	2.4e-37
WP_058371863.1|2858255_2858570_-	hypothetical protein	NA	M9Q2I3	Clostridium_phage	55.1	1.6e-23
WP_058371864.1|2858572_2858926_-	hypothetical protein	NA	M9Q2K9	Clostridium_phage	62.5	2.1e-35
WP_043853213.1|2859278_2860166_-	hypothetical protein	NA	M9Q2F4	Clostridium_phage	66.4	1.2e-108
WP_058371866.1|2860193_2860802_-	hypothetical protein	NA	M9Q248	Clostridium_phage	59.9	2.6e-41
WP_058371867.1|2861137_2862394_-|capsid	capsid protein	capsid	M9Q2F2	Clostridium_phage	61.7	5.3e-142
WP_043853216.1|2862377_2863904_-|portal	phage portal protein	portal	M9Q246	Clostridium_phage	64.5	7.6e-191
WP_058371868.1|2864060_2865425_-|terminase	terminase	terminase	M9Q2I1	Clostridium_phage	76.7	1.0e-202
WP_058371869.1|2865421_2866063_-	hypothetical protein	NA	M9Q2K7	Clostridium_phage	41.7	1.1e-26
WP_043853218.1|2866100_2866673_-	recombinase family protein	NA	A0A219YB42	Aeromonas_phage	42.4	2.0e-32
WP_058371870.1|2867210_2867828_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1L2BY87	Clostridium_phage	36.2	2.1e-22
2869862:2869877	attR	AATCTTATTTTTGCTT	NA	NA	NA	NA
>prophage 9
NZ_CP013352	Clostridium butyricum strain JKY6D1 chromosome 1, complete sequence	3819894	3678555	3690789	3819894	integrase	Erysipelothrix_phage(66.67%)	7	3677369:3677395	3690151:3690177
3677369:3677395	attL	TGGCGGAGAGAAGGGGATTTGAACCCC	NA	NA	NA	NA
WP_058141620.1|3678555_3681504_-	DEAD/DEAH box helicase	NA	A0A2K5B256	Erysipelothrix_phage	47.2	1.3e-234
WP_058371939.1|3681516_3683430_-	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	45.2	2.4e-133
WP_058141625.1|3683483_3684242_-	DUF4391 domain-containing protein	NA	A0A2K5B2C0	Erysipelothrix_phage	23.2	1.2e-06
WP_058146856.1|3684251_3687509_-	helicase	NA	A0A2K5B2B9	Erysipelothrix_phage	50.9	7.3e-300
WP_058141627.1|3688673_3688853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058141629.1|3689022_3689979_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	31.6	7.1e-38
WP_058141631.1|3690339_3690789_-	nucleoside deaminase	NA	A0A2H4PQS8	Staphylococcus_phage	33.1	3.3e-09
3690151:3690177	attR	TGGCGGAGAGAAGGGGATTTGAACCCC	NA	NA	NA	NA
>prophage 10
NZ_CP013352	Clostridium butyricum strain JKY6D1 chromosome 1, complete sequence	3819894	3806212	3812848	3819894	protease,transposase	Faustovirus(16.67%)	7	NA	NA
WP_058141651.1|3806212_3807364_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1X7QGF3	Faustovirus	29.9	8.4e-17
WP_002582832.1|3807420_3807996_+|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	36.0	1.2e-19
WP_002581275.1|3808230_3809562_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	31.2	2.8e-24
WP_002582831.1|3809661_3810183_-	DUF4446 family protein	NA	NA	NA	NA	NA
WP_002582830.1|3810222_3811086_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	35.7	6.5e-14
WP_002582829.1|3811099_3811861_-	ParA family protein	NA	Q8JL10	Natrialba_phage	30.3	1.4e-20
WP_058141652.1|3812068_3812848_-	nucleoid occlusion protein	NA	S5WII0	Leptospira_phage	40.4	4.3e-17
>prophage 1
NZ_CP013353	Clostridium butyricum strain JKY6D1 chromosome 2, complete sequence	790373	567651	662212	790373	tail,protease,plate,transposase,capsid,portal,integrase	Clostridium_phage(32.0%)	108	619917:619934	663381:663398
WP_125390909.1|567651_568675_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_058372112.1|568785_569085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064062221.1|569246_570065_-	EcsC family protein	NA	NA	NA	NA	NA
WP_058372113.1|570771_571749_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_058372114.1|571857_573168_-	sensor histidine kinase	NA	X5JAC0	Clostridium_phage	30.4	1.5e-17
WP_002581243.1|573179_573890_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	37.5	3.7e-31
WP_058372115.1|574061_576656_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_003413325.1|576655_577342_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.6	1.0e-33
WP_043665323.1|577425_578415_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_043665328.1|578401_579088_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_058372116.1|579594_580620_-	arabinogalactan endo-1,4-beta-galactosidase	NA	NA	NA	NA	NA
WP_043853920.1|581032_582031_-	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_043853744.1|582343_584407_-	beta-galactosidase	NA	NA	NA	NA	NA
WP_058372117.1|584580_586125_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_058372118.1|586361_587900_-	DUF3502 domain-containing protein	NA	NA	NA	NA	NA
WP_035764313.1|588097_588988_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_081044150.1|589103_590084_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_058372119.1|590319_591861_+	response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.9	4.0e-06
WP_080775817.1|591772_593632_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.4	5.3e-21
WP_003413637.1|593687_594377_+	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_058372120.1|594583_595027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372121.1|595226_595778_-	hemerythrin	NA	NA	NA	NA	NA
WP_058372123.1|597218_597536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372124.1|597532_597769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372125.1|597863_598067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372126.1|598051_598924_-	ParM/StbA family protein	NA	Q0SPH6	Clostridium_phage	29.7	4.5e-23
WP_125390915.1|599056_599227_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J765	uncultured_Caudovirales_phage	64.3	1.3e-11
WP_058372128.1|599353_599878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003432416.1|600273_600474_-	alpha/beta-type small acid-soluble spore protein	NA	Q77YX0	Bacillus_phage	42.2	2.8e-05
WP_125390911.1|600644_601364_-	hypothetical protein	NA	A0A0A7S0U2	Clostridium_phage	35.8	1.5e-24
WP_058372130.1|601363_601726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372131.1|601676_602744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003414383.1|603049_603229_-	hypothetical protein	NA	A0A2H4J069	uncultured_Caudovirales_phage	75.0	3.6e-12
WP_058372132.1|603688_605311_-	hypothetical protein	NA	I3VYU6	Thermoanaerobacterium_phage	33.1	7.4e-19
WP_058372133.1|605361_605685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035763532.1|605702_605915_-	hemolysin XhlA	NA	NA	NA	NA	NA
WP_058372134.1|606208_606508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372136.1|607529_608147_-	YmfQ family protein	NA	A0A0A7RTU9	Clostridium_phage	40.2	4.4e-41
WP_064062222.1|608147_610040_-	hypothetical protein	NA	A0A0A7S1G0	Clostridium_phage	57.9	1.5e-26
WP_058372137.1|610040_611168_-|plate	baseplate J/gp47 family protein	plate	A0A2H4J7K8	uncultured_Caudovirales_phage	36.2	2.1e-52
WP_045144373.1|611174_611612_-	DUF2634 domain-containing protein	NA	A0A2H4J4Q8	uncultured_Caudovirales_phage	43.4	2.3e-23
WP_058372138.1|611604_611949_-	hypothetical protein	NA	A0A0A8WFG6	Clostridium_phage	42.7	2.6e-14
WP_058372223.1|611938_612916_-	hypothetical protein	NA	A0A2H4J063	uncultured_Caudovirales_phage	47.4	6.3e-74
WP_058372139.1|612964_613531_-	hypothetical protein	NA	L0P6F5	Lactobacillus_phage	37.6	9.1e-33
WP_081044151.1|613624_613786_+	ribbon-helix-helix domain-containing protein	NA	NA	NA	NA	NA
WP_058372140.1|613795_614278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372141.1|614648_615488_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_058372142.1|615525_619290_-|tail	phage tail tape measure protein	tail	A0A2H4J055	uncultured_Caudovirales_phage	33.2	1.2e-85
WP_058372143.1|619493_619988_-	XkdN	NA	A0A2H4J883	uncultured_Caudovirales_phage	39.7	1.7e-19
619917:619934	attL	TTCTTCATTTAATTTTTT	NA	NA	NA	NA
WP_003432463.1|620020_620440_-|tail	phage tail tube protein	tail	A0A2H4J032	uncultured_Caudovirales_phage	61.8	1.2e-42
WP_058372144.1|620457_621897_-|tail	phage tail sheath protein	tail	B6SBT7	Clostridium_virus	46.0	1.8e-109
WP_027635367.1|621896_622130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372145.1|622145_622967_-	hypothetical protein	NA	A0A2H4J4Q0	uncultured_Caudovirales_phage	53.1	2.1e-83
WP_002581889.1|622970_623396_-	hypothetical protein	NA	A0A2H4J736	uncultured_Caudovirales_phage	44.8	1.5e-24
WP_058372146.1|623400_623784_-	hypothetical protein	NA	A0A2H4J057	uncultured_Caudovirales_phage	51.6	4.0e-32
WP_003432470.1|623783_624104_-	hypothetical protein	NA	A0A2H4J040	uncultured_Caudovirales_phage	56.4	4.7e-26
WP_058372147.1|624106_624358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372148.1|624414_625470_-|capsid	phage capsid protein	capsid	D9ZND6	Clostridium_phage	49.7	2.0e-86
WP_058372149.1|625486_625891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372150.1|625919_626546_-|capsid	phage capsid protein	capsid	A0A0K2CP96	Brevibacillus_phage	35.0	5.2e-13
WP_081044152.1|626859_627168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003432485.1|629638_631183_-|portal	phage portal protein	portal	D9ZNC8	Clostridium_phage	51.7	1.7e-137
WP_058372153.1|632561_633209_-	hypothetical protein	NA	A0A2R4P8H7	Staphylococcus_phage	46.3	2.6e-52
WP_058372155.1|633764_634715_-|portal	phage portal protein	portal	A0A0A7RTY1	Clostridium_phage	40.5	2.3e-44
WP_058372156.1|635010_635199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372157.1|635320_635626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372158.1|635981_636554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372159.1|636609_637131_-	hypothetical protein	NA	A0A0A7RVS1	Clostridium_phage	34.3	2.1e-15
WP_058372160.1|637246_637501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372161.1|637484_637817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155594188.1|637813_637984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372162.1|637986_638286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033127229.1|638300_639302_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	28.9	4.3e-17
WP_058372163.1|639553_639763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155594189.1|640429_640570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372164.1|640598_641210_-	hypothetical protein	NA	A0A2H4J8I2	uncultured_Caudovirales_phage	39.5	2.0e-33
WP_058372165.1|641233_641503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372166.1|641525_642245_-	hypothetical protein	NA	A0A1L2BY85	Clostridium_phage	36.3	3.2e-30
WP_058372167.1|642288_642477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045144349.1|642481_642886_-	RusA family crossover junction endodeoxyribonuclease	NA	J9QE82	Clostridium_phage	40.8	5.3e-19
WP_058372168.1|642974_643280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045144347.1|643295_643571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372169.1|643571_644648_-	DUF3102 domain-containing protein	NA	A0A2H4J025	uncultured_Caudovirales_phage	43.4	4.6e-17
WP_058372170.1|644648_646238_-	hypothetical protein	NA	A0A2H4J8D4	uncultured_Caudovirales_phage	37.5	5.1e-73
WP_058372171.1|646251_646653_-	hypothetical protein	NA	A0A2H4J073	uncultured_Caudovirales_phage	35.4	3.7e-12
WP_003406460.1|646692_647037_-	hypothetical protein	NA	A0A0A7RTL9	Clostridium_phage	52.6	1.0e-23
WP_058372172.1|647014_647251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372173.1|647247_647595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372174.1|647610_648417_-	DNA replication protein	NA	A0A1B1P7U2	Bacillus_phage	33.5	4.2e-31
WP_058372175.1|648358_649201_-	DnaD domain protein	NA	C5J987	Streptococcus_phage	39.3	1.4e-29
WP_058372176.1|649354_650068_-	MBL fold metallo-hydrolase	NA	A0A1L2JY21	Aeribacillus_phage	43.9	1.1e-51
WP_058372177.1|650067_650958_-	recombinase RecT	NA	A0A1L2JY28	Aeribacillus_phage	42.4	6.8e-51
WP_058372178.1|650961_651147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372179.1|651146_653117_-	AAA family ATPase	NA	S0A069	Cellulophaga_phage	33.3	2.3e-75
WP_058372180.1|653590_653806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372181.1|653819_654347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372182.1|654354_654597_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A0K2CZ86	Paenibacillus_phage	56.4	3.8e-20
WP_033127217.1|654613_654814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003432559.1|654880_655105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058372183.1|655074_655647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003432570.1|655962_656262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372184.1|656265_656550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081044156.1|656551_657334_-	phage antirepressor protein	NA	A0A0A7RW33	Clostridium_phage	52.3	1.7e-66
WP_058372186.1|657361_657577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058372187.1|657767_658286_+	helix-turn-helix transcriptional regulator	NA	Q8SBN0	Clostridium_phage	53.5	1.2e-34
WP_058372188.1|658306_658792_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTX7	Clostridium_phage	42.6	1.1e-21
WP_058372189.1|658818_659901_+|integrase	site-specific integrase	integrase	A0A1P8VVR7	Streptococcus_phage	29.8	1.9e-23
WP_058141644.1|660832_662212_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
663381:663398	attR	TTCTTCATTTAATTTTTT	NA	NA	NA	NA
